| Literature DB >> 26925044 |
Chandra B Patel1, Rishi Shanker2, Vijai K Gupta3, Ram S Upadhyay4.
Abstract
The availability of safe and pristine water is a global challenge when large numbers of natural and anthropogenic water resources are being depleted with faster rate. The remaining water resources are severely contaminated with various kinds of contaminants including microorganisms. Enterobacter is one of the fecal coliform bacteria of family Enterobacteriaceae. Enterobacter was earlier used as an indicator bacterium along with other fecal Coliforms namely Escherichia coli, Citrobacter, and Klebsiella, but it is now known to cause various diseases in human beings. In this study, we have collected 55 samples from potable water and riverine system and proved their presence using their conserved sequences of 16S rRNA and 23S rRNA genes with the help of SYBR green real-time PCR, which showed very high specificity for the detection of Enterobacter. The Enterobacter counts in potable water were found to 1290 ± 32.89 to 1460 ± 39.42 cfu/100 ml. The Enterobacter levels in surface water were 1.76 × 10(4) ± 492, 1.33 × 10(4) ± 334, 1.15 × 10(4) ± 308, 2.56 × 10(4) ± 802, 2.89 × 10(4) ± 962, 8.16 × 10(4) ± 3443 cfu/100 ml; the levels of Enterobacter contamination associated with hydrophytes were 4.80 × 10(4) ± 1804, 3.48 × 10(4) ± 856, 8.50 × 10(4) ± 2074, 8.09 × 10(4) ± 1724, 6.30 × 10(4) ± 1738, 3.68 × 10(4) ± 949 cfu/10 g and the Enterobacter counts in sediments of the river, were 2.36 × 10(4) ± 703, 1.98 × 10(4) ± 530, 9.92 × 10(4) ± 3839, 6.80 × 10(4) ± 2230, 8.76 × 10(4) ± 3066 and 2.34 × 10(4) ± 732 cfu/10 g at the sampling Site #1, Site #2, Site #3, Site #4, Site #5, and Site #6, respectively. The assay could be used for the regular monitoring of potable water and other water reservoirs to check waterborne outbreaks.Entities:
Keywords: Enterobacter; fecal coliforms; microbial contamination; quantitative enumeration; real-time PCR; riverine system
Year: 2016 PMID: 26925044 PMCID: PMC4756282 DOI: 10.3389/fmicb.2016.00172
Source DB: PubMed Journal: Front Microbiol ISSN: 1664-302X Impact factor: 5.640
Sequence of primers were used to detect Enterobacter in environmental samples.
| Name of genes | Primers Sequences (5′-3′) | Length (nt) | Tm (°C) | % GC | Product Length (bp) |
|---|---|---|---|---|---|
| F: Forward | |||||
| R: Reverse | |||||
| 23S rRNA | F: AGTGGAACGGTCTGGAAAGG | 20 | 56.5 | 55 | 154 |
| R: TCGGTCAGTCAGGAGTATTTAGC | 23 | 57.3 | 47.8 | ||
| 16S rRNA | F: ATCAGATGTGCCCAG ATGG | 19 | 53.5 | 52.6 | 110 |
| R: CCGTGTCTCAGTTCCAGTG | 19 | 54.6 | 57.9 |
Enterobacter count in potable water (per 100 ml).
| aSampling sites | Sites name | |
|---|---|---|
| Site : A | Gaughat | 13320 ± 428.90 |
| Site : B | Aishbagh | NDd |
| Site : C | Husain Ganj | ND |
| Site : D | Kaiserbagh | ND |
| Site : E | Nakkhas | 1304 ± 34.94 |
| Site : F | Shastrinagar | 1290 ± 32.89 |
| Site : G | Saadatganj | 1460 ± 39.42 |
| Site : H | City Station | ND |
| Site : I | Motinagar | ND |
| Site : J | KGMU | ND |
Enterobacter count in river Gomti in surface water (per 100 ml), sediments (per 10 g) and hydrophytes (per 10 g).
| Sampling sites | Sites Name | Surface water | Sediments | Hydrophytes |
|---|---|---|---|---|
| Site # 1 | GhailaBridge | 1.76 × 104 ± 492 | 2.36 × 104 ± 703 | 4.80 × 104 ± 1804 |
| Site # 2 | Gaughat | 1.33 × 104± 334 | 1.98 × 104 ± 530 | 3.48 × 104± 856 |
| Site # 3 | Shaheed Smarak | 1.15 × 104± 307 | 9.92 × 104 ± 3839 | 8.50 × 104± 2074 |
| Site # 4 | Bhaisakund | 2.56 × 104± 801 | 6.80 × 104± 2230 | 8.09 × 104 ± 1724 |
| Site # 5 | Chandiamau | 2.89 × 104± 962 | 8.76 × 104± 3066 | 6.30 × 104 ± 1738 |
| Site # 6 | Indira Jal Setu | 8.16 × 104 ± 3443 | 2.34 × 104 ± 732 | 3.68 × 104 ± 949 |