Literature DB >> 26953931

Mobilization of Genomic Islands of Staphylococcus aureus by Temperate Bacteriophage.

Bo Youn Moon1,2, Joo Youn Park1, D Ashley Robinson3, Jonathan C Thomas4, Yong Ho Park2, Justin A Thornton5, Keun Seok Seo1.   

Abstract

The virulence of Staphylococcus aureus, in both human and animal hosts, is largely influenced by the acquisition of mobile genetic elements (MGEs). Most S. aureus strains carry a variety of MGEs, including three genomic islands (νSaα, νSaβ, νSaγ) that are diverse in virulence gene content but conserved within strain lineages. Although the mobilization of pathogenicity islands, phages and plasmids has been well studied, the mobilization of genomic islands is poorly understood. We previously demonstrated the mobilization of νSaβ by the adjacent temperate bacteriophage ϕSaBov from strain RF122. In this study, we demonstrate that ϕSaBov mediates the mobilization of νSaα and νSaγ, which are located remotely from ϕSaBov, mostly to recipient strains belonging to ST151. Phage DNA sequence analysis revealed that chromosomal DNA excision events from RF122 were highly specific to MGEs, suggesting sequence-specific DNA excision and packaging events rather than generalized transduction by a temperate phage. Disruption of the int gene in ϕSaBov did not affect phage DNA excision, packaging, and integration events. However, disruption of the terL gene completely abolished phage DNA packing events, suggesting that the primary function of temperate phage in the transfer of genomic islands is to allow for phage DNA packaging by TerL and that transducing phage particles are the actual vehicle for transfer. These results extend our understanding of the important role of bacteriophage in the horizontal transfer and evolution of genomic islands in S. aureus.

Entities:  

Mesh:

Substances:

Year:  2016        PMID: 26953931      PMCID: PMC4783081          DOI: 10.1371/journal.pone.0151409

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Genetic variation of bacteria can be achieved through mutations, rearrangements and horizontal gene transfers and recombinations. Increasing genome sequence data have demonstrated that, besides the core genes encoding house-keeping functions such as essential metabolic activities, information processing, and bacterial structural and regulatory components, a vast number of accessory genes encoding antimicrobial resistance, toxins, and enzymes that contribute to adaptation and survival under certain environmental conditions are acquired by horizontal gene transfer of mobile genetic elements (MGEs) [1, 2]. Mobile genetic elements are a heterogeneous group of molecules that include plasmids, bacteriophages, genomic islands, chromosomal cassettes, pathogenicity islands, and integrative and conjugative elements [2-4]. Genomic islands are relatively large segments of DNA ranging from 10 to 200 kb often integrated into tRNA gene clusters flanked by 16–20 bp direct repeats [3]. They are recognized as discrete DNA segments acquired by horizontal gene transfer since they can differ from the rest of the chromosome in terms of GC content (%G+C) and codon usage [3, 5]. Staphylococcus aureus is a major pathogen that colonizes the skin and mucous membranes of humans and animals, causing diseases ranging from mild skin infections to severe invasive diseases such as necrotizing pneumonia, infective endocarditis, and osteomyelitis [6-8]. The pathogenicity of this bacterium is largely influenced by the virulence genes carried on MGEs [9]. Three types of genomic islands (νSaα, νSaβ, νSaγ) are known in S. aureus [2]. Each type of genomic island is polymorphic in gene content but conserved within strain lineages [10-12]. Genomic islands are not as competently mobile as other MGEs, due to the lack of typical genetic elements required for or indicative of mobilization such as integrases, excisionases, terminases, and associated repeat sequences [13, 14]. While efficient mobilization of SaPIs by temperate helper phages has been well documented [15, 16], direct evidence indicating the mechanism of genomic island mobilization has not been well established. Previously, we reported the transfer of νSaβ by temperate phage ϕSaBov, which integrated immediately adjacent to the νSaβ [17]. The induction of ϕSaBov by mitomycin C generated transducing particles harboring overlapping segments of νSaβ in circular and linear forms of phage DNA, which appeared to be followed by sequential integration and homologous recombination events, resulting in transfer of entire ϕSaBov and νSaβ [17]. Here we demonstrate, for the first time, phage-mediated transfer of genomic islands νSaα and νSaγ, which are remotely located from ϕSaBov. Our results also showed that the genetic background of the host and recipient strains impact the ability and efficiency of transfer of MGEs mediated by bacteriophages, suggesting the presence of MGE-specific mechanisms of excision and integration from the donor and the recipient strains, respectively, in concert with functions from bacteriophages.

Materials and Methods

Bacterial strains and growth conditions

All strains and plasmids used in this study are listed in Table 1. Staphylococcus aureus strains were cultured in tryptic soy broth (TSB) or agar (TSA) plates (Difco) supplemented with tetracycline (5 μg/mL, Sigma-Aldrich) as necessary. Escherichia coli were grown in Luria-Bertani (LB) broth and agar plates supplemented with ampicillin (100 μg/mL, Sigma-Aldrich) as necessary. Twenty nine bovine mastitis isolates and 22 human isolates were kindly provided by QIA (Quarantine inspection agency, South Korea) and Patrick Schlievert (University of Iowa), respectively.
Table 1

A list of strains and plasmids used in this study.

StrainDescriptionReference or source
Staphylococcus aureus
RF122Bovine isolate, CC15126
RF122 set::tetMIndicative strain for transfer of νSaαThis study
RF122 hla::tetMIndicative strain for transfer of νSaγThis study
RF122 tst::tetMIndicative strain for transfer of SaPIbov1This study
RF122 mdr::tetMIndicative strain for transfer of SaPI122This study
RF122 int::tetMRF122 Δint[17]
RF122 set::tetM, int::catIndicative strain for transfer of νSaα in Δint background, RF122 Δint set::tetMThis study
RF122 hla::tetM, int::catIndicative strain for transfer of νSaγ in Δint background, RF122 Δint hla::tetMThis study
RF122 terL::tetMRF122 ΔterL[17]
RF122 ΔterL pMin164 terLComplementation of ΔterLThis study
Escherichia coli 
DH5αCloning host of pMAD and pMin164Life Technologies
Top10Cloning host of pCR4Life Technologies
Plasmid 
pMAD-CMGenerating deletion mutants[17]
pMAD-tetMtetM insertion for screening transduction[17]
pCR4-TOPOTA cloning vectorLife Technologies
pMin164High copy number vector for complementation[18]

Phage induction and transduction

Cultures were incubated at 37°C with 200 rpm until reaching mid-exponential phase, and then mitomycin C (1 μg/mL, Sigma-Aldrich) was added. Cultures were incubated at 30°C with 80 rpm until clear lysis was observed. The lysates were sterilized with syringe filers (0.22 μm, Nalgene). A phage spot test and the plaque-forming unit (PFU) were determined by soft agar (0.5%) overlay method. For transduction experiments, the recipient strains were cultured to mid-log phase and adjusted to approximately 2×107 CFU/mL. A phage solution containing approximately 108 PFU/mL was added to the culture, and incubated for 30 min at 30°C for the phage absorption, followed by addition of sodium citrate solution (100 mM, pH 4.5). After centrifuging at 4,000 rpm at 4°C for 15min, the pellet was suspended in sodium citrate solution and plated on TSA supplemented with tetracycline (5 μg/mL).

Phage DNA extraction

Phage DNA purification was performed as previously described [17]. Briefly, heterogeneous chromosomal DNA of E. coli K-12 was added to the culture lysates induced by mitomycin C as a control for verification of DNase treatment previously described [17]. Excessive amounts of DNase I (Sigma-Aldrich, 100 unit each) were added to remove chromosomal DNA. The phage particles were precipitated with NaCl (0.5 M final concentration) and polyethylene glycol 8000 (10%, wt/vol), followed by ultracentrifugation at 100,000 × g for 1 h. Phage DNA was extracted from the pellets using DNeasy kit (Qiagen) according to the manufacturers’ instructions.

PCR, outward PCR, and quantitative real time PCR

All primer pairs used in PCR, outward PCR, and quantitative real time PCR are listed in Table 2. PCR was performed to determine the presence of transducing phage particles harboring MGEs using primers specific to MGEs associated with strain RF122 including: νSaα (the set gene), νSaβ (the lukE gene), and νSaγ (the hla gene), SaPIbov1 (the tst gene), SaPI122 (the mdr gene), and ϕSaBov (the int gene). To estimate the frequency of transducing phage particles harboring MGEs, the absolute copy number of each MGE per nanogram of phage DNA was determined using quantitative real time PCR. Briefly, PCR products specific to MGEs (above) were cloned into pCR™4-TOPO® TA Vector (Life Technologies). Plasmids were quantified using a Nanodrop (Thermo Scientific) and the number of DNA copies/ng was calculated as described previously [19]. Quantitative real time PCR reaction was performed using SYBR green I master mix (Applied Biosystems) and a serial dilution of plasmid templates. Standard curves were generated by linear regression analysis calculating the slope, intercept, and correlation coefficient (R2) using Microcal OriginPro (Microcal origin, Version 7.5). Quantification of MGEs was calculated by interpolation the CT from the standard curve.
Table 2

A list of primers used in this study.

NameSequences (5' to 3')
Detection of Specific virulence gene in MGEs
intfCATCACTGGTGGACGCTTTG
intrAATGCATCGAGCGCTTTTTC
set1fGACAGTAGGCAAGCTGCGAAT
set1rTTTCTCTGCCGTCGATTGACT
lukEfTTTTTTTCCATCAGGCGTAACA
lukErACGAATGATTTGGCCATTCC
hlafGCACTTACTGACAATAGTGCC
hlarTCGCCACCTATATATACCGTTTC
tstfTGAATTTTTTTATCGTAAGCCCTTTG
tstrGGAAATGGATATAAGTTCCTTCGCT
mdrfCTTTTCCTAGAAGATACCGCAATGT
mdrrCCCATCCTTCGTGCGTTAGT
qRT-PCR
qintfCATCACTGGTGGACGCTTTG
qintrAATGCATCGAGCGCTTTTTC
qsetfAGACAAGAACGCACGCCTAAA
qsetrTTATGGTTGGAGATTGTGGTGTGT
qlukEfAGGTGGCAATGGCTCATTTA
qlukErTTGCTGAACCTGACGGACC
qhlafGGCCAGGCTAAACCACTTTTG
qhlarGCTAATGCCGCAGATTCTGA
qtstfTGAATTTTTTTATCGTAAGCCCTTTG
qtstrGGAAATGGATATAAGTTCCTTCGCT
qmdrfCTTTTCCTAGAAGATACCGCAATGT
qmdrrCCCATCCTTCGTGCGTTAGT
rnaIIIfTGAGTTATTAAGCCATCCCAACTTAA
rnaIIIrAAAATACATAGCACTGAGTCCAAGGA
hlgbfAGGTAAAATAACACCAGTCAGCGTAA
hlgbrTGGTGCATAATCAACGACGTTT
Selective marker
tetMfGCGCGTCGACGATCAAGAAACAAAGGCAACCCA
tetMrGCGCGAATTCTAGGACACAATATCCACTTGTAG
Allelic replacement of set, RF122 set::tetM
setupfGCGCGGATCCACGCCGAAAACTAAAGTGACA
setuprGCGCGTCGACTGCTAA ACTTGCTTTCGCAAT
setdnfGCGCGAATTCTTGAGTCTCTAAGAACGCCGA
setdnrGCGCAGATCTAAAGACATCAAGGCCATGTGT
dsetrTGCGTATAAACACCTGCGTCT
Allelic replacement of hla, RF122 hla::tetM
hlaupfGCGCGAATCCTTACCTCATATAGTGTCATG
hlauprGCGCGGTCGACGAAAGGTACCATTGCTGGTC
hladnfGCGCGGAATTCGTCAAATTAGAATATTGCAG
hladnrGCGCGAGATCTAATGCCTATAACTAA AAACC
dhlarAATGAATCCTGTCGCTAATGCC
Allelic replacement of tst, RF122 tst::tetM
tstupfGCGCGTCGACACCAATGCGGCAGTCGGTGAT
tstuprGCGCACGCGTATTGGAAAATAACAATGAATGACGGA
tstdnfGCGCGAATTCCACTACTATACCAGTCTAGCAAAT
tstdnrGCGCCCCGGGGTGTACCAACATCTTTAATTTCTTCA
dtstrAGTTCTATTGGAGTAGGTAATTTTTCAG
Allelic replacement of mdr, RF122 mdr::tetM
mdrupfGCGCGTCGACTAAACCTTAAACCCTCTAATTCAGT
mdruprGCGCACGCGTAGGAGTACTCATAACAGGTGTCGTTA
mdrdnfGCGCGAATTCTCTTAGATACTCCTCTTTGGTT
mdrdnrGCGCCCCGGGAATATTCGGAATAGGCTCGCAG
dmdrrTGGCCATAATCGCGCCAACGA
Generating integrase knock-out strain, RF122 Δint
IntupfGCGCGGATCCGCTCCTTTACGGAGCTTTAA
IntuprGCGCGTCGACAATAAGGGTAGGCGAGCTAC
IntdnfGCGCGAATTCGCATATCTTGGGAACGTTTC
IntdnrGCGCAGATCTAACAGAGAACATGTTGCTAC
Allelic replacement of hlgB, RF122 hlgB::tetM
hlgBupfGCGCGGATCCCATTCGTGCAATCGGTTACC
hlgBuprGCGCGTCGACAGCTAATCGATTTAGAATAG
hlgBdnfGCGCGAATTCGGCTTTGTGAAACCTAATCC
hlgBdnrGCGCAGATCTGGTCGTCACAATTACTGTG
dhlgBrAATGGCAGTATTACTAAG
Generating terminaseL knock-out strain, RF122 ΔterL
TerupfGCGCGGATCCTGTCAACATGGCTTTTTCTG
TeruprGCGCGTCGACTTGCTGAGGGTCTTGTGTTC
TerdnfGCGCGAATTCCTTTCCGACCACGGGTTAA
TerdnrGCGCAGATCTACGAAAGTTTGCCGGAAATA
Outwarding PCR 
pselfAGCGGTGTGATTCTGGTGAAT
p0342rTGGCGCACTCATCAAAGAGT
pSAB1912fTGG AAG AGA TTT TAT AAC TAA TTT TG
pSaPI122rCAG TGG GGA CAC CTG TGT AA
pIntfCGAGATTTAACGAGGGATAGG
p1702rTTGACACTAGCTTTCCGTTG
Verification of chromosomal DNA contamination in phage DNA preparation
waaQfTAAAGGTGCGGGAACTTTCG
waaQrAAGCGAGATCATCTGCCGAG
Complementation of terL
tercompfGCTAGGATCCATCGGACTCCGTCCCGTCAT
tercomprGCTAGAATTCAGACTACAAAGAGAATCCCG

Allelic exchange constructs

All PCR primer pairs used in allelic exchange constructs were listed in Table 2. The gene deletion mutants and the insertion of tetracycline resistance gene marker for screening transduction events were generated by allelic exchange using a modified pMAD-CM and pMAD-tetM temperature-sensitive shuttle vector system [17], respectively. Briefly, the gene fragment of upstream and downstream of target gene were cloned in pMAD-CM and pMAD-tetM. Resulting plasmids were electroporated to E. coli DH5α, and then to strain RF122. RF122 harboring the constructed plasmid were cultured at 43°C (non-permissive temperature for the replication of pMAD) to promote the first homologous recombination, followed by culturing 37°C to promote the second recombination, resulting in allelic exchange.

Phage and bacterial genomic DNA sequencing and analysis

Phage capsid DNA was isolated as described above, and bacterial genomic DNA was isolated with a DNeasy kit according to the manufacturer’s instructions (Qiagen). The dsDNA was quantified with a Qubit HS Assay Kit (Invitrogen). Indexed, paired-end libraries were prepared with a Nextera XT DNA Sample Preparation Kit (Illumina). Libraries were cleaned with 1.2× AMPure XP beads (Agencourt) and sequenced using a 300 cycle MiSeq Reagent Kit v2 on an Illumina MiSeq instrument (Illumina). CLC Genomics Workbench v6 software was used to trim and filter reads for quality and to assemble reads de novo. Recombined regions among the RF122 donor (GenBank NC_007622), CTH96 recipient, and transductants were identified through local alignments.

Results

Transducing phage particles induced from RF122 harbor mobile genetic elements (MGEs)

To investigate the possibility that transducing phage particles induced from strain RF122 harbor genes uniquely associated with MGEs, PCR was performed using phage DNA extracted from RF122 following mitomycin C treatment. To ensure the removal of RF122 chromosomal DNA, exogenous E. coli chromosomal DNA was added to the phage-induced lysates and treated with an excessive amount of DNase I. A PCR targeting the waaQ gene of E. coliwas performed to confirm the removal of chromosomal DNA in the phage DNA preparation (Fig 1A). Results of PCR revealed that transducing phage particles induced from RF122 harbor genes associated with MGEs including genomic islands νSaα (the set gene), νSaβ (the lukE gene), and νSaγ (the hla gene), SaPIbov1 (the tst gene), SaPI122 (the mdr gene), and ϕSaBov (the int gene) (Fig 1B). The genes not belonging to MGE (hlgB and rnaIII) were not detected (Fig 1C). The SaPIbov1and ϕSaBov bordered with direct repeat sequences generated amplification products in outward PCR indicating a circular form of phage DNA. Sequencing of amplification products further confirmed these findings (data not shown). The SaPI122, not bordered with direct repeat sequence did not generate an amplification product suggesting a linear form of phage DNA, as expected for cos-type of sticky-end linear molecules (Fig 1D).
Fig 1

The presence of MGEs in transducing particles induced from the RF122 strain.

(A) Verification of chromosomal DNA removal in preparation of phage DNA by adding exogenous chromosomal DNA of E. coli, followed by the treatment with DNase. The presence of MGEs in the phage DNA from transducing particles induced from the RF122 strain was analyzed by PCR amplification using primers specific to (B) MGEs; νSa (set), νSaβ (lukE), νSaγ (hla), SaPIbov1 (tst), SaPI122 (mdr), ϕSaBov (int) and (C) non-MGE (rnaIII, hlgB). (D) Outward PCR analysis of circularization of MGEs flanked with the direct repeat sequence; SaPIbov1, SaPI122, and ϕSaBov.

The presence of MGEs in transducing particles induced from the RF122 strain.

(A) Verification of chromosomal DNA removal in preparation of phage DNA by adding exogenous chromosomal DNA of E. coli, followed by the treatment with DNase. The presence of MGEs in the phage DNA from transducing particles induced from the RF122 strain was analyzed by PCR amplification using primers specific to (B) MGEs; νSa (set), νSaβ (lukE), νSaγ (hla), SaPIbov1 (tst), SaPI122 (mdr), ϕSaBov (int) and (C) non-MGE (rnaIII, hlgB). (D) Outward PCR analysis of circularization of MGEs flanked with the direct repeat sequence; SaPIbov1, SaPI122, and ϕSaBov. To estimate the frequency of transducing phage particles harboring MGEs, the absolute copy number of each MGE per nanogram of the phage DNA was interpolated from a standard curve generated using quantitative real time PCR (data not shown). The copy number of the ϕSaBov was the highest (8.51 Log10 copies/ng phage DNA), followed by νSaβ (5.25 Log10 copies/ng phage DNA). The copy numbers of νSaα, νSaγ, SaPIbov1, and SaPI122 were lower than the ϕSaBov and νSaβ, and ranged between 1.64–3.00 Log10 copies/ng phage DNA (Fig 2).
Fig 2

Estimation of the absolute copy number of MGEs in phage DNA using quantitative real time PCR.

Sequence analysis of phage DNA

The DNA sequences from phage capsids were determined in order to identify and map the location of the RF122 chromosomal DNA packed into transducing phage particles. A total of 47 contigs (>500 bp) were assembled which clustered in MGEs including νSaα, νSaβ, SaPIbov1, SaPI122, and ϕSaBov, except for a single short contig at SAB1107-8 not known to be located on MGEs (Fig 3). The ϕSaBov was assembled in a single contig, while other MGEs contained multiple contigs ranging 6–23 contigs. A contig corresponding to νSaγ was not found in phage DNA sequencing, which might be due to the low copy number of the νSaγ regions as shown in quantitative real time PCR. These results suggest that the mechanism of excision and packaging of phage DNA is specific to MGEs, rather than a generalized transduction mechanism, which would result in random excision and packaging of host chromosomal DNA.
Fig 3

A schematic map of contigs determined from Illumina MiSeq analysis of phage DNA.

A red box indicates the location and number of contigs detected from sequencing analysis of phage DNA. A white box indicates the location of MGEs (Sa,Sa, Saγ, SaPIbov1, SaPI122, ϕSaBov) present in the RF122 chromosome.

A schematic map of contigs determined from Illumina MiSeq analysis of phage DNA.

A red box indicates the location and number of contigs detected from sequencing analysis of phage DNA. A white box indicates the location of MGEs (Sa,Sa, Saγ, SaPIbov1, SaPI122, ϕSaBov) present in the RF122 chromosome.

Transfer of MGEs by transducing phage particles induced from RF122

Results of PCR and phage DNA sequencing demonstrated the presence of phage particles harboring MGEs in the RF122 strain. To test the transfer of MGEs by these transducing phage particles to other S. aureus, the tetM gene, conferring tetracycline resistance, was introduced into the MGEs as depicted in Fig 4A by homologous recombination using a modified pMAD system. The insertion of the tetM gene was confirmed by PCR (Fig 4B). The transfer of MGEs was successful mostly in the ST151 lineage (Table 3). Other than ST151 strains, νSaα and SaPIbov1 were transferred only to ST1-SCCmecIV and ST398, respectively. Interestingly, among the ST151 strains, SaPIbov1 was only transferred to recipients (RF114, 38963, CI2135) which do not have SaPIbov1 in the genome. SaPIbov1 was not transferred to the recipients (CTH96, RF113, DS102) which have pre-existing SaPIbov1 in the genome. We also inserted the tetM gene into the non-MGE gene (hlgB) to test random excision and packaging of phage DNA as in true generalized transduction, but transduction was not observed even with the recipients belonging to the ST151 lineage (data not shown).
Fig 4

Schematic maps of the tetM gene insertion in the MGEs present in the RF122 strain.

(A) The tetM gene was inserted into the MGEs present in the RF122 strain, including νSaα, νSaγ, SaPIbov1 and SaPI122, resulting RF122 set::tetM, RF122 hla::tetM, RF122 tst::tetM, and RF122 mdr::tetM, respectively. (B) The insertion of tetM was confirmed by PCR using primer sets designed to present a negative result in the insertional mutants, compared to the RF122 wild type strain (WT).

Table 3

Transduction frequencies of mobile genetic elements.

Recipient OriginRecipient GenotypesStrainMGE
νSaανSaγSaPIbov1SaPI122
aBovine (29)ST151 b(6/6)CTH96c1.30×10−68.00×10−7NoneNone
 RF1131.65×10−57.00×10−7None2.43×10−6
  RF1141.10×10−61.40×10−63.60×10−7None
  389632.70×10−61.00×10−63.10×10−7None
  CI21352.70×10−61.50×10−64.00×10−8None
  DS1023.50×10−6NoneNoneNone
 ST1 (0/3) NoneNoneNoneNone
 ST188 (0/8) NoneNoneNoneNone
 ST20 (0/5) NoneNoneNoneNone
 ST72 (0/4) NoneNoneNoneNone
ST398 (1/3)K31NoneNone4.5×10−7None
Human (22)ST1-SCCmecIV (3/7)MW22.00×10−8NoneNoneNone
 MN KN3.10×10−7NoneNoneNone
  C99-5291.00×10−8NoneNoneNone
  C99-193NoneNoneNoneNone
  MN GaryNoneNoneNoneNone
  MN AskNoneNoneNoneNone
  MN MANoneNoneNoneNone
 ST8-SCCmecIV (0/7) NoneNoneNoneNone
 ST36-SCCmecII (0/8) NoneNoneNoneNone

aThe number of tested strains is in parenthesis.

bThe number of strains transduced with any MGE/the number of strains tested.

cTransduction frequencies (CFU/pfu)

Schematic maps of the tetM gene insertion in the MGEs present in the RF122 strain.

(A) The tetM gene was inserted into the MGEs present in the RF122 strain, including νSaα, νSaγ, SaPIbov1 and SaPI122, resulting RF122 set::tetM, RF122 hla::tetM, RF122 tst::tetM, and RF122 mdr::tetM, respectively. (B) The insertion of tetM was confirmed by PCR using primer sets designed to present a negative result in the insertional mutants, compared to the RF122 wild type strain (WT). aThe number of tested strains is in parenthesis. bThe number of strains transduced with any MGE/the number of strains tested. cTransduction frequencies (CFU/pfu) To further confirm the transfer of MGEs, a draft genome sequence of a recipient (CTH96) and transductants (CTH96 νSaα transductant and CTH96 νSaγ transductant) was determined. Based on single nucleotide polymorphisms (SNPs) and the tetM gene found in the CTH96 νSaα transductant, approximately 27,162 bp of νSaα was transferred from donor to recipient, ranging from SAB0378 to SAB0403 and including a part of the set gene locus, hsdM, hsdS, and the lip gene locus (Fig 5A). The sequence comparison of the CTH96 νSaγ transductant suggested that approximately 28,000 bp of νSaγ was transferred from donor to recipient, ranging from SAB1002 to SAB1029 and including phenylalanyl-tRNA synthetase (pheT), excinuclease ABC subunit C (uvrC), recombination and DNA strand exchange inhibitor protein (mutS2), ribonuclease III (rnc), succinate dehydrogenase (sdh), extracellular fibrinogen binding protein (efb), and the hla gene (Fig 5B).
Fig 5

A schematic map of sequence alignments among RF122 (donor), CTH96 (recipient), and CTH96 transductants of phage induced from RF122 set::tetM (A) and RF122 hla::tetM (B). White brackets indicated the identical sequence between CTH96 transductant and RF122 donor, suggesting gene transfer from RF122 to CTH96. The shading between the entries represents the percent identity (BLASTn) from 68% (light gray) to 100% (dark gray) using Easyfig.

A schematic map of sequence alignments among RF122 (donor), CTH96 (recipient), and CTH96 transductants of phage induced from RF122 set::tetM (A) and RF122 hla::tetM (B). White brackets indicated the identical sequence between CTH96 transductant and RF122 donor, suggesting gene transfer from RF122 to CTH96. The shading between the entries represents the percent identity (BLASTn) from 68% (light gray) to 100% (dark gray) using Easyfig.

The role of integrase and terminase on ϕSaBov in the transfer of MGEs

The integrase and terminase encoded in MGEs, including bacteriophages and SaPIs, are important for phage DNA excision, packaging, and integration, in concert with other factors derived from the donor or recipient [15]. However, the integrase and terminase were not present in the genomic islands νSaα and νSaγ. To test the involvement of the integrase (int) and terminase large subunit (terL) encoded by ϕSaBov in the transfer of these genomic islands, the int or terL gene was deleted in the RF122 strain. PCR analysis of phage DNA extracted from these strains showed that disruption of the terL gene completely abrogated phage DNA packaging, which could be restored by complementation of terL (Fig 6A). In contrast, disruption of the int gene did not affect DNA packaging (Fig 6B) nor the transfer of νSaα and νSaγ (Table 4). These results indicate that packaging of genomic islands in ϕSaBov is dependent on the terminase, but does not require integrase.
Fig 6

The roles of terminase large subunit (TerL) and intergrase (Int) on phage DNA excision and packaging.

The terminase large subunit knock-out and integrase knock-out strains were generated from the RF122 strain by allelic replacement. The presence of MGEs in the phage DNA was analyzed by PCR with primers specific to each MGEs; νSaα (set), νSaβ (lukD), νSaγ (hla), SaPIbov1 (tst), and SaPI122 (mdr). A disruption of the TerL completely abolished the phage DNA packaging events. A complementation of TerL by pMin164 terL restored the phage DNA packaging events. (B) A disruption of the Int did not affect the phage DNA packaging events.

Table 4

The role of the integrase encoded in the ϕSaBov on transduction frequencies of MGEs.

RF122RF122Δint
Recipient strainsνSaανSaγνSaανSaγ
CTH96a1.45×10−67.60×10−71.50×10−62.00×10−7
RF1131.85×10−57.20×10−71.70×10−61.30×10−7
RF1141.30×10−61.50×10−61.00×10−62.10×10−7
389632.50×10−61.20×10−62.00×10−61.50×10−7
CI21352.90×10−61.40×10−62.50×10−62.00×10−7
DS1023.90×10−6None4.00×10−6None

aTransduction frequencies (CFU/pfu)

The roles of terminase large subunit (TerL) and intergrase (Int) on phage DNA excision and packaging.

The terminase large subunit knock-out and integrase knock-out strains were generated from the RF122 strain by allelic replacement. The presence of MGEs in the phage DNA was analyzed by PCR with primers specific to each MGEs; νSaα (set), νSaβ (lukD), νSaγ (hla), SaPIbov1 (tst), and SaPI122 (mdr). A disruption of the TerL completely abolished the phage DNA packaging events. A complementation of TerL by pMin164 terL restored the phage DNA packaging events. (B) A disruption of the Int did not affect the phage DNA packaging events. aTransduction frequencies (CFU/pfu) In pac-type phages, the terminase small subunit (TerS) recognizes and binds to the phage-specific packaging (pac) site typically located in or near to the terL gene that initiates a hetero-oligomer complex with TerL resulting in headful phage DNA packaging [15, 20, 21]. Analysis of phage DNA sequence showed an 11 bp consensus sequence present in ϕSaBov, νSaα, and νSaγ (Fig 7), suggesting that MGE-specific phage DNA packaging by ϕSaBov might result from the recognition of pac sites in the MGE by TerS that induce the headful packaging mechanism in concert with TerL and other factors in the ϕSaBov.
Fig 7

An 11 bp consensus sequence identified near to the terL gene using MEME (http://meme-suite.org/index.html) was conserved in MGEs packaged in the transducing phage particles.

Putative pac site in MGEs. Sequence logos separated with colors indicated the frequencies scaled relative to the conservation at each position.

An 11 bp consensus sequence identified near to the terL gene using MEME (http://meme-suite.org/index.html) was conserved in MGEs packaged in the transducing phage particles.

Putative pac site in MGEs. Sequence logos separated with colors indicated the frequencies scaled relative to the conservation at each position.

Discussion

A transfer of MGEs by temperate phages requires a series of successful sequential events including excision from the host genome, packaging into transducing phage particles, transfer to a recipient and integration into the recipient genome. To investigate phage DNA excision events, phage DNA analysis using PCR and sequencing was performed. These results revealed that phage DNA excision events by ϕSaBov are highly specific to chromosomal locations of MGEs, suggesting a mechanism of sequence-specific excision events. It has been shown elsewhere that a typical pac-type phage DNA excision event is highly specific to the direct repeat sequence recognized by the integrase, excisionase, and terminase small unit [15, 21]. For MGEs, such as ϕSaBov and SaPIbov1, that are flanked by direct repeat sequences, phage DNA excision events occurred at the direct repeat sequence and formed a circular form of phage DNA. This process was likely controlled by their own integrase, excisionase, and terminases. For MGEs not flanked by direct repeat sequences, including νSaα and νSaγ, phage DNA excision events occurred at various locations within these genomic islands. νSaα and νSaγ do not possess annotated genes for excision events such as integrase, excisionase, and terminase, so phage DNA excision events in these MGEs might be controlled by other elements associated with SaPIs, transposases, integrative and conjugative elements in the host background. To support this possibility, the RN4220 harboring ϕSaBov, which has a different background of integrase, transposases, and integrative and conjugative elements than RF122 and lacks MGEs such as SaPIbov1, SaPI122, did not generate transducing phage particles harboring MGEs (data not shown). As determined by PCR and DNA sequence analysis of phage DNA, transduction events are specific to MGEs rather than the random events that are expected from generalized transduction. A recent study demonstrated that the TerS encoded by SaPIs induced sequence-specific excision and packaging of phage DNA at unlinked chromosomal segments [15]. In our current study, sequence analysis of MGEs present in transducing particles revealed potential consensus sequences in these MGEs which might mediate DNA excision/packaging events by TerS encoded in the ϕSaBov, SaPIbov1 or SaPI122. Currently, the role of TerS and these potential consensus sequences on horizontal gene transfer is under investigation. A higher frequency of MGE transfer by ϕSaBov was observed with recipient strains belonging to ST151 than with other strain lineages. These results suggest that the host specificity of phage might be a primary barrier in the transfer of MGE by phage. The host specificity of phage is expected to be determined by interactions between the tail proteins of phage and the target molecules in recipient cells such as proteins and wall teichoic acid (WTA) which were generally conserved in the core genome of the same or related lineages of strain [22-25]. As such, strains belonging to ST151 lineage commonly express receptors to ϕSaBov and thereby become more susceptible to transduction. Interestingly, SaPIbov1 was not transferred to ST151 recipients that already possess SaPIbov1 in the genome. This observation is not likely superinfection immunity due to lysogenic phages since phage was not induced by mitomycin C treatment in these recipient strains [26]. It is possible that the conserved transcriptional regulators in the SaPIs, such as stl and str [27, 28], might negatively regulate transcription of elements required for the integration of the SaPIbov1. To confirm the transfer of MGEs by ϕSaBov, a draft genome sequence of the transductants for νSaα and νSaγ was determined. The extent of the transfer of MGEs was estimated by comparing single nucleotide polymorphisms and the presence of the tetM gene among donors, recipients, and transductants. Based on these comparisons, it was hypothesized that linear phage DNA segments harboring parts of νSaα and νSaγ were transferred, rather than a transfer of a single contig harboring entire νSaα or νSaγ. This result supports findings that the overall structure of genomic islands can vary as a result of “plug and play” type of recombinational replacements [29]. To our knowledge, this is the first report to demonstrate a mobilization of νSaα and νSaγ. Although the hla gene was largely thought to have evolved with the core chromosome of S. aureus, recombination events are evident in some strains [30, 31]. Our results suggest one mechanism by which the hla gene could be horizontally transferred among S. aureus strains. Our previous study demonstrated that the int gene encoded by the ϕSaBov is required for integration of phage DNA harboring ϕSaBov and νSaβ into recipient genome, but not for phage DNA excision events of ϕSaBov and νSaβ [17]. Further, the terL encoded in the ϕSaBov is required for packaging phage DNA of ϕSaBov and νSaβ [17]. Similarly, in this study, the int gene encoded by ϕSaBov is not required for phage DNA excision events in νSaα and νSaγ nor for the integration into recipient genome. However, the terL is essential for packaging into transducing phage particles. These results suggest the major role of temperate phage in transfer of νSaα and νSaγ is to package DNA and shuttle it via transducing phage particles. Although it has long been acknowledged that bacteriophages contribute the horizontal transfer of MGEs by generalized and specialized transduction, the causal link to the transfer of genomic islands by bacteriophages or other means has not been established. In this study, for the first time, we present experimental evidence demonstrating transfer of genomic islands by a temperate phage utilizing MGE-specific DNA excision events from the host genome and presumably recipient-derived factors for integration. These results represent the complexity of underlying mechanism of phage-bacterial interaction in horizontal gene transfer and extend our understanding of the important role of bacteriophage in the horizontal transfer and evolution of genomic islands in S. aureus.
  31 in total

1.  Real-time reverse transcriptase-polymerase chain reaction (RT-PCR) for measurement of cytokine and growth factor mRNA expression with fluorogenic probes or SYBR Green I.

Authors:  J L Yin; N A Shackel; A Zekry; P H McGuinness; C Richards; K V Putten; G W McCaughan; J M Eris; G A Bishop
Journal:  Immunol Cell Biol       Date:  2001-06       Impact factor: 5.126

Review 2.  Genomic islands in pathogenic and environmental microorganisms.

Authors:  Ulrich Dobrindt; Bianca Hochhut; Ute Hentschel; Jörg Hacker
Journal:  Nat Rev Microbiol       Date:  2004-05       Impact factor: 60.633

Review 3.  DNA packaging in dsDNA bacteriophages.

Authors:  L W Black
Journal:  Annu Rev Microbiol       Date:  1989       Impact factor: 15.500

4.  Insights on evolution of virulence and resistance from the complete genome analysis of an early methicillin-resistant Staphylococcus aureus strain and a biofilm-producing methicillin-resistant Staphylococcus epidermidis strain.

Authors:  Steven R Gill; Derrick E Fouts; Gordon L Archer; Emmanuel F Mongodin; Robert T Deboy; Jacques Ravel; Ian T Paulsen; James F Kolonay; Lauren Brinkac; Mauren Beanan; Robert J Dodson; Sean C Daugherty; Ramana Madupu; Samuel V Angiuoli; A Scott Durkin; Daniel H Haft; Jessica Vamathevan; Hoda Khouri; Terry Utterback; Chris Lee; George Dimitrov; Lingxia Jiang; Haiying Qin; Jan Weidman; Kevin Tran; Kathy Kang; Ioana R Hance; Karen E Nelson; Claire M Fraser
Journal:  J Bacteriol       Date:  2005-04       Impact factor: 3.490

5.  The gene for toxic shock toxin is carried by a family of mobile pathogenicity islands in Staphylococcus aureus.

Authors:  J A Lindsay; A Ruzin; H F Ross; N Kurepina; R P Novick
Journal:  Mol Microbiol       Date:  1998-07       Impact factor: 3.501

Review 6.  Pathogenicity islands in bacterial pathogenesis.

Authors:  Herbert Schmidt; Michael Hensel
Journal:  Clin Microbiol Rev       Date:  2004-01       Impact factor: 26.132

7.  Immunobiologic and biochemical properties of mutants of toxic shock syndrome toxin-1.

Authors:  D L Murray; G S Prasad; C A Earhart; B A Leonard; B N Kreiswirth; R P Novick; D H Ohlendorf; P M Schlievert
Journal:  J Immunol       Date:  1994-01-01       Impact factor: 5.422

Review 8.  Staphylococcus aureus α-toxin: nearly a century of intrigue.

Authors:  Bryan J Berube; Juliane Bubeck Wardenburg
Journal:  Toxins (Basel)       Date:  2013-06       Impact factor: 4.546

9.  Molecular correlates of host specialization in Staphylococcus aureus.

Authors:  Lisa Herron-Olson; J Ross Fitzgerald; James M Musser; Vivek Kapur
Journal:  PLoS One       Date:  2007-10-31       Impact factor: 3.240

10.  Wall teichoic acid structure governs horizontal gene transfer between major bacterial pathogens.

Authors:  Volker Winstel; Chunguang Liang; Patricia Sanchez-Carballo; Matthias Steglich; Marta Munar; Barbara M Bröker; Jose R Penadés; Ulrich Nübel; Otto Holst; Thomas Dandekar; Andreas Peschel; Guoqing Xia
Journal:  Nat Commun       Date:  2013       Impact factor: 14.919

View more
  13 in total

1.  Transposase-Mediated Excision, Conjugative Transfer, and Diversity of ICE6013 Elements in Staphylococcus aureus.

Authors:  Emily A Sansevere; Xiao Luo; Joo Youn Park; Sunghyun Yoon; Keun Seok Seo; D Ashley Robinson
Journal:  J Bacteriol       Date:  2017-03-28       Impact factor: 3.490

2.  Induction of Immunosuppressive CD8+CD25+FOXP3+ Regulatory T Cells by Suboptimal Stimulation with Staphylococcal Enterotoxin C1.

Authors:  Juyeun Lee; Nogi Park; Joo Youn Park; Barbara L F Kaplan; Stephen B Pruett; Juw Won Park; Yong Ho Park; Keun Seok Seo
Journal:  J Immunol       Date:  2017-12-13       Impact factor: 5.422

Review 3.  Staphylococci on ICE: Overlooked agents of horizontal gene transfer.

Authors:  Emily A Sansevere; D Ashley Robinson
Journal:  Mob Genet Elements       Date:  2017-08-22

4.  Large Preferred Region for Packaging of Bacterial DNA by phiC725A, a Novel Pseudomonas aeruginosa F116-Like Bacteriophage.

Authors:  Christine Pourcel; Cédric Midoux; Yolande Hauck; Gilles Vergnaud; Libera Latino
Journal:  PLoS One       Date:  2017-01-06       Impact factor: 3.240

5.  Comparative Genome Analyses of Vibrio anguillarum Strains Reveal a Link with Pathogenicity Traits.

Authors:  Daniel Castillo; Paul D Alvise; Ruiqi Xu; Faxing Zhang; Mathias Middelboe; Lone Gram
Journal:  mSystems       Date:  2017-02-28       Impact factor: 6.496

6.  Genetic engineering of a temperate phage-based delivery system for CRISPR/Cas9 antimicrobials against Staphylococcus aureus.

Authors:  Joo Youn Park; Bo Youn Moon; Juw Won Park; Justin A Thornton; Yong Ho Park; Keun Seok Seo
Journal:  Sci Rep       Date:  2017-03-21       Impact factor: 4.379

Review 7.  Phage Therapy: What Have We Learned?

Authors:  Andrzej Górski; Ryszard Międzybrodzki; Małgorzata Łobocka; Aleksandra Głowacka-Rutkowska; Agnieszka Bednarek; Jan Borysowski; Ewa Jończyk-Matysiak; Marzanna Łusiak-Szelachowska; Beata Weber-Dąbrowska; Natalia Bagińska; Sławomir Letkiewicz; Krystyna Dąbrowska; Jacques Scheres
Journal:  Viruses       Date:  2018-05-28       Impact factor: 5.048

8.  Genomic islands and the evolution of livestock-associated Staphylococcus aureus genomes.

Authors:  Relangi Tulasi Rao; Shivani Sharma; Natesan Sivakumar; Kannan Jayakumar
Journal:  Biosci Rep       Date:  2020-11-27       Impact factor: 3.840

9.  Characteristics for phage-encoded cell wall hydrolase of LysSAP27 to reduce staphylococcal food poisoning.

Authors:  Do-Won Park; Young-Duck Lee; Jong-Hyun Park
Journal:  Food Sci Biotechnol       Date:  2021-05-11       Impact factor: 2.391

10.  Genomic Analysis of Pasteurella atlantica Provides Insight on Its Virulence Factors and Phylogeny and Highlights the Potential of Reverse Vaccinology in Aquaculture.

Authors:  Rebecca Marie Ellul; Panos G Kalatzis; Cyril Frantzen; Gyri Teien Haugland; Snorre Gulla; Duncan John Colquhoun; Mathias Middelboe; Heidrun Inger Wergeland; Anita Rønneseth
Journal:  Microorganisms       Date:  2021-06-04
View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.