Literature DB >> 26915950

Generation and characterization of rat liver stem cell lines and their engraftment in a rat model of liver failure.

Ewart W Kuijk1,2, Shauna Rasmussen3, Francis Blokzijl1,2, Meritxell Huch4,5, Helmuth Gehart1, Pim Toonen1, Harry Begthel1, Hans Clevers1, Aron M Geurts3,6, Edwin Cuppen1,2.   

Abstract

The rat is an important model for liver regeneration. However, there is no in vitro culture system that can capture the massive proliferation that can be observed after partial hepatectomy in rats. We here describe the generation of rat liver stem cell lines. Rat liver stem cells, which grow as cystic organoids, were characterized by high expression of the stem cell marker Lgr5, by the expression of liver progenitor and duct markers, and by low expression of hepatocyte markers, oval cell markers, and stellate cell markers. Prolonged cultures of rat liver organoids depended on high levels of WNT-signalling and the inhibition of BMP-signaling. Upon transplantation of clonal lines to a Fah(-/-) Il2rg(-/-) rat model of liver failure, the rat liver stem cells engrafted into the host liver where they differentiated into areas with FAH and Albumin positive hepatocytes. Rat liver stem cell lines hold potential as consistent reliable cell sources for pharmacological, toxicological or metabolic studies. In addition, rat liver stem cell lines may contribute to the development of regenerative medicine in liver disease. To our knowledge, the here described liver stem cell lines represent the first organoid culture system in the rat.

Entities:  

Mesh:

Substances:

Year:  2016        PMID: 26915950      PMCID: PMC4768167          DOI: 10.1038/srep22154

Source DB:  PubMed          Journal:  Sci Rep        ISSN: 2045-2322            Impact factor:   4.379


The adult liver has a vital role in metabolism, detoxification and the production of essential serum proteins. In contrast with the high regenerative capacity of the rat liver1234, isolated rat liver cells have limited potential to proliferate in vitro5. The highest growth potential of rat liver cells in culture has been attributed to a hepatocyte subpopulation called small hepatocytes. Expansion in this culture system is limited to a period of 1–2 weeks after isolation6. As a consequence, toxicological and pharmacological studies still depend on primary cultures of rat hepatocytes789. The high functional variability and limited life span of primary hepatocytes pose limitations to these studies7. The derivation of rat liver stem cell (LSC) lines could help circumvent these issues and contribute to the minimization of experimental animal usage10. We previously described culture conditions that sustain the long-term culture of adult mouse stem cells from the intestine11, stomach12, liver13 and pancreas14. In addition, we developed culture systems that support the self-renewal of stem cells from the adult human intestine1516 and the human liver17. These cultures grow as 3-dimensional organ buds commonly referred to as organoids. Self-renewal of these organoid cultures depends on the Lgr5-ligand and WNT agonist RSPO1. In self-renewing epithelial organ systems such as the small intestine, colon, and the stomach, Lgr5 is expressed in the stem cells that reside at the bottom of the crypts18. In contrast with the gastrointestinal tract, other organ systems such as the pancreas and the liver lack actively dividing stem cells. The stem cells in these organs become activated after tissue damage to support regeneration. Several recent studies using different animal models of liver damage demonstrate that multiple cell types can contribute to liver regeneration, such as hepatocytes19202122, duct-derived oval cells232425 and hepatic stellate cells (a liver-resident mesenchymal cell)26. Apparently, different cell types of the adult liver can act as facultative stem cells and contribute to liver regeneration, depending on the type and extent of the damage2327. Liver and pancreas regeneration involves activation of the WNT-pathway1314. Genetic lineage tracing techniques have recently demonstrated that Lgr5, which is not expressed in the healthy adult mouse liver or pancreas, becomes activated in a subpopulation of cells upon injury1314. In the damage mouse liver, small Lgr5 + cells appear and contribute to the generation of hepatocytes and ductal cells, indicating that the Lgr5+cells have bipotential. In the presence of the Lgr5-ligand RSPO1, single Lgr5+ mouse liver cells can give rise to cystic organoid cultures that can be expanded indefinitely, while maintaining the potential to differentiate towards hepatocytes and duct cells, demonstrating that liver derived Lgr5+ cells are true bi-potential stem cells in vitro. Moreover, in vitro differentiated liver stem cells are able to engraft in an Fah−/− mouse model of liver failure, where they develop into functional hepatocytes13. More recently, we also described culture conditions that support human liver stem cell cultures17. The liver organoid system is considered a valuable tool for drug testing10. Considering the established role of the rat in pharmacological research we pursued the development of an organoid culture system for the rat liver in the current study. We chose for the SHR/OlaIpcv (SHR) and BN-Lx/Cub (BN-Lx) rat strains, because these are the two founder strains of the rat HXB/BXH recombinant inbred panel that has been extensively phenotyped at the physiological, behavioral and molecular levels and all genomic variation between both strains has been identified2829.

Results

Establishment of rat liver stem cell lines

For the generation of mouse and human liver stem cell lines, isolated duct cells are initially subjected to high levels of WNT-signaling and inhibition of BMP-signaling by Noggin during the first 3–4 days of culture1317. After culture induction, WNT and Noggin are no longer required. To establish rat liver stem cell lines, liver tissue was digested with collagenase and differential centrifugation steps were performed to enrich for duct cells. The fractions containing rat duct cells were embedded in matrigel and cultured in mouse liver stem cell culture initiation conditions13, which includes 50% conditioned medium (produced in house) of WNT3A and 10% conditioned medium (produced in house) of Noggin. After 2 days the first cystic epithelial organoids appeared reminiscent of mouse and human liver stem cells (Fig. 1A). In contrast with the mouse, human liver stem cells are routinely cultured in the presence of 2 small chemical compounds: forskolin (a cAMP pathway agonist) and A83-01 (an inhibitor of the Tgf-ß receptors Alk4/5/7). However, when rat liver cells were subjected to these ‘human’ liver stem cell conditions17, cystic organoids were lost within 1 week after switching culture conditions, indicating that these conditions fail to support rat liver stem cell self-renewal (Fig. 1B).
Figure 1

Establishment of rat liver stem cells and the effects of various growth factor conditions on the cultures.

(A) Rat liver stem cells grow as cystic organoid structures (top panels), which are lost when NOGGIN or WNT3A is absent from the medium (bottom panels). Regular cultures contained 50% conditioned medium (produced in house) of WNT3A and 10% conditioned medium (produced in house) of Noggin. For conditions lacking WNT3A or NOGGIN we used medium conditioned on control cell lines that do not produce these factors. (B) Human liver stem cell medium fails to support the self renewal of rat liver stem cells. Scale bars are 1mm.

Rat liver stem cell self-renewal depends on WNT and NOGGIN

In the presence of WNT and NOGGIN, the cysts continued to grow and they were split 10–12 days after culture initiation. Subsequent passages were performed at 6–9 day intervals at 1:4–1:8 split ratios. The cultures could be maintained beyond passage 25 without signs of senescence or loss of self-renewal potential. Withdrawal of Noggin or WNT had adverse effects on the cultures, drastically reducing the number of cysts after 14 days of culture (Fig. 2A). These effects were already noticeable at day 7 of Noggin or WNT withdrawal, reducing the number of large cysts at this time point (Fig. 2B). Therefore, for rat, but not mouse, WNT and NOGGIN are essential to sustain self-renewal in vitro. Quantitative RT-PCR revealed that in the absence of WNT or NOGGIN, the stem cell marker Lgr513 was downregulated, while the expression levels of the duct marker Krt1930 and the bipotent hepatic progenitor markers Cd4431 and Prom132 remained high (Fig. 2B). This coincided with a downregulation of the hepatocyte markers Albumin and Cyp3a11 and also of the hepatocyte maturation markers Hnf6 (OC-1) and Pparg. These data suggest that in the absence of WNT or NOGGIN, stem cells are lost from the cultures through differentiation towards duct cells, but not towards hepatocytes.
Figure 2

Effects of growth factor conditions on the number of organoids and on gene expression levels.

(A) Quantification of the number of cystic organoids (top panels) or the number of large cystic organoids upon 7 and 14 days of culture in the absence of WNT or NOGGIN. Results are expressed as mean ± SEM of three independent cultures. (B) The effects of the absence of WNT or NOGGIN on the expression levels of stem cell/duct markers and hepatocyte markers. Results are expressed as mean ± SEM. Asterisks denote significant differences (2-tailed student’s t-test): *p < 0.05; **p < 0.01.

Rat liver stem cell lines express stem cell markers and duct markers

The rat liver stem cells were further characterized by the expression levels of markers for various liver cell types (Fig. 3). In clonally expanded cell lines, the expression level of the stem cell marker Lgr5 was higher compared to the expression in the liver or in the rat embryonic stem cell line DA27. The expression of the liver progenitor markers Cd44, Prom1, and Sox933 was enriched in the rat liver stem cell lines. Krt19 was also expressed at relatively high levels, probably reflecting the ductal origin of the liver stem cell lines. The hepatocyte maturation markers Pparg and Tbx334 and the hepatocyte markers Albumin and Cyp3a11 were expressed at lower levels in the rat liver stem cell cultures when compared to the expression levels in the liver (Fig. 3).
Figure 3

Characterization of rat liver stem cell cultures by quantitative RT-PCR.

Relative expression levels of stem cell/duct markers in embryonic stem cells, liver, and liver stem cells (left panels). Expression levels of hepatocyte/maturation markers in embryonic stem cells, liver, and liver stem cells (right panels). Results are expressed as mean ± SEM. ES = rat embryonic stem cells.

RNA-seq characterization of rat liver stem cell lines

We performed RNA-seq on 7 stem cell clones and 4 liver samples to further characterize the rat liver stem cell cultures. Analysis of the RNA-seq data confirmed the significantly higher expression in rat liver stem cells of the stem cell marker Lgr5 and several duct/progenitor including Cd44, Prom1, Krt19 and Sox9 (Fig. 4). Hepatocyte markers such as Albumin, Fah, and Hnf4a were expressed at significantly lower levels in the liver stem cells compared to the liver. The same was true for a selection of markers for stellate cells and oval cells (Fig. 4).
Figure 4

Differential expression between liver samples and liver stem cell samples of selected markers of liver cell types.

Log2 fold changes of stem cell /duct markers, hepatocyte markers, stellate cell markers, and the oval cell marker Afp. Negative fold changes indicate lower expression in rat liver stem cells compared to the liver, positive fold changes indicate higher expression in rat liver stem cells compared to the liver. All markers are significantly differently expressed (adjusted P-value < 0.05).

Gene functional classification and clustering analyses with DAVID3536 of all 396 significantly higher expressed genes revealed that rat liver stem cells are enriched for keratin family genes, genes involved in plasma membrane function and genes involved in calcium binding (see Supplemental file S3). KEGG pathway analysis further revealed significantly higher expression of genes involved in extra-cellular matrix-receptor interactions (Fold Enrichment = 6.5, adjusted P-value = 0.018, FDR = 0.2), such as several integrins (Integrin α2, Integrin α3, Integrin β4, and Integrin β6) and laminins (Laminin α5, Laminin β3, and Laminin γ2) (see Supplemental file S3). Subsequently, gene functional classification and clustering analyses were performed on all 2276 genes that were expressed at significantly lower levels in the rat liver organoid cultures. These analyses revealed that many low-expressed genes play roles in mature liver function, such as genes involved in complement activation, protein synthesis, and family members that belong to the Cytochrome p450 family (see Supplemental file S4). KEGG analysis also showed a significant low expression of genes involved in liver function such as genes involved in complement and coagulation cascades (Fold enrichment = 4.8, adjusted P-value = 2.0E-19, FDR = 1.4E-18), drug metabolism (Fold enrichment = 4.1, adjusted P-value = 2.7E-13, FDR = 3.8E-12), PPAR signaling (Fold enrichment = 3.9, adjusted P-value = 5.2E-12, FDR = 1.1E-10), and fatty acid metabolism (Fold enrichment = 4.4, adjusted P-value = 4.8E-09, FDR = 1.3E-07) (see Supplemental file S4).

In vitro differentiation of rat liver stem cell lines

Mouse liver stem cells can be differentiated through the inhibition of Notch and TGF-ß, which results in enhanced hepatocyte cell fate13. When these in vitro differentiation conditions were applied to rat liver stem cells, the stem cell/progenitor markers Lgr5 and Sox9 were downregulated, while expression of the liver maturation markers Pparg, Bmp2, and Hnf6 was upregulated (Fig. 5). Furthermore, the expression of the mature hepatocyte marker Cyp3a11 was increased upon differentiation. Albumin expression was not upregulated, indicating that under these in vitro differentiation conditions, the rat liver stem cells have embarked on a path towards hepatocyte cell differentiation, but they have not fully matured in Albumin-expressing hepatocytes.
Figure 5

Effect of in vitro differentiation conditions on rat liver stem cell cultures as determined by quantitative RT-PCR.

Relative expression levels of stem cell/duct markers and hepatocyte/maturation markers in undifferentiated liver stem cells (LSCs) and at day 10 (D10) of differentiation. Results are expressed as mean ± SEM.

In vivo differentiation of rat liver stem cells

Differentiation towards hepatocytes may be more efficient when the cells are subjected to the cues such as present in the damaged liver. Therefore, we tested the potential of rat liver stem cells to engraft into the livers of fumarylacetoacetate hydrolase (Fah) interleukin 2 receptor gamma (Il2rg) double mutant rats, a model for tyrosinemia type I liver disease. Fah−/− hepatocytes accumulate intermediate metabolites resulting in programmed cell death and ultimately in liver failure unless the mutant rats are administered NTBC (2-(2-nitro-4-trifluoro-methylbenzyol)-1,3-cyclohexanedione). Clonally expanded organoids from the BNLx and the SHR strains were expanded further to obtain enough cells for transplantations. Single cell suspensions were injected intrasplenically in the rats (Fig. 6A). Sham injected animals served as controls. All animals were cycled on and off NTBC to induce liver damage and to facilitate engraftment and expansion of transplanted cells. Subsequently, engraftment was analyzed by immunohistochemical staining of liver sections with an antibody against FAH (Fig. 6B). FAH positive cells were detected in 3 out of 7 transplanted rats. In one liver, the engrafted cells were of BNLx origin and the sizes of the grafts were calculated to comprise ~20% of the liver. In the remaining 2 livers, the engrafted cells were of SHR-origin and the engrafted areas were calculated to be 1.5% in one liver and less than 1% in the other. To determine the differentiation potential of the engrafted cells consecutive sections were stained with an antibody that recognizes rat Albumin. Albumin staining was readily detected outside the FAH-positive patches resulting in nearly mutually exclusive expression patterns between Albumin and FAH (Fig. 6C). Importantly, there were Albumin positive cells present in the FAH-positive areas, indicating the potential of engrafted rat liver stem cells to differentiate towards hepatocytes. Finally, we also observed CK19 positive cells outside the ducts in the FAH-positive engrafted areas (Fig. 6D). The CK19 positive cells possibly highlight engrafted cells that are migrating towards damaged tissue.
Figure 6

Transplantation of rat liver stem cells to the Fah−/− Il2rg−/− rat model of liver failure.

(A) Experimental set-up: single organoids were manually picked and expanded until enough cells were obtained for intrasplenic transplantation into the Fah−/− Il2rg−/−model of liver failure. After transplantation the rats were cycled on and off NTBC (see material and methods section for more detail). Within 2 months after transplantation rat livers were analyzed for engraftment by immunohistochemistry. (B) Immunohistochemical analysis of FAH-expression demonstrates engraftment in livers of animals that received liver stem cells. (C) Consecutive sections of FAH-positive areas were analyzed for the expression of the hepatocyte marker Albumin. The expression of FAH and Albumin is nearly mutually exclusive, indicating that the majority of the injected cells have not yet fully differentiated to hepatocytes. Caged boxes with dashed lines are enlarged in the panels below. Arrowheads indicate a subset of ALBUMIN-positive hepatocytes in the FAH-positive grafts. (D) Consecutive sections of FAH-positive areas were analyzed for the expression of the duct marker CK19. In addition to the ducts, CK19 positive cells were also detected inside the FAH-positive grafts outside the ducts (open arrowheads). Scale bars are 200 μm.

Discussion

In the current study, we demonstrate that self-renewing organoids can be generated from the rat liver. To our knowledge, these represent the first organoid culture system in the rat. Unlike mouse and human liver organoid cultures, rat liver stem cells require high levels of WNT-signaling and suppressed BMP-signaling. Mouse and human liver stem cells, on the other hand, only require WNT and NOGGIN during culture initiation and not thereafter. This discrepancy may reflect species differences in liver regeneration37. Upon transplantation, rat liver stem cells differentiated towards FAH positive grafts containing CK19 and Albumin positive cells, indicating that rat liver stem cells have the bipotential to differentiate into either hepatocytes or duct cells. Albumin expression was observed in the minority of the engrafted cells indicating incomplete differentiation of the transplanted stem cells at the examined time points. Mouse and human liver stem cells can be differentiated towards albumin positive hepatocytes. Under mouse hepatocyte differentiation conditions, rat liver stem cells did not adopt a hepatocyte phenotype. The high levels of WNT and NOGGIN required for rat liver stem cells may adversely affect their differentiation potential towards hepatocytes. Nevertheless, the transplantation experiments demonstrate the potential of rat liver stem cells towards hepatocytes. The in vitro differentiation conditions of rat liver stem cells towards hepatocytes needs further optimization. The stem-cell model of liver regeneration has recently been challenged. Several studies using different mouse models of liver damage demonstrate that liver regeneration doesn’t depend on the activation of liver-specific stem cells, but on the proliferation of hepatocytes19202122. On the other hand, studies in the rat have demonstrated that when hepatocyte proliferation is blocked, partial hepatectomy leads to the appearance of duct-derived oval cells that gradually give rise to small hepatocytes and ultimately hepatocytes, resulting in the restoration of liver function232425. In addition, hepatic stellate cells (a liver-resident mesenchymal cell) can also contribute to liver regeneration26. Apparently, different cell types of the adult liver can act as facultative stem cells and contribute to liver regeneration, depending on the type and extent of the damage2327. As their mouse and human counterparts1317, the here described duct-derived rat liver organoids can be cultured extensively (>25 passages) and differentiate into duct cells and hepatocytes, thereby fulfilling the two main criteria of a bona fide stem cell: i.e. self-renewal capacity and differentiation potential3839. Mouse and human liver stem cells are derived from biliary epithelial duct cells1317. To establish the rat liver stem cell lines described in the current study, bulk liver cell populations were enriched for duct cells. The ductal origin of the rat liver stem cell cultures was further reflected by the gene expression patterns obtained from quantitative RT-PCR and RNA-seq experiments. Rat liver stem cell cultures expressed duct and stem cell markers such as Krt19, Sox9, Cd44, Epcam, and Lgr5. The relative low expression of markers for hepatocytes, stellate cells, and oval cells, decrease the likelihood that the rat liver stem cell cultures originated from these liver cell types. RNA-seq analysis also revealed enhanced expression in the rat liver stem cells of genes that belong to the families of integrins and laminins, which are involved in extracellular matrix-receptor interactions. The integrin and laminin genes that are highly expressed in rat liver stem cells are also known to be expressed in mouse and human biliary epithelial duct cells4041. This finding emphasizes the ductal phenotype of the rat liver stem cell cultures and further supports their ductal origin. Interestingly, genes encoding the calcium binding proteins, including S100 calcium-binding proteins A4 and A6, were enriched in rat liver stem cells. S100A4 and S100A6 are thought to play important roles in the activation of stem cells at the onset of hair follicle regeneration42. Their elevated expression in liver stem cells may indicate a role for these factors in rat liver stem cells. Here, we have demonstrated that rat duct cells can self-renew extensively in culture, while having the capacity to engraft into the liver of a rat model of liver failure, where they can differentiate towards hepatocytes. Rat liver stem cell lines may contribute to the development of regenerative medicine in liver disease. Furthermore, rat liver stem cell lines may be particularly useful for studies on rat models for human metabolic disorders, such as the Gunn rat (model for CN syndrome typeI), the FAH–/– (model of tyrosinaemia type I), the rat model for hemochromatosis, and the Long Evans Cinnamon rat (model of Wilson’s disease)434445. These models could benefit from rat liver stem cell lines as a tool to further elucidate the molecular mechanisms of these diseases or to examine the potential of liver stem cells in restoring liver function upon transplantation. Moreover, rat liver stem cells hold potential as an additive or alternative model to primary rat hepatocytes, which are currently frequently used in pharmacological studies. We think these rat liver stem cell lines will be particularly valuable, because they were generated from the well-characterized founder strains of the rat HXB/BXH recombinant inbred panel2829.

Methods

Animal experiments

All animals received human care and all animal procedures and breeding were performed in accordance with the institutional review committees at the Hubrecht Institute and the Medical College of Wisconsin. These animal studies were performed under protocols approved either by the Institutional Animal Care and Use Committee of MCW or by the animal ethical committee (DEC) of the Netherlands Academy of Sciences (KNAW), the Netherlands (Protocol nr: H1 11 08.02). Animals with the Fah mutation and IL2RG deficiency were maintained on drinking water containing 16 mg/L (2-(2-nitro-4-trifluoromethylbenzoyl)-1,3-cyclohexanedione) (NTBC) (a kind gift from Yecuris, Inc.) and Sulfatrim at a dose of 56 mg/L.

Rat liver stem cell isolation and culture

All chemicals were obtained from Sigma Aldrich (Zwijndrecht, the Netherlands) unless stated otherwise. A lobe of freshly isolated liver was cut into small pieces that were resuspended in collagenase solution consisting of 0.02% Collagenase type IV in freshly prepared Krebs solution (120 mM NaCl, 4.8 mM KCl, 1.2 mM KH2PO4, 1.2 mM MgSO4.7 H2O, 24 mM NaHCO3, 1.3 mM CaCl2, and 20 mM HEPES). After a 10 minute incubation at 37 °C the cell suspension was passed through a 40 μm cell strainer and diluted 4-fold with ice-cold Krebs solution. The cell suspension was centrifuged at 60 g and the supernatant was centrifuged at 300 g. The resulting cell pellet was washed once in Advanced DMEM/F12 (Life Technologies, Bleiswijk, the Netherlands) followed by another 5 min centrifugation at 300 g. The cell pellet was resuspended in ice-cold matrigel and plated as 50 μl droplets of a warm 24 well plate. After the matrigel had solidified the culture medium was added to the wells. Culture medium consisted of Advanced DMEM/F12, 1.25 mM n-acetylcysteine, 50% WNT3a conditioned medium (produced in house), 10% RSPO1 conditioned medium (produced in house), 10% NOGGIN conditioned medium (produced in house), 50 ng/ml EGF (Peprotech, London, United Kingdom), 10 nM gastrin (Sigma-Aldrich), 100 ng/ml Fgf10 (Peprotech), 10 mM nicotinamide (Sigma-Aldrich), 50 ng/ml HGF (Peprotech), and 10 μM Y-27632 (ENZO Life Sciences, Raamsdonksveer, the Netherlands). Culture medium also contained HEPES (Life Technologies), B27 supplement without retinoic acid (Life Technologies), and N2 supplement (Life Technologies). The same medium was used to test the effects of WNT or NOGGIN depletion, except for that WNT or NOGGIN conditioned media were replaced with media conditioned on control cell lines that do not produce these factors. Rat liver stem cells were cultured in a humidified tissue culture incubator with 5%CO2 and atmospheric O2 at 37 °C. Medium was refreshed every other day and the cells were mechanically split every 6–9 days at 1:4–1:8 split ratios. Clonal lines were obtained after manually picking and expanding single organoids. For in vitro differentiation, rat liver organoids were seeded and kept 2–4 days under regular medium. Then the medium was replaced with medium containing A8301 (50 nM, Tocris Bioscience) and DAPT (10 nM,Sigma-Aldrich) and lacking RSPO1, HGF and nicotinamide. Medium was changed every other day for a period of 10 days.

Transplantations

Fah−/−; Il2rg−/− animals 4–5 weeks of age were placed on 2 mg/L NTBC two days prior to transplantation. At the day of transplantation the animals were anesthetized by isoflurane inhalation. Single cell suspensions containing ~2.5 × 10e6 liver stem cells in 500 μl of 0.9% saline were injected into the tip of the spleen using a 27 gauge needle. Controls animals received saline alone. Animals were kept on 2 mg/L NTBC for one week following transplantation to allow for engraftment and maturation of cells. Animals were then removed from NTBC for 2 days, followed by 4 days of 16 mg/L NTBC administration. The animals were then cycled off/on NTBC according to 15% weight loss. 15% weight loss was calculated from the day of withdrawal weight or the day of highest achieved body weight. Animals were weighed and distress scored daily until they reach 15% weight loss or a distress score of six upon which they were returned to NTBC-Sulfatrim supplemented water for five days at a time. After five days, animals were removed from NTBC-Sulfatrim supplemented water and 15% weight loss was calculated again. This cycle was repeated as needed for each individual animal until the end of the experiment.

Immunohistochemistry

Formalin-fixed and paraffin embedded liver tissues were deparaffinized followed by blocking of endogenous peroxidase activity. Antigen Retrieval was performed by boiling the slides for 30 minutes in citrate buffer (pH 6.0). Non-specific binding sides were blocked with normal goat serum prior to incubation with the primary antibody solution. The following primary antibodies (all from Bio-Connect, Huissen, the Netherlands) were used: rabbit anti-FAH (cat. no. ARP41681_T100) rabbit anti-Cytokeratin 19 (cat. no. 14965-1-AP) and rabbit anti-Albumin (cat. no. 16475-1-AP). After the wash steps following the primary antibody step, the sections were incubated in HRP conjugated anti-rabbit (DAKO envision system K4003, Heverlee, Belgium). Antibody binding was visualized by incubating the sections with DAB substrate and the sections were counterstained with hematoxylin before the slides were mounted. To quantify the engraftment areas, 10 random areas were designated per slide and in these areas graft sizes were measured based on FAH expression. Since some of the transplanted cells probably are FAH negative, these values likely represent underestimates of the true engraftment.

Quantitative RT-PCR

RNA extraction from rat liver stem cells was performed with Trizol (Life Technologies) according to the manufacturer’s protocol. RNA was reverse transcribed with M-MLV reverse transcriptase (Promega, Leiden, the Netherlands) using random primers. The resulting cDNA was used as a template in real time PCR reactions. PCR reactions were prepared according the SYBR green supermix protocol (Bio-Rad, Veenendaal, the Netherlands) using intron-spanning primer pairs (Table 1). RT-PCR reactions were run on CFX 96 and CFX 384 real-time PCR detection systems (Bio-Rad). PCR amplification cycles were preceded by a 3 minute step at 95.0 °C followed by 40 cycles at 95.0 °C, 58.0 °C, 72.0 °C, and 80 °C (real-time measurement) respectively. Melt curves were generated after PCR amplification. The threshold cycles were used to calculate relative expression levels according to the ∆∆Ct method with GAPDH as a reference gene.
Table 1

List of primers.

GeneForward PrimerReverse Primer
GapdhTGACTCTACCCACGGCAAGTTCAAACGACATACTCAGCACCAGCATCA
Hnf6CCGGAGGATGTGGAAGTGGAGCTGCTGGGAAATGGTGA
Krt19CTAATGGCGAGCTGGAGGTGAAGGGCGGGCATTGTCGATCTGTAGGA
Lgr5AGATGAGCGGGACCTTGAAATTACCCCGATTAGCAGTTTTATG
Bmp2ATCCGGCCGCCCCTTGTCCTCCTGGCTGGCCCGAGTGC
PpargCCTGCGGAAGCCCTTTGGTGACCTTGGCGAACAGCTGGGAGGAC
Tbx3CTGCCCTTCCACCTCCAACAACACGGCACCGGGACTGGGATGGAATAC
AlbuminCAAGGCTGCCGACAAGGATAACAATTGCGGCACAGAGAAAAGAAGT
Cyp3a11AGAGAACCGCATGCAAGAGAAAGTAGCCGGCAAAAATAAAGAAAATGG
G6pCTCGGGGGAATGCATGTGATAGGAACCCCGGATGTGGCTGAAAGTT
Cd44GACCGGGATGACGCCTTCTTTATTTTCTTGCCTCTTGGGTGGTGTTTC
Prom1AGGGGGTATATGTCGATTGATGAAATTAAGCCACCCAGCCACCAGTAT
Sox9TGGCAGAGGGTGGCAGACAGCCGTTGGGCGGCAGGTATTGG

RNA-sequencing

RNA extraction from 7 clones of rat liver stem cells (3xSHR, 4xBNLx) and 4 liver samples (2x SHR and 2xBNLx) was performed with Trizol (Life Technologies) according to the manufacturer’s protocol. The isolated RNA was subjected to poly (A) selection with the MicroPoly(A) Purist Kit (Life Technologies) and CAP-selection with the mRNA ONLY Eukaryotic mRNA isolation kit (Epicentre/Illumina, Eindhoven, the Netherlands). Next, the CAP and poly (A) selected RNA was heat sheared followed by hybridization and ligation to the SOLID adapters according to the SOLID sequencing protocol. The RNA was reverse transcribed using the SOLID RT primer followed by size-selection of the complementary DNA (cDNA). The cDNA was subsequently amplified using a SOLID PCR primer and a unique barcoding primer for each library. Sequencing was performed on a SOLID Wildfire. The dataset is publicly available at the European Nucleotide Archive (ENA): http://www.ebi.ac.uk/ena/data/view/PRJEB9910.

RNA-seq data analysis

RNA-seq reads were mapped with Burrows-Wheeler Aligner 0.5.946 onto the rat reference genome RGSC5.0. The BAM files were sorted with Sambamba v0.5.147 and reads were counted with HTSeq-count version 0.6.0 (default settings)48 to exons as defined in Rattus_norvegicus.Rnor_5.0.74.gtf (Ensembl). Non-uniquely mapped reads were not counted, due to their alignment quality of 0. Subsequently, DESeq version 1.16.049 was used to normalize counts. The non-zero normalized gene counts showed a bimodal distribution, and a gene read count threshold of 50 was used to select expressed genes (see Supplemental Fig. S1). Hierarchical clustering was performed using the Spearman’s rank correlation of the normalized counts of expressed genes and divides liver samples and liver stem cell samples into two distinct groups (see Supplemental Fig. S2). DESeq nbinomTest was used to test for differential expression between liver and LSC samples. We selected differentially expressed genes with an adjusted P-value < 0.05 (Benjamini-Hochberg FDR correction) and an absolute log2 fold-change>2. The resulting 2672 genes were divided into a set of 396 genes higher expressed in the rat liver stem cells compared to the liver and a set of 2276 genes expressed at lower levels in the LSCs. These gene sets were functionally annotated using DAVID3536.

Additional Information

How to cite this article: Kuijk, E. W. et al. Generation and characterization of rat liver stem cell lines and their engraftment in a rat model of liver failure. Sci. Rep. 6, 22154; doi: 10.1038/srep22154 (2016).
  47 in total

1.  Immunolocalization of extracellular matrix components and integrins during mouse liver development.

Authors:  Nobuyoshi Shiojiri; Yoshinori Sugiyama
Journal:  Hepatology       Date:  2004-08       Impact factor: 17.425

2.  Hepatic stellate cells contribute to progenitor cells and liver regeneration.

Authors:  Claus Kordes; Iris Sawitza; Silke Götze; Diran Herebian; Dieter Häussinger
Journal:  J Clin Invest       Date:  2014-11-17       Impact factor: 14.808

3.  Adult hepatocytes are generated by self-duplication rather than stem cell differentiation.

Authors:  Kilangsungla Yanger; David Knigin; Yiwei Zong; Lara Maggs; Guoqiang Gu; Haruhiko Akiyama; Eli Pikarsky; Ben Z Stanger
Journal:  Cell Stem Cell       Date:  2014-08-14       Impact factor: 24.633

4.  A novel rat model of hereditary hemochromatosis due to a mutation in transferrin receptor 2.

Authors:  Thomas B Bartnikas; Sheryl J Wildt; Amy E Wineinger; Klaus Schmitz-Abe; Kyriacos Markianos; Dale M Cooper; Mark D Fleming
Journal:  Comp Med       Date:  2013-04       Impact factor: 0.982

Review 5.  In vitro assays for induction of drug metabolism.

Authors:  Brian G Lake; Roger J Price; Amanda M Giddings; David G Walters
Journal:  Methods Mol Biol       Date:  2009

Review 6.  Mechanisms of liver development: concepts for understanding liver disorders and design of novel therapies.

Authors:  Frédéric P Lemaigre
Journal:  Gastroenterology       Date:  2009-03-27       Impact factor: 22.682

7.  Identification of stem cells in small intestine and colon by marker gene Lgr5.

Authors:  Nick Barker; Johan H van Es; Jeroen Kuipers; Pekka Kujala; Maaike van den Born; Miranda Cozijnsen; Andrea Haegebarth; Jeroen Korving; Harry Begthel; Peter J Peters; Hans Clevers
Journal:  Nature       Date:  2007-10-14       Impact factor: 49.962

8.  Differential expression analysis for sequence count data.

Authors:  Simon Anders; Wolfgang Huber
Journal:  Genome Biol       Date:  2010-10-27       Impact factor: 13.583

9.  Long-term culture of genome-stable bipotent stem cells from adult human liver.

Authors:  Meritxell Huch; Helmuth Gehart; Ruben van Boxtel; Karien Hamer; Francis Blokzijl; Monique M A Verstegen; Ewa Ellis; Martien van Wenum; Sabine A Fuchs; Joep de Ligt; Marc van de Wetering; Nobuo Sasaki; Susanne J Boers; Hans Kemperman; Jeroen de Jonge; Jan N M Ijzermans; Edward E S Nieuwenhuis; Ruurdtje Hoekstra; Stephen Strom; Robert R G Vries; Luc J W van der Laan; Edwin Cuppen; Hans Clevers
Journal:  Cell       Date:  2014-12-18       Impact factor: 41.582

10.  HTSeq--a Python framework to work with high-throughput sequencing data.

Authors:  Simon Anders; Paul Theodor Pyl; Wolfgang Huber
Journal:  Bioinformatics       Date:  2014-09-25       Impact factor: 6.937

View more
  23 in total

1.  Hepatic progenitor cell activation in liver repair.

Authors:  Adam Bria; Jorgessen Marda; Junmei Zhou; Xiaowei Sun; Qi Cao; Bryon E Petersen; Liya Pi
Journal:  Liver Res       Date:  2017-08-09

2.  Pigment epithelium-derived factor (PEDF) peptide promotes the expansion of hepatic stem/progenitor cells via ERK and STAT3-dependent signaling.

Authors:  Shou-Chuan Shih; Tsung-Chuan Ho; Show-Li Chen; Yeou-Ping Tsao
Journal:  Am J Transl Res       Date:  2017-03-15       Impact factor: 4.060

3.  Syngeneic implantation of mouse hepatic progenitor cell-derived three-dimensional liver tissue with dense collagen fibrils.

Authors:  Miho Tamai; Eijiro Adachi; Masaya Kawase; Yoh-Ichi Tagawa
Journal:  World J Gastroenterol       Date:  2022-04-14       Impact factor: 5.374

4.  Measuring mutation accumulation in single human adult stem cells by whole-genome sequencing of organoid cultures.

Authors:  Myrthe Jager; Francis Blokzijl; Valentina Sasselli; Sander Boymans; Roel Janssen; Nicolle Besselink; Hans Clevers; Ruben van Boxtel; Edwin Cuppen
Journal:  Nat Protoc       Date:  2017-12-07       Impact factor: 13.491

5.  Fumarylacetoacetate Hydrolase Knock-out Rabbit Model for Hereditary Tyrosinemia Type 1.

Authors:  Li Li; Quanjun Zhang; Huaqiang Yang; Qingjian Zou; Chengdan Lai; Fei Jiang; Ping Zhao; Zhiwei Luo; Jiayin Yang; Qian Chen; Yan Wang; Philip N Newsome; Jon Frampton; Patrick H Maxwell; Wenjuan Li; Shuhan Chen; Dongye Wang; Tak-Shing Siu; Sidney Tam; Hung-Fat Tse; Baoming Qin; Xichen Bao; Miguel A Esteban; Liangxue Lai
Journal:  J Biol Chem       Date:  2017-01-04       Impact factor: 5.157

Review 6.  Cellular Mechanisms of Liver Regeneration and Cell-Based Therapies of Liver Diseases.

Authors:  Irina V Kholodenko; Konstantin N Yarygin
Journal:  Biomed Res Int       Date:  2017-01-22       Impact factor: 3.411

Review 7.  Multi‑layered prevention and treatment of chronic inflammation, organ fibrosis and cancer associated with canonical WNT/β‑catenin signaling activation (Review).

Authors:  Masaru Katoh
Journal:  Int J Mol Med       Date:  2018-05-17       Impact factor: 4.101

8.  Human liver stem cells attenuate concanavalin A-induced acute liver injury by modulating myeloid-derived suppressor cells and CD4+ T cells in mice.

Authors:  Yanzhen Bi; Jiannan Li; Yonghong Yang; Quanyi Wang; Quanquan Wang; Xiaobei Zhang; Guanjun Dong; Yibo Wang; Zhongping Duan; Zhenfeng Shu; Tongjun Liu; Yu Chen; Kai Zhang; Feng Hong
Journal:  Stem Cell Res Ther       Date:  2019-01-11       Impact factor: 6.832

9.  Efficient liver repopulation of transplanted hepatocyte prevents cirrhosis in a rat model of hereditary tyrosinemia type I.

Authors:  Ludi Zhang; Yanjiao Shao; Lu Li; Feng Tian; Jin Cen; Xiaotao Chen; Dan Hu; Yan Zhou; Weifen Xie; Yunwen Zheng; Yuan Ji; Mingyao Liu; Dali Li; Lijian Hui
Journal:  Sci Rep       Date:  2016-08-11       Impact factor: 4.379

10.  Elevation of tumour markers TGF-β, M2-PK, OV-6 and AFP in hepatocellular carcinoma (HCC)-induced rats and their suppression by microalgae Chlorella vulgaris.

Authors:  Khaizurin Tajul Arifin; Suhaniza Sulaiman; Suhana Md Saad; Hanafi Ahmad Damanhuri; Wan Zurinah Wan Ngah; Yasmin Anum Mohd Yusof
Journal:  BMC Cancer       Date:  2017-12-21       Impact factor: 4.430

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.