Literature DB >> 26949945

Association Analysis of Myosin Heavy-chain Genes mRNA Transcription with the Corresponding Proteins Expression of Longissimus Muscle in Growing Pigs.

X M Men, B Deng, X Tao, K K Qi, Z W Xu.   

Abstract

The goal of this work was to investigate the correlations between MyHC mRNA transcription and their corresponding protein expressions in porcine longissimus muscle (LM) during postnatal growth of pigs. Five DLY (Duroc×Landrace×Yorkshire) crossbred pigs were selected, slaughtered and sampled at postnatal 7, 30, 60, 120, and 180 days, respectively. Each muscle was subjected to quantity MyHCs protein contents through an indirect enzyme-linked immunosorbent assay (ELISA), to quantity myosin heavy-chains (MyHCs) mRNA abundances using real-time polymerase chain reaction. We calculated the proportion (%) of each MyHC to total of four MyHC for two levels, respectively. Moreover, the activities of several key energy metabolism enzymes were determined in LM. The result showed that mRNA transcription and protein expression of MyHC I, IIa, IIx and IIb in LM all presented some obvious changes with postnatal aging of pigs, especially at the early stage after birth, and their mRNA transcriptions were easy to be influenced than their protein expressions. The relative proportion of each MyHC mRNA was significantly positively related to that of its corresponding protein (p<0.01), and MyHC I mRNA proportion was positively correlated with creatine kinase (CK), succinate dehydrogenase (SDH), malate dehydrogenase (MDH) activities (p<0.05). These data suggested that MyHC mRNA transcription can be used to reflect MyHC expression, metabolism property and adaptive plasticity of porcine skeletal muscles, and MyHC mRNA composition could be a molecular index reflecting muscle fiber type characteristics.

Entities:  

Keywords:  Gene Expression; Myofiber Types; Myosin Heavy-chain; Porcine Muscle

Year:  2016        PMID: 26949945      PMCID: PMC4782079          DOI: 10.5713/ajas.15.0259

Source DB:  PubMed          Journal:  Asian-Australas J Anim Sci        ISSN: 1011-2367            Impact factor:   2.509


INTRODUCTION

Mammalian skeletal muscle fibers are characterized by their morphological traits such as total number of fibers (TNF) and cross-sectional area of fibers (CSAF), and fiber type characteristics, such as contractile, and metabolic properties (Lee et al., 2010). During the postnatal growth process of pigs, there are no changes in TNF while the CSAF within muscle increases with aging. Fiber type characteristics can also change to accommodate a myriad of environmental cues (Gunawan et al., 2007), which contribute to variations of pork quality (Joo et al., 2013). Myosin heavy-chain (MyHC) is a major contractile apparatus in mammalian skeletal muscles, and consists of different types of protein isoforms. According to MyHC isoform composition, four different types of muscle fiber exists in adult porcine muscle, including slow-oxidative, fast-oxidative, intermediate and fast-glycolytic myofibres (Schiaffino et al., 1989). Compared with MyHC protein expression, studying MyHC mRNA transcription is more beneficial in understanding the transamination mechanism among different fiber types, and the corresponding quantitative technique is also more valuable to identify changes in MyHC mRNA level (Jankala et al., 1997). However, not all of genes are controlled at the transcriptional level, the expression of some genes is also regulated by posttranscriptional regulation processes such as mRNA stability, translation initiation, and protein stability (Chen et al., 2002; Tian et al., 2004). Although MyHC mRNA transcription and protein expression are both used to reflect fiber type characteristics in porcine muscle (Schiaffino and Reggiani, 1996; Botinelli and and Reggiani, 2000; Spangenburg and Booth, 2003), further verification is required to determine whether MyHC mRNA transcription can reflect fiber type characteristics, especially in porcine muscles. At present, little researches has been carried out on the relationship between MyHC mRNA and the corresponding protein in muscle during postnatal growth process of pigs. One major purpose of the present work is to reveal the correlations between MyHC mRNA transcription and the corresponding protein expression, through determining their dynamic changes in muscle during postnatal development and aging of pigs, and to develop an index reflecting muscle fiber type characteristics. These results would be a benefit for further utilizing MyHC to research porcine muscle fiber type characteristics on molecular level, and may provide potential ways to improve pork quality during postnatal growth.

MATERIALS AND METHODS

Animals, housing, and experimental design

All procedures for the care and use of pigs were approved by the animal ethics committee of Zhejiang Academy of Agricultural Science, China. We selected 25 male DYL (Duroc×Yorkshire×Landrace) newborn piglets from five litters (five pigs each litter) fed in Lvjia Yuan Livestock Industry Co., Ltd, Zhejiang Province, China. According to the nutritional requirement recommended by NRC (1998), these pigs were creep fed after birth with a creep diet, and weaned on day 28, successively fed until 180-day age. All pigs were housed in a barn with enough space and given a free choice access to diets and tap water. In order to reveal the effects of postnatal growth stages on MyHC expression, we selected several key ages including postnatal 7 days (2.50±0.15 kg, representing the primary stage of piglets), 30 days (10.00±0.50 kg, representing the beginning of weaning stage), 60 days (20.00±0.55 kg, representing the last nursing stage), 120 days (60.00±0.45 kg, representing the end of growing stage) and 180 (100.00±0.60 kg, representing the end of finishing stage) days, and five pigs of each stage were slaughter and sampled. These stages can reflect the changing physiological and in vitro environment of pigs during postnatal growth process, including muscle fiber characteristics.

Sampling longissimus muscle

According to the commercial live pig slaughtering rules in China, the pigs ready for slaughter were kept off feed and given a free access to tap water for 16 hours, and then killed through electrical stunning and exsanguination. About 5-cm-thick longissimus muscle (LM) adjacent to the last rib was collected from the left side of the carcass within 30 min after exsanguination, and was rapidly frozen in liquid nitrogen and then stored in −80°C until analysis.

Analysizing protein expressions of four adult MyHC genes in longissimus muscle

Myosion protein was extracted as described by Savolainen et al. (1995). About 200-mg LM tissue from each pig was powered in liquid nitrogen, and oscillated while added to 1.4 mL buffer solution pH 6.5 containing 0.3 M KCl, 0.1 M KH2PO4, 0.05 M K2HPO4, 0.04 M ethylenediaminetetraacetic acid disodium salt. The extracted mix was placed in ice bath for 15 min, and the supernatant was collected by centrifuging at 3,000×g for 10 min at 4°C. A 100-μL aliquot of supernatant was taken to measure total protein concentration with a protein assay kit (micro BCA, Shanghai Sangon Biological Engineering Technology and Services Co., Ltd., Shanghai, China). The concentration of each MyHC was determined by an USCNLIFETM ELISA kit produced by Wuhan EIAab Technology Co., Ltd, Wuhan, China. The recombinant protein of each MyHC with different concentrations (0, 15, 30, 60, 120, 240, 480, and 960 pg/mL) as a quality control was used to establish a linear regression equation for a quantitative assay. 100-μL supernatant or the quality controls and 50 μL labeling mouse anti-pig IgG with horseradish peroxides were successively added into 96- well micro plate coated by specific antibody (MyHC I: A4.840, sc-53089; MyHC IIa: A4.1519, sc-53094; MyHC IIx: A4.1025, sc-53088; MyHC IIb: MY-32, Sc-58797). The micro plate was incubated for 1 h at 37°C, and then washed by a washing buffer. Color reaction was conducted by successively adding 50 μL coloured solution A and B for 15 min, and then stopped by adding 50 μL terminating solution. Optic density at 450 nm (OD450 nm) was measured using Infinite 200 plate reader (TECAN, Switzerland). The contents of MyHC protein in unknown sample were calculated according to a linear regression equation fitted with the concentrations of quality controls and their corresponding OD450 nm, and expressed as “pg/mg protein”. MyHC protein composition, the proportion of each MyHC protein to total of four MyHC, was calculated as follow:

Analysing mRNA transcriptions of four adult MyHC genes in longissimus muscle

Total RNA in tissue was isolated using an EZNA HP Total RNA kit (Omega Bio-tek, Norcross, GA, USA). The cDNA was passed through a reverTra Ace qPCR RT kit (Toyobo Co. Ltd., Osaka, Japan), with 3 μL total RNA (about 2 μg), 1 μL primer mix, 1 μL RT enzyme mix, 4 μL 5×RT buffer, 13 μL nuclease-free water. The mixture was incubated at 65°C for 2 min, at 37°C for 15 min, and then at 98°C for 5 min, and last remained at −80°C until being analysed. Standard mRNA fragments for MyHC I, IIa, IIx and IIb were produced as described by Hu et al. (2008). The primers used were as follows: MyHC I F: 5′-CACTTGCTAAGAGGGACCTCTGAGTTCA-3′, U75316; MyHCIIa F: 5′-AGCCTCTTTCTTCTCCCAGGGACATTC-3′, AB025260; MyHC IIb F: 5′-CATCTGGTAACATAA GAGGTACATCTAG-3′, AB025261; MyHCIIx F: 5′-CTTTCCTCATAAAGCTTCAAGTTCTGCC-3′, AB025262; MyHCs R: ATCCAGGCTGCGTAACGCTCTTTGAGGTT GTA, and were synthesized by Invitrogen Co. Ltd., Shanghai, China. The molecular number of each standard mRNA fragment was calculated according to “copies/μL = 6.02×1023 (copies/mol)×10−9×concentration (ng/μL)/RNA length (base numbers)×340 (g/mol/base)”. The standard mRNA fragments were divided into multiples of 10 to 104~108 copies/μL, and then reverse transcribed into cDNA which was used to fit a standard curve of real-time polymerase chain reaction (PCR). The PCR reaction mixture used the SYBR qPCR Mix kit (Toyobo Co., Ltd., Japan) in a volume of 15 μL consisting of 0.3 μL of each primer (10 nM), 7.5 μL SYBR qPCR mix, 0.3 μL ROX reference dye, 2.0 μL cDNA and 4.6 μL (Easy dilution). The reaction was carried out in a StepOne Plus Real-time PCR system (Life Technologies, Carlsbad, CA, USA) for 20 s at 95°C, followed by 40 cycles at 95°C for 5 s and 60°C for 50 s. The molecular numbers of each MyHC mRNA in a muscle sample (copies/mg tissue) was calculated according to the fitted standard curves. MyHC mRNA composition, the proportion of each MyHC mRNA to total of four MyHC, was calculated as MyHC protein composition.

Analysing of metabolic enzymes activities in LM

Frozen muscle tissues were weighed, homogenized in normal saline (0.9%) and centrifuged with 3,500×g for 10 min at 4°C. The supernatant was used to measure total protein concentration as described in the above section “Analyzing protein expressions of four MyHC genes in LM”. Another 400-μL supernatant was used to measure succinate dehydrogenase (SDH), malate dehydrogenase (MDH), creatine kinase (CK) and lactate dehydrogenase (LDH) activities using commercial kits (Nanjing Jiangcheng Biochemical Institute, Nanjing, China). The enzyme activities were expressed as “U/mg protein”.

Statistical analyses

A one-way analysis of variance and Duncan test (p = 0.05) in SPSS16.0 was employed to determine the differences among means from different ages, and all data were expressed as “means±standard deviation (stdv.)”. Association analysis was conducted by Pearson correlation coefficients of bivariate correlations in SPSS16.0.

RESULTS

Dynamics changes of MyHC I, IIa, IIx, and IIb protein expressions

In Table 1, MyHC I protein content and relative proportion both significantly decreased in the order of “7 days→30 days, 60 days→120 days, 180 days” (p<0.05). MyHC IIa protein content and MyHC IIx protein relative proportions did not significantly change from 30 to 180 days (p>0.05), which were significantly higher than that at 7 days (p<0.05). MyHC IIa protein relative proportion and MyHC IIx protein content both exhibited a tendency of increasing first and decreasing afterwards, and the highest value at 30 days from 7 to 180 days (p<0.05). MyHC IIb protein content and relative proportion both decreased first and increased afterwards, with the lowest value at 30 days during postnatal growth (p<0.05).
Table 1

Comparison of MyHC protein expression in LM of pigs with different postnatal ages

7 days30 days60 days120 days180 days
MyHC IContents (pg/mg)9.83±0.51a7.71±0.66 b7.95±1.52 b5.75±0.36 c6.02±0.96 c
Relative proportion (%)12.19±0.76a9.74±1.00b7.86±1.55b5.96±0.33c6.15±0.80c
MyHC IIaContents (pg/mg)12.36±1.43b25.03±1.94a26.94±2.37a22.64±2.19a25.37±4.52a
Relative proportion (%)18.74±4.02b32.28±0.99a16.30±0.25b19.88±1.55b23.84±3.55b
MyHC IIxContents (pg/mg)15.11±3.11c25.59±1.38a16.51±1.26c19.47±1.67b23.24±2.91a
Relative proportion (%)15.30±1.56b31.55±1.41a26.61±2.40a23.80±2.47a25.81±3.19a
MyHC IIbContents (pg/mg)53.27±4.29a28.65±0.40b57.81±3.28a54.61±1.89a49.20±3.18a
Relative proportion (%)65.96±4.32a36.18±1.03c57.09±2.97b56.62±1.08b50.35±3.22b

MyHC, myosin heavy-chain; LM, longissimus muscle.

Comparison of the data among different ages, the same letters mean no significant difference between them (p>0.05), the different letters mean the significant difference (p<0.05).

Dynamics changes of MyHC I, IIa, IIx, and IIb mRNA transcriptions

In Table 2, MyHC I mRNA abundance and relative proportion both presented an obviously decreasing tendency in the order of “7 days→60 days→120 days→180 days →30 days”, with the significant differences between 7 days and other days, 30 days and other days (p<0.05). MyHC IIa and IIx mRNA both exhibited a tendency of increasing first and decreasing afterwards in both their absolute contents and relative proportions, with the lowest value at 7 days for MyHC IIa mRNA and at 60 days for MyHC IIx mRNA. MyHC IIb mRNA abundance gradually increased with postnatal aging (p<0.05), whereas its relative proportion had a non-significant change between 7 and 30 days, and then significantly increased from 60 days on (p<0.05).
Table 2

Comparison of MyHC mRNA transcription in LM of pigs with different postnatal ages

7 days30 days60 days120 days180 days
MyHC IAbundance (109 copies/mg)3.44±0.32a0.13±0.04c0.97±0.14b0.98±0.08b0.85±0.08b
Relative proportion (%)3.47±0.73a0.25±0.07d1.49±0.25b1.25±0.13b0.88±0.06c
MyHC IIaAbundance (109 copies/mg)0.49±0.19d3.14±0.91a1.03±0.10c1.58±0.55bc2.44±0.94b
Relative proportion (%)1.18±0.46b6.06±1.67a1.59±0.19b2.02±0.74b2.54±1.01b
MyHC IIxAbundance (109 copies/mg)0.61±0.03b1.49±0.73a0.40±0.16c1.55±0.55a2.29±0.47a
Relative proportion (%)1.47±0.05b2.87±0.68a0.60±0.23c1.98±0.74a2.38±0.47a
MyHC IIbAbundance (109 copies/mg)38.79±1.42e47.04±1.67d62.81±2.79c74.76±2.59b90.87±2.73a
Relative proportion (%)93.87±0.93ab90.83±3.07b96.12±0.19a94.75±1.59a94.21±1.29a

MyHC, myosin heavy-chain; LM, longissimus muscle.

Comparison of the data among different ages, the same letters mean no significant difference between them (p>0.05), the different letters mean the significant difference (p<0.05).

Correlations of MyHC mRNA transcriptions with the corresponding protein expressions during postnatal growth

Table 3 showed that, for any MyHC gene, mRNA relative proportion was highly significantly positively correlated with the corresponding protein proportion (p<0.01). But not all of positive correlation was significant (p<0.05), between MyHC mRNA abundance and its protein content.
Table 3

Correlations of MyHC mRNA transcription with its protein expression in porcine LM during postnatal growth

MyHC protein contentMyHC protein composition


MyHC IMyHC IIaMyHC IIxMyHC IIbMyHC IMyHC IIaMyHC IIxMyHC IIb
MyHC mRNA abundanceMyHC mRNA composition
 MyHC I0.334--- MyHC I0.576**---
 MyHC IIa-0.458*-- MyHC IIa-0.652**--
 MyHC IIx--0.637**- MyHC IIx--0.753**-
 MyHC IIb---0.288 MyHC IIb---0.551**

MyHC, myosin heavy-chain; LM, longissimus muscle.

Means significant difference (p<0.05);

means very significant difference (p<0.01).

Correlations between MyHC composition and metabolic enzymes activities in LM

Table 4 shows the activities of four metabolism enzymes in LM of pigs from different postnatal ages. The activities of MDH and SDH presented an obviously decreasing tendency from 7 to 180 days, with the significant differences between 7 days and other days, 30–60 days and other days (p<0.05). CK activity at 7 days was higher than that of other days (p<0.05), and there was no significantly difference from 7 to 180 days for LDH activity (p>0.05).
Table 4

Comparison of metabolic enzymes activities in LM of pigs with different postnatal ages

Metabolic enzymes activities7 days30 days60 days120 days180 days
Creatine kinase, CK16.69±2.84a11.98±1.99b8.76±3.90b12.16±1.80b10.21±1.44b
Lactate dehydrogenase, LDH24.09±4.6719.63±5.1826.80±6.2525.39±4.2528.07±4.76
Succinate dehydrogenase, SDH11.78±2.06a5.78±0.92b5.01±1.63b2.62±0.61c2.16±0.51c
Malate dehydrogenase, MDH2.24±1.17a1.47±0.20b1.24±0.20b0.76±0.07c0.77±0.07c

LM, longissimus muscle.

Comparison of the data among different ages, the same letters mean no significant difference between them (p>0.05), the different letters mean the significant difference (p<0.05).

In Table 5, the relative proportions of MyHC I mRNA and protein were both positively correlated with the activities of SDH and MDH (p<0.01). The relative proportion of MyHC I mRNA was also positively correlated with CK activity (p<0.01), while the protein relative proportion was negatively correlated with LDH activity (p<0.01).
Table 5

Correlations of MyHC composition with metabolism enzyme activities in porcine LM during postnatal growth

MyHC protein compositionMyHC mRNA composition


MyHC IMyHC IIaMyHC IIbMyHC IIxMyHC IMyHC IIaMyHC IIbMyHC IIx
CK activity0.224−0.247−0.234−0.2500.500*−0.1280.0410.105
LDH activity−0.468*0.2910.2560.2920.063−0.2310.284−0.039
SDH activity0.643**−0.459*−0.454*−0.455*0.769**−0.143−0.126−0.185
MDH activity0.725**−0.474*−0.467*−0.470*0.682**−0.084−0.186−0.203

MyHC, myosin heavy-chain; LM, longissimus muscle; CK, creatine kinase; LDH, lactate dehydrogenase; SDH, succinate dehydrogenase; MDH, malate dehydrogenase.

Means significant difference (p<0.05);

means very significant difference (p<0.01).

DISCUSSION

Expressions of four adult MyHC genes in postnatal porcine muscle

MyHC are encoded by a multigene family in skeletal muscle of mammalian animals. Eleven MyHC genes have been found in different types of muscle tissue such as skeletal muscle and cardiac muscle. MyHC-neo and MyHC-emb genes are only expressed before birth of animals, while MyHCI, IIa, IIx, and IIb are expressed in skeletal muscles of adult animals (Schiaffino and Reggiani, 2011). Early reports have indicated that MyHC were expressed in a tissue-specific and developmentally regulated manner in muscle (Mahdavi et al., 1987). The present study found that mRNA transcription and protein expression of four adult MyHC genes all presented some obvious changes with postnatal aging of pigs, especially in the early stage. The result was in agreement with that reported in the literature (Zhao et al., 2004; Yang et al., 2008). The phenomenon could be related with the special developmental stage, dietary changing, and weaning stress. Because in a single myofibre, several types of MyHC isoforms simultaneously exist, and can reverse from one form to another so that a special myofibre may be dominated by a particular MyHC isoform in a specific environment (Reggiani et al., 2000). The phenotypic properties of skeletal muscle fibers can be influenced by various factors such as development, innervation, increased and decreased neuromuscular activity, physical activity (overloading and unloading), hormones and ageing (Sullivan et al., 1995; Schiaffino and Reggiani, 1996; Pette and Staron, 2000). In our result, MyHC IIb and IIx of LM in 30 days and 60 days had the lowest expressions. These could be related to weaning stress of piglets. Weaning stress produced effects on feed intake, growth performance and some endocrine indexes in piglets, such as thyroid hormone and insulin-like growth factor. For skeletal muscle, these growth factors mediate the formation of fast-type myofibers (MusarÒ, et al., 2001; Lynch, et al., 2001). Certainly, effects of weaning on muscle fiber types was very complex and needs to be further researched. Our result only indicated that muscle fibers have the highly adaptability and plasticity for different environmental changes. Moreover, MyHC mRNA changed more sensitively than MyHC protein in muscle with the postnatal aging of pigs in present study. This further confirmed existed previous report that the major regulation of MyHC expression may occur at the mRNA transcriptional level (Cox and Buckingham, 1992).

Correlations between mRNA transcription and protein expression of MyHC

In human muscle, MyHC protein levels have been confirmed to be positively correlated with mRNA transcript (Short et al., 2005). Gunawan et al. (2007) found that the relative expressive level of MyHC I or IIb mRNA was positively correlated with relative content of the corresponding protein to total content of four MyHC isoforms protein (R2 = 0.76 and 0.78, respectively) in various muscles from seven pigs. The present study respectively determined the mRNA and protein absolute levels of MyHC I, IIa, IIx, and IIb in porcine muscle tissue, through an absolute quantitative real-time PCR and an indirect enzyme-linked immunosorbent assay, and then calculated the relative proportion (%) of each MyHC to total four MyHC. Our results found a positive correlation between mRNA transcriptions and protein expressions in any of the four MyHC genes, including their abundant contents and relative proportions. Especially, the correlation coefficients (r) between the relative proportion of mRNA and that of the corresponding protein ranged from 0.551 to 0.753, and were highly significant. These also confirmed that MyHC expression is transcriptionally regulated (Cox and Buckingham, 1992).

Quantitative analysis of MyHC expressions and fiber type characteristics in muscle

Some researches regarded MyHC expressions as a powerful tool for analyzing fibre type characteristics of muscles (Schiaffino and Reggiani, 1996); Spangenburg and Booth, 2003). Multiple immunochemistry, sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and proteomics were used to study MyHC protein expression (Caiozzo et al., 2004; Li et al., 2005), while slot/dot-blot (Diffee et al., 1991), northern blot (Caiozzo et al., 1996), RNase protection assay (Reilly et al., 2000), in situ hybridization (Serrano et al., 2001), and reverse transcriptase reaction coupled to a RT-PCR (Sanchez et al., 2006) were used to determine mRNA transcription. Immunochemistry and SDS-PAGE were regarded as the best semi-quantitative techniques for MyHC protein expression, but they may over-represent predominant proteins and under-represent small amounts of protein (Jankala et al., 1997). With the development of real time RT-PCR technique, quantification of MyHC mRNA could be a more valuable technique to identify changes in MyHC expression (Van Daele, 2010). According to the metabolic properties of different types (I, IIa, IIx, IIb) of muscle fiber in adult porcine skeletal muscle, type I fibers are classically known to have greater oxidative capacity than type II fibers (Lefaucheur and Gerrard, 2000), which can be reflected in the activity of SDH or MDH. The present study showed that the activities of SDH, CK, and MDH were positively correlated with the compositions of MyHC I mRNA or protein. Thus, MyHC mRNA composition maybe an ideal index reflecting fiber type characteristics in porcine muscle. And we had utilized MyHC mRNA composition as a molecular marker of muscle fiber type composition within skeletal muscle, and revealed the age-related changes and nutritional regulation of myofibre type characteristics of porcine muscle in another paper (Men et al., 2013).

CONCLUSION

This study was the first to reveal the correlation between mRNA transcription and the corresponding protein expression of four adult MyHC genes in muscle, during postnatal aging of pigs. Data from these experiments suggested that MyHC mRNA transcription can be used to reflect myofibre type characteristics such as MyHC expression, metabolism property and adaptive plasticity of porcine skeletal muscles, and MyHC mRNA composition could be as an ideal index reflecting fiber type characteristics. Moreover, it will be necessary to investigate the correlation of MyHC mRNA composition with lipid and energy metabolism, and some key functional genes expression in muscle with the postnatal aging of pigs. This information would be useful for further understanding the biological mechanism of porcine skeletal muscle growth and meat quality development and may provide some effective approaches to improve pork quality.
  30 in total

Review 1.  Fiber types in mammalian skeletal muscles.

Authors:  Stefano Schiaffino; Carlo Reggiani
Journal:  Physiol Rev       Date:  2011-10       Impact factor: 37.312

2.  Myosin heavy chains in skeletal muscles of the common shrew (Sorex araneus): absence of a slow isoform and transitions of fast isoforms with ageing.

Authors:  J Savolainen; M Vornanen
Journal:  Acta Physiol Scand       Date:  1995-10

3.  Developmental and hormonal regulation of sarcomeric myosin heavy chain gene family.

Authors:  V Mahdavi; S Izumo; B Nadal-Ginard
Journal:  Circ Res       Date:  1987-06       Impact factor: 17.367

4.  Contractile protein content reflects myosin heavy-chain isoform gene expression.

Authors:  A M Gunawan; S K Park; J M Pleitner; L Feliciano; A L Grant; D E Gerrard
Journal:  J Anim Sci       Date:  2006-12-04       Impact factor: 3.159

5.  IGF-I treatment improves the functional properties of fast- and slow-twitch skeletal muscles from dystrophic mice.

Authors:  G S Lynch; S A Cuffe; D R Plant; P Gregorevic
Journal:  Neuromuscul Disord       Date:  2001-04       Impact factor: 4.296

6.  Protein and mRNA levels of the myosin heavy chain isoforms Ibeta, IIa, IIx and IIb in type I and type II fibre-predominant rat skeletal muscles in response to chronic alcohol feeding.

Authors:  M E Reilly; G McKoy; D Mantle; T J Peters; G Goldspink; V R Preedy
Journal:  J Muscle Res Cell Motil       Date:  2000       Impact factor: 2.698

7.  Changes in myosin heavy chain mRNA and protein expression in human skeletal muscle with age and endurance exercise training.

Authors:  Kevin R Short; Janet L Vittone; Maureen L Bigelow; David N Proctor; Jill M Coenen-Schimke; Paul Rys; K Sreekumaran Nair
Journal:  J Appl Physiol (1985)       Date:  2005-03-03

8.  Effects of denervation on cell cycle control in laryngeal muscle.

Authors:  Vincent J Caiozzo; Ya Zhen Wu; Michael J Baker; Roger Crumley
Journal:  Arch Otolaryngol Head Neck Surg       Date:  2004-09

9.  Control of myosin heavy chain expression: interaction of hypothyroidism and hindlimb suspension.

Authors:  G M Diffee; F Haddad; R E Herrick; K M Baldwin
Journal:  Am J Physiol       Date:  1991-12

10.  Discordant protein and mRNA expression in lung adenocarcinomas.

Authors:  Guoan Chen; Tarek G Gharib; Chiang-Ching Huang; Jeremy M G Taylor; David E Misek; Sharon L R Kardia; Thomas J Giordano; Mark D Iannettoni; Mark B Orringer; Samir M Hanash; David G Beer
Journal:  Mol Cell Proteomics       Date:  2002-04       Impact factor: 5.911

View more
  2 in total

1.  Effect of Porcine Whole Blood Protein Hydrolysate on Slow-Twitch Muscle Fiber Expression and Mitochondrial Biogenesis via the AMPK/SIRT1 Pathway.

Authors:  Sun Woo Jin; Gi Ho Lee; Ji Yeon Kim; Chae Yeon Kim; Young Moo Choo; Whajung Cho; Eun Hee Han; Yong Pil Hwang; Yong An Kim; Hye Gwang Jeong
Journal:  Int J Mol Sci       Date:  2022-01-22       Impact factor: 5.923

2.  Effects of a traditional Chinese medicine formula and its extraction on muscle fiber characteristics in finishing pigs, porcine cell proliferation and isoforms of myosin heavy chain gene expression in myocytes.

Authors:  Qin Ping Yu; Ding Yuan Feng; Xiao Jun He; Fan Wu; Min Hao Xia; Tao Dong; Yi Hua Liu; Hui Ze Tan; Shi Geng Zou; Tao Zheng; Xian Hua Ou; Jian Jun Zuo
Journal:  Asian-Australas J Anim Sci       Date:  2017-06-26       Impact factor: 2.509

  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.