| Literature DB >> 26941827 |
Yuan Jiang1, Hui Gou1, Sanrong Wang1, Jiang Zhu1, Si Tian1, Lehua Yu1.
Abstract
Pulsed electromagnetic field (hemical">PEMF) has been suggested as a promising method alternative to drug-based therapies for treating <hemical">span class="Disease">osteoporosis (OP), but the role of PEMF in GIOP animal models still remains unknown. This study was performed to investigate the effect of PEMF on bone formation and lipid metabolism and further explored the several important components and targets of canonical Wnt signaling pathway in GIOP rats. After 12 weeks of intervention, bone mineral density (BMD) level of the whole body increased significantly, serum lipid levels decreased significantly, and trabeculae were thicker in GIOP rats of PEMF group. PEMF stimulation upregulated the mRNA and protein expression of Wnt10b, LRP5, β-catenin, OPG, and Runx2 and downregulated Axin2, PPAR-γ, C/EBPα, FABP4, and Dkk-1. The results of this study suggested that PEMF stimulation can prevent bone loss and improve lipid metabolism disorders in GIOP rats. Canonical Wnt signaling pathway plays an important role in bone formation and lipid metabolism during PEMF stimulation.Entities:
Year: 2016 PMID: 26941827 PMCID: PMC4749801 DOI: 10.1155/2016/4927035
Source DB: PubMed Journal: Evid Based Complement Alternat Med ISSN: 1741-427X Impact factor: 2.629
Primer sequences for real-time PCR analysis.
| Gene ID | Gene | 5′-3′ | Sequence |
|---|---|---|---|
| 315294 | Wnt10b | Forward | CAGGCTTTGTGTGGAGTCATT |
| Reverse | GAGGTTCTGGGCTGTAGTGG | ||
|
| |||
| 293649 | LRP5 | Forward | GACCTGATGGGACTCAAAGC |
| Reverse | GGGTGAAGAAGCACAGATGG | ||
|
| |||
| 84353 |
| Forward | CTTACGGCAATCAGGAAAGC |
| Reverse | GACAGACAGCACCTTCAGCA | ||
|
| |||
| 25341 | OPG | Forward | TCAAGAATGCCACAGAA |
| Reverse | GTCACGAAGCGGGTGTAGT | ||
|
| |||
| 117516 | RANKL | Forward | GGGAGCACTAAGAACTGGTCA |
| Reverse | TTGGACACCTGGACGCTAAT | ||
|
| |||
| 29134 | Axin2 | Forward | AGTCAGCAGAGGGACAGGAA |
| Reverse | CTTGGAGTGCGTGGACACTA | ||
|
| |||
| 293897 | Dkk-1 | Forward | TGACCACAGCCATTTACCTC |
| Reverse | ACAGAGCCTTCTTGCCCTTT | ||
|
| |||
| 80722 | SOST | Forward | GAATGGTAGGTGCCAGGAGCA |
| Reverse | TTAGGTAGGTGCCAGGAGCA | ||
|
| |||
| 367218 | Runx2 | Forward | CCTCTGACTTCTGCCTCTGG |
| Reverse | GATGAAATGCCTGGGAACTG | ||
|
| |||
| 25664 | PPAR- | Forward | CGGTTGATTTCTCCAGCATT |
| Reverse | TCGCACTTTGGTATTCTTGG | ||
|
| |||
| 24252 | C/EBP | Forward | AGTTGACCAGTGACAATGACCG |
| Reverse | TCAGGCAGCTGGCGGAAGAT | ||
|
| |||
| 79451 | FABP4 | Forward | CGACCACCATAAAGAGGAGAC |
| Reverse | AAACCACCAAATCCCATCAA | ||
|
| |||
| 24383 | GAPDH | Forward | CAGGAGGCATTGCTGATGAT |
| Reverse | GAAGGCTGGGGCTCATTT | ||
Bone mineral density (BMD) of each group before and after treatment (g/cm2).
| Groups | Part | ||||||||
|---|---|---|---|---|---|---|---|---|---|
| Head | Upper limb | Femur | Trunk | Rib | Pelvis | Spine | Whole body | ||
| Control group | Prior to treatment | 0.237 ± 0.010 | 0.153 ± 0.032 | 0.142 ± 0.011 | 0.125 ± 0.009 | 0.113 ± 0.006 | 0.132 ± 0.017 | 0.132 ± 0.008 | 0.149 ± 0.005 |
| Posttreatment | 0.243 ± 0.016 | 0.144 ± 0.026 | 0.156 ± 0.012#O | 0.125 ± 0.008# | 0.110 ± 0.007# | 0.134 ± 0.017# | 0.137 ± 0.009# | 0.153 ± 0.007# | |
|
| |||||||||
| GIOP group | Prior to treatment | 0.225 ± 0.015 | 0.131 ± 0.031 | 0.127 ± 0.008 | 0.110 ± 0.007 | 0.099 ± 0.012 | 0.113 ± 0.013 | 0.108 ± 0.010 | 0.132 ± 0.004 |
| Posttreatment | 0.235 ± 0.021 | 0.123 ± 0.032 | 0.132 ± 0.011 | 0.114 ± 0.007 | 0.102 ± 0.007 | 0.117 ± 0.016 | 0.111 ± 0.015 | 0.135 ± 0.009 | |
|
| |||||||||
| Calcium group | Prior to treatment | 0.221 ± 0.010 | 0.147 ± 0.035 | 0.120 ± 0.013 | 0.106 ± 0.009 | 0.102 ± 0.012 | 0.104 ± 0.012 | 0.110 ± 0.010 | 0.131 ± 0.005 |
| Posttreatment | 0.237 ± 0.024 | 0.119 ± 0.033 | 0.129 ± 0.019 | 0.113 ± 0.014 | 0.100 ± 0.008 | 0.123 ± 0.018O | 0.125 ± 0.018#O | 0.141 ± 0.013 | |
|
| |||||||||
| PEMF group | Prior to treatment | 0.219 ± 0.006 | 0.138 ± 0.009 | 0.120 ± 0.009 | 0.107 ± 0.010 | 0.100 ± 0.013 | 0.101 ± 0.015 | 0.110 ± 0.007 | 0.133 ± 0.006 |
| Posttreatment | 0.234 ± 0.024 | 0.112 ± 0.035 | 0.133 ± 0.018O | 0.117 ± 0.008O | 0.104 ± 0.008 | 0.117 ± 0.018O | 0.130 ± 0.013#O | 0.148 ± 0.008#O | |
Compared with the control group before treatment, P < 0.05; compared with the GIOP group after treatment, # P < 0.05; compared with before treatment, O P < 0.05.
Bone mineral content (BMC) of each group before and after treatment (g).
| Groups | Part | ||||||||
|---|---|---|---|---|---|---|---|---|---|
| Head | Upper limb | Femur | Trunk | Rib | Pelvis | Spine | Whole body | ||
| Control group | Prior to treatment | 2.02 ± 0.23 | 0.49 ± 0.25 | 2.33 ± 1.00 | 3.82 ± 1.05 | 1.25 ± 0.49 | 1.40 ± 0.23 | 1.73 ± 0.49 | 8.19 ± 0.64 |
| Posttreatment | 2.04 ± 0.28 | 0.49 ± 0.23 | 2.79 ± 0.69 | 3.43 ± 0.97# | 1.23 ± 0.60# | 1.35 ± 0.53 | 1.85 ± 0.75# | 8.31 ± 0.95# | |
|
| |||||||||
| GIOP group | Prior to treatment | 1.80 ± 0.13 | 0.39 ± 0.27 | 2.31 ± 0.73 | 2.60 ± 0.64 | 0.67 ± 0.32 | 1.15 ± 0.26 | 0.80 ± 0.25 | 7.21 ± 0.63 |
| Posttreatment | 1.85 ± 0.18 | 0.34 ± 0.10 | 2.32 ± 0.69 | 2.32 ± 0.73 | 0.58 ± 0.31 | 1.10 ± 0.37 | 0.80 ± 0.28 | 7.06 ± 0.57 | |
|
| |||||||||
| Calcium group | Prior to treatment | 1.82 ± 0.10 | 0.42 ± 0.23 | 2.62 ± 1.01 | 2.12 ± 0.33 | 0.53 ± 0.11 | 1.00 ± 0.34 | 0.81 ± 0.25 | 7.14 ± 0.77 |
| Posttreatment | 1.90 ± 0.32 | 0.35 ± 0.19 | 2.58 ± 0.65 | 2.44 ± 0.41 | 0.61 ± 0.20 | 1.24 ± 0.32O | 0.91 ± 0.33 | 7.52 ± 0.71O | |
|
| |||||||||
| PEMF group | Prior to treatment | 1.88 ± 0.16 | 0.53 ± 0.27 | 2.25 ± 0.97 | 2.27 ± 0.40 | 0.53 ± 0.12 | 0.95 ± 0.26 | 0.86 ± 0.32 | 7.09 ± 0.80 |
| Posttreatment | 2.04 ± 0.21O | 0.46 ± 0.23 | 2.73 ± 0.68 | 2.33 ± 0.39 | 0.63 ± 0.18O | 1.02 ± 0.27 | 0.99 ± 0.34 | 7.68 ± 0.64O | |
Compared with the control group before treatment, P < 0.05; compared with the GIOP group after treatment, # P < 0.05; compared with before treatment, O P < 0.05.
Figure 1The serum concentrations of alkaline phosphatase (ALP) and tartrate resistant acid phosphatase (TRAP) in each group before and after treatment ((a) A, B). The results of serum biochemical analysis in each group before and after treatment include serum calcium (Ca), phosphorus (P), triglyceride (TG), total cholesterol (TCHO), high density lipoprotein cholesterol (HDL), and low density lipoprotein cholesterol (LDL) ((a) C, D). The L4 vertebral bodies were stained with Safranin-O/Fast green: ((b) A) control group, ((b) B) GIOP group, ((b) C) calcium group, and ((b) D) PEMF group; bone tissue was stained in grayish-green or blue; cartilage tissue was stained in red. The L4 vertebral bodies also were stained with HE staining solution: ((b) E) control group, ((b) F) GIOP group, ((b) G) calcium group, and ((b) H) PEMF group. The rate of OPG to RANKL mRNA and protein expressions in each group after treatment ((c) A, B). Compared with the control group, P < 0.05; compared with the GIOP group, # P < 0.05; compared with calcium group, O P < 0.05.
Histomorphometrical analysis of the fourth lumbar (L4) vertebral bodies.
| Group | Tb.Ar (%) | Tb.Wi ( | Tb.N (n/mm) | Tb.Sp ( |
|---|---|---|---|---|
| Control group | 54.23 ± 2.48 | 55.41 ± 5.69 | 9.85 ± 1.01 | 46.87 ± 6.29 |
| GIOP group | 26.95 ± 5.55 | 52.70 ± 4.67 | 5.25 ± 0.63 | 139.80 ± 25.68 |
| Calcium group | 42.69 ± 6.30 | 62.23 ± 5.05# | 6.88 ± 1.06 | 85.32 ± 19.91 |
| PEMF group | 48.16 ± 4.28# | 61.42 ± 2.63 | 7.84 ± 0.52 | 66.55 ± 9.64# |
Data were expressed as mean ± SD.
Tb.Ar: trabecular area; Tb.Wi: trabecular width; Tb.N: trabecular number; Tb.Sp: trabecular separation.
Compared with the control group, P < 0.05; compared with the GIOP group, # P < 0.05.
Figure 2The relative mRNA expressions of target genes were estimated using real-time PCR analysis after 12-week interventions. Compared with the control group, P < 0.05; compared with the GIOP group, # P < 0.05; compared with calcium group, O P < 0.05.
Figure 3The protein expressions of target genes were estimated using Western blot analysis after 12-week interventions. Compared with the control group, P < 0.05; compared with the GIOP group, # P < 0.05; compared with calcium group, O P < 0.05.