| Literature DB >> 26913023 |
Yi-Ping Wang1, Wen-Juan Du1, Li-Ping Huang1, Yan-Wu Wei1, Hong-Li Wu1, Li Feng1, Chang-Ming Liu1.
Abstract
Pseudorabies virus (PRV) DNA replication occurs in the nuclei of infected cells and requires the viral DNA polymerase. The PRV DNA polymerase comprises a catalytic subunit, UL30, and an accessory subunit, UL42, that confers processivity to the enzyme. Its nuclear localization is a prerequisite for its enzymatic function in the initiation of viral DNA replication. However, the mechanisms by which the PRV DNA polymerase holoenzyme enters the nucleus have not been determined. In this study, we characterized the nuclear import pathways of the PRV DNA polymerase catalytic and accessory subunits. Immunofluorescence analysis showed that UL42 localizes independently in the nucleus, whereas UL30 alone predominantly localizes in the cytoplasm. Intriguingly, the localization of UL30 was completely shifted to the nucleus when it was coexpressed with UL42, demonstrating that nuclear transport of UL30 occurs in an UL42-dependent manner. Deletion analysis and site-directed mutagenesis of the two proteins showed that UL42 contains a functional and transferable bipartite nuclear localization signal (NLS) at amino acids 354-370 and that K(354), R(355), and K(367) are important for the NLS function, whereas UL30 has no NLS. Coimmunoprecipitation assays verified that UL42 interacts with importins α3 and α4 through its NLS. In vitro nuclear import assays demonstrated that nuclear accumulation of UL42 is a temperature- and energy-dependent process and requires both importins α and β, confirming that UL42 utilizes the importin α/β-mediated pathway for nuclear entry. In an UL42 NLS-null mutant, the UL42/UL30 heterodimer was completely confined to the cytoplasm when UL42 was coexpressed with UL30, indicating that UL30 utilizes the NLS function of UL42 for its translocation into the nucleus. Collectively, these findings suggest that UL42 contains an importin α/β-mediated bipartite NLS that transports the viral DNA polymerase holoenzyme into the nucleus in an in vitro expression system.Entities:
Keywords: DNA polymerase; UL42; accessory subunit; nuclear transport; pseudorabies virus
Year: 2016 PMID: 26913023 PMCID: PMC4753316 DOI: 10.3389/fmicb.2016.00124
Source DB: PubMed Journal: Front Microbiol ISSN: 1664-302X Impact factor: 5.640
Primers used in this study.
| UL42–HindIII-F | CCC | pCMV-Flag–UL42 |
| UL42–EcoRI-R | CCG | |
| UL30–EcoRI-F | CCG | pCAGGS-HA–UL30 |
| UL30–SphI-R | ACAT | |
| UL42(2–384)-F | CCC | pEGFP–UL42(2–384) |
| UL42(2–370)-R | CCG | pEGFP–UL42(2–370) |
| UL42(2–366)-R | CCG | pEGFP–UL42(2–366) |
| UL42(2–363)-R | CCG | pEGFP–UL42(2–363) |
| UL42(2–353)-R | CCG | pEGFP–UL42(2–353) |
| UL42(354–384)-F | CCC | pEGFP–UL42(354–384) |
| UL42(364–384)-F | AGCTTCTCCCATCGCCAAGCGCCCGCGGACCGCCTCGGGGGAAGGGGGCCACGCCTAC GGAGATTTATTCTAAG | pEGFP–UL42(364–384) |
| UL42(364–384)-R | AATTCTTAGAATAAATCTCCGTAGGCGTGGCCCCCTTCCCCCGAGGCGGTCCGCGGG CGCTTGGCGATGGGAGA | |
| UL42(367–384)-F | AGCTTCTAAGCGCCCGCGGACCGCCTCGGGGGAAGGGGGCCACGCCTACGGAGAT TTATTCTAAG | pEGFP–UL42(367–384) |
| UL42(367–384)-R | AATTCTTAGAATAAATCTCCGTAGGCGTGGCCCCCTTCCCCCGAGGCGGTCCGCGG GCGCTTAGA | |
| UL42(371–384)-F | AGCTTCTACCGCCTCGGGGGAAGGGGGCCACGCCTACGGAGATTTATTCTAAG | pEGFP–UL42(371–384) |
| UL42(371–384)-R | AATTCTTAGAATAAATCTCCGTAGGCGTGGCCCCCTTCCCCCGAGGCGGTAGA | |
| SV40NLS-F | AGCTTCTCCAAAAAAGAAGAGAAAGGTAG | pEGFP–SV40NLS |
| SV40NLS-R | AATTCTACCTTTCTCTTCTTTTTTGGAGA | |
| UL42ΔNLS-F | GCGTCCTCCGCCGCCCCAGCAGCAGGAGATACCGCCTCGGGGGAAGGGGGCCACG CCTAC | pCMV-Flag–UL42ΔNLS |
| UL30(539–541)m-F | CCCCCGCCGCGGGGGACGCAGCACCAGCAGCCCCGCGCATGTACA | pCAGGS-HA–UL30(539−541)A |
| β-Gal–PstI-F | AAAA | pEGFP–β-Gal |
| β-Gal–BamHI-R | CGC | |
| SV40NLS–β-Gal-F | AGCTTCTCCAAAAAAGAAGAGAAAGGTATCTGCA | pEGFP–SV40NLS–β-Gal |
| SV40NLS–β-Gal-R | GATACCTTTCTCTTCTTTTTTGGAGA | |
| Pat4–β-Gal-F | AGCTTCTAAGCGCCCGCGGTCTGCA | pEGFP–Pat4–β-Gal |
| Pat4–β-Gal-R | GACCGCGGGCGCTTAGA | |
| Pat7–β-Gal-F | AGCTTCTCCCATCGCCAAGCGCCCGCGGTCTGCA | pEGFP–Pat7–β-Gal |
| Pat7–β-Gal-R | GACCGCGGGCGCTTGGCGATGGGAGA | |
| Bipartite–β-Gal-F | AGCTTCTAAGCGGCCCGCCGCCCCGCGCATGTACACGCCCATCGCCAAGCGCCCG CGGTCTGCA | pEGFP–Bipartite–β-Gal |
| Bipartite–β-Gal-R | GACCGCGGGCGCTTGGCGATGGGCGTGTACATGCGCGGGGCGGCGGGCCGCTTAGA | |
| K354A–β-Gal-F | AGCTTCGGCACGGCCCGCCGCCCCGCGCATGTACACGCCCATCGCCAAGCGCCCGCG GTCTGCA | pEGFP–K354A–β-Gal |
| K354A–β-Gal-R | GACCGCGGGCGCTTGGCGATGGGCGTGTACATGCGCGGGGCGGCGGGCCGTGCAGA | |
| R355A–β-Gal-F | AGCTTCGAAGGCACCCGCCGCCCCGCGCATGTACACGCCCATCGCCAAGCGCCCGCG GTCTGCA | pEGFP–R355A–β-Gal |
| R355A–β-Gal-R | GACCGCGGGCGCTTGGCGATGGGCGTGTACATGCGCGGGGCGGCGGGTGCCTTAGA | |
| (354–355)A–β-Gal-F | AGCTTCGGCAGCACCCGCCGCCCCGCGCATGTACACGCCCATCGCCAAGCGCCCGCG GTCTGCA | pEGFP–(354–355)A–β-Gal |
| (354–355)A–β-Gal-R | GACCGCGGGCGCTTGGCGATGGGCGTGTACATGCGCGGGGCGGCGGGTGCTGCAGA | |
| R360A–β-Gal-F | AGCTTCTAAGCGGCCCGCCGCCCCGGCAATGTACACGCCCATCGCCAAGCGCCCGCG GTCTGCA | pEGFP–R360A–β-Gal |
| R360A–β-Gal-R | GACCGCGGGCGCTTGGCGATGGGCGTGTACATTGCCGGGGCGGCGGGCCGCTTAGA | |
| K367A–β-Gal-F | AGCTTCTAAGCGGCCCGCCGCCCCGCGCATGTACACGCCCATCGCCGCACGCCCG CGGTCTGCA | pEGFP–K367A–β-Gal |
| K367A–β-Gal-R | GACCGCGGGCGTGCGGCGATGGGCGTGTACATGCGCGGGGCGGCGGGCCGCTTAGA | |
| R368A–β-Gal-F | AGCTTCTAAGCGGCCCGCCGCCCCGCGCATGTACACGCCCATCGCCAAGGCACCGCG GTCTGCA | pEGFP–R368A–β-Gal |
| R368A–β-Gal-R | GACCGCGGTGCCTTGGCGATGGGCGTGTACATGCGCGGGGCGGCGGGCCGCTTAGA | |
| R370A–β-Gal-F | AGCTTCTAAGCGGCCCGCCGCCCCGCGCATGTACACGCCCATCGCCAAGCGCCCGGC ATCTGCA | pEGFP–R370A–β-Gal |
| R370A–β-Gal-R | GATGCCGGGCGCTTGGCGATGGGCGTGTACATGCGCGGGGCGGCGGGCCGCTTAGA | |
| Impα1–EcoRI-F | CCG | pCAGGS-HA–Impα1 |
| Impα1–XhoI-R | CCG | |
| Impα3–EcoRI-F | CCG | pCAGGS-HA–Impα3 |
| Impα3–XhoI-R | CCG | |
| Impα4–EcoRI-F | CCG | pCAGGS-HA–Impα4 |
| Impα4–XhoI-R | CCG | |
| Impα5–EcoRI-F | CCG | pCAGGS-HA–Impα5 |
| Impα5–XhoI-R | CCG | |
| Impα6–EcoRI-F | CCG | pCAGGS-HA–Impα6 |
| Impα6–XhoI-R | CCG | |
| Impα7–EcoRI-F | CCG | pCAGGS-HA–Impα7 |
| Impα7–XhoI-R | CCG | |
| Impα8–EcoRI-F | CCG | pCAGGS-HA–Impα8 |
| Impα8–XhoI-R | CCG | |
| Impβ–ClaI-F | CC | pCAGGS-HA–Impβ |
| Impβ–SphI-R | ACAT | |
| Impα4–ClaI-F | CC | pCAGGS-His–Impα4 |
| Impα4–SphI-R | ACAT |
Impα and Impβ are the abbreviations of importin α and importin β, respectively.
The sequences of the primers UL42(2–384)-R and UL42(354–384)-R are consistent with the sequence of the primer UL42-EcoRI-R.
The sequences of the primers UL42(2–370)-F, UL42(2–366)-F, UL42(2–363)-F, and UL42(2–353)-F are consistent with the sequence of the primer UL42(2–384)-F.
UL30(539–541)m-F and its corresponding complementary reverse primer were used for the construction of pCAGGS-HA–UL30(539-541)A, according to the QuickChange Site-Directed Mutagenesis Kit instructions, in which 539KRR541 is substituted with three alanine residues.
The underlined sequences represent the restriction sites introduced for convenient cloning. Of the primers [UL42ΔNLS-F and UL30(539–541)m-F] designed for site-directed mutagenesis, only the forward primers are shown, but the corresponding complementary reverse primers were also used.
Recombinant plasmids pEGFP–UL42(364–384), pEGFP–UL42(367–384), pEGFP–UL42(371–384), and pEGFP–SV40NLS were constructed by inserting the corresponding annealed primer pairs into the HindIII and EcoRI sites of pEGFP-C1.
Recombinant plasmids pEGFP–SV40NLS–β-Gal, pEGFP–Pat4–β-Gal, pEGFP–Pat7–β-Gal, pEGFP–Bipartite–β-Gal, pEGFP–K354A–β-Gal, pEGFP–R355A–β-Gal, pEGFP–(354–355)A–β-Gal, pEGFP–R360A–β-Gal, pEGFP–K367A–β-Gal, pEGFP–R368A–β-Gal, and pEGFP–R370A–β-Gal were constructed by inserting the corresponding annealed primer pairs into the HindIII and PstI sites of pEGFP–β-Gal.
Figure 1Nuclear transport of the PRV DNA polymerase catalytic subunit UL30 requires the accessory subunit UL42. (A) Co-IP of HEK293T cells transfected with pCMV-Flag–UL42 and/or pCAGGS-HA–UL30. IP was performed with an MAb recognizing the Flag tag, and the western blotting (WB) was probed with the antibodies indicated on the left. The cytoskeletal protein β-actin was used as the internal control. The asterisk indicates the heavy chain of IgG. The positions of the molecular mass markers (kDa) are indicated on the left. The WB results are representative of three or more independent experiments. (B) Reverse Co-IP of HEK293T cells transfected with pCMV-Flag–UL42 and/or pCAGGS-HA–UL30. IP was performed with an MAb recognizing the HA tag, and the WB was probed using the antibodies indicated on the left. The cytoskeletal protein β-actin was used as the internal control. The asterisk indicates the heavy chain of IgG. The positions of the molecular mass markers (kDa) are indicated on the left. The WB results are representative of three or more independent experiments. (C) Colocalization of UL42 and UL30 in the absence of other viral proteins. HeLa cells were transfected with pCMV-Flag–UL42 and/or pCAGGS-HA–UL30, fixed at 24 h posttransfection, and subjected to immunofluorescence analyses using antibodies directed against either the Flag tag (FITC, green) or the HA tag (TRITC, red) and the DNA was stained with Hoechst (DAPI, blue). The merged FITC, TRITC, and DAPI signals are shown. The images of each construct are representative of three independent transfection experiments. (D) To analyze the localization patterns of Flag–UL42 and HA–UL30 statistically, 100 positive cells expressing Flag–UL42 or HA–UL30 or coexpressing Flag–UL42 and HA–UL30 were scored from independent transfections in three repeated experiments and the relative percentages of the different subcellular localization categories were calculated. N, exclusively nuclear; C > N, more cytoplasmic than nuclear.
Figure 2UL42 contains a functional and transferable bipartite NLS that mediates its nuclear localization. (A) The predicted NLSs in the PRV UL42 and UL30 sequences identified with the PSORT II software program. The single-letter amino acid code is used. The superscript numbers indicate the corresponding amino acid positions within the protein sequence. (B) Schematic representation of EGFP, EGFP–SV40NLS, and full-length EGFP–UL42 and their truncated mutant derivatives, which were used to identify the putative NLS in UL42. The localization of various EGFP-expressing fusion proteins was categorized into five different patterns: N, exclusively nuclear; N > C, more nuclear than cytoplasmic; N = C, diffuse; C > N, more cytoplasmic than nuclear; and C, strictly cytoplasmic. The localization results are summarized on the right. (C) For each construct, 100 EGFP-expressing cells were scored from independent transfections in three repeated experiments and the relative percentages of the different subcellular localization categories of the fusion constructs were calculated. N, exclusively nuclear; N > C, more nuclear than cytoplasmic; N = C, diffuse; C > N, more cytoplasmic than nuclear; C, strictly cytoplasmic. (D) Representative localization images of various UL42–EGFP fusion protein constructs. Localization of the fusion proteins was analyzed as the fluorescent EGFP signal with confocal microscopy, and the DNA was stained with Hoechst reagent. The merged GFP and DAPI signals are shown. The image for each construct is representative of three independent transfection experiments. (E) Schematic representation of the classical SV40 TAg-NLS and the predicted UL42 pat4, pat7, or bipartite NLS fused between EGFP and β-Gal. “None” indicates that no specific motif was fused between these two reporter proteins. The localization of these constructs is summarized on the right. N, exclusively nuclear; C > N, more cytoplasmic than nuclear; C, strictly cytoplasmic. (F) For each construct, 100 EGFP-expressing cells were scored after independent transfections in three repeated experiments and the relative percentages of the different subcellular localizations of the fusion constructs were estimated. N, exclusively nuclear; C > N, more cytoplasmic than nuclear; C, strictly cytoplasmic. (G) Representative localization images of various EGFP–β-Gal fusion proteins containing the specific NLS. Localization of the fusion proteins was analyzed as the fluorescent EGFP signal using confocal microscopy, and the DNA was stained with Hoechst reagent. The merged GFP and DAPI signals are shown. The image for each construct is representative of three independent transfection experiments.
Figure 3K Schematic representation of the classical SV40 TAg-NLS, the UL42 bipartite NLS, and the UL42 NLS bearing amino acid substitutions fused between EGFP and β-Gal. “None” indicates that no specific motif was fused between these two reporter proteins. The red underlined amino acids were changed to A residue at the indicated positions. The localization of these constructs is summarized on the right. N, exclusively nuclear; N = C, diffuse; C > N, more cytoplasmic than nuclear; C, strictly cytoplasmic. (B) For each construct, 100 EGFP-expressing cells were scored after independent transfections in three repeated experiments and the relative percentages of the different subcellular localizations of the fusion constructs were estimated. N, exclusively nuclear; N > C, more nuclear than cytoplasmic; N = C, diffuse; C > N, more cytoplasmic than nuclear; C, strictly cytoplasmic. (C) Subcellular localization of various EGFP–β-Gal fusion proteins containing the specific NLS was analyzed with confocal microscopic analysis of the fluorescent EGFP signal and the Hoechst-reagent-stained DNA. The merged GFP and DAPI signals are shown. The image for each construct is representative of three independent transfection experiments.
Figure 4UL42 binds to importins α3 and α4 through its NLS. (A) Co-IP of HEK293T cells cotransfected with recombinant constructs encoding Flag–UL42 and HA-tagged importin α1, α3, α4, α5, α6, α7, or α8. (B) Co-IP of pCMV-Flag–UL42-transfected and untransfected HEK293T cells to identify the association between UL42 and endogenous importin α3. (C) Co-IP of pCMV-Flag–UL42-transfected and untransfected HEK293T cells to identify the association between UL42 and endogenous importin α4. (D) Co-IP of HEK293T cells cotransfected with recombinant constructs encoding Flag–UL42 or Flag–UL42ΔNLS and HA-tagged importin α3. (E) Co-IP of HEK293T cells cotransfected with recombinant constructs encoding Flag–UL42 or Flag–UL42ΔNLS and HA-tagged importin α4. IP was performed using an MAb recognizing the Flag tag, and the western blotting (WB) was probed with the antibodies indicated on the left. The cytoskeletal protein β-actin was used as the internal control. The asterisk indicates the heavy chain of IgG. The positions of the molecular mass markers (kDa) are indicated on the left. The WB results are representative of three or more independent experiments.
Figure 5Nuclear import of UL42 is an active process that depends on cytosolic factors and the NLS, and occurs in a temperature- and energy-dependent manner. (A) After the permeabilization of the cell membranes with digitonin and the depletion of soluble cytosolic factors by consecutively washing the cells with ice-cold TB, HeLa cells were incubated with an import mixture containing rabbit reticulocyte lysate (RRL), an ATP-regenerating system, and an import substrate of purified Flag–UL42 in TB (+RRL+E). –RRL+E, RRL was omitted from the import mixture. WGA, the cells were pretreated with WGA before incubation with the import mixture. 0°C, the nuclear import assay was performed on ice. AMP–PNP, the ATP-regenerating system was omitted and ATP was replaced with 1 mM AMP–PNP. The nuclear uptake was analyzed with immunofluorescence assays using an MAb recognizing the Flag tag. The merged FITC and DAPI signals are shown. Images are representative of three independent nuclear import assays. (B) +, equivalent to “+RRL+E” in (A). ΔNLS, the import substrate (purified Flag–UL42) was omitted and the purified Flag–UL42ΔNLS was added. The merged FITC and DAPI signals are shown. Images are representative of three independent nuclear import assays.
Figure 6UL42 is transported into the nucleus UL42 competes with the SV40 TAg–NLS, but not with the hnRNP A1-M9, for nuclear import. Nuclear import was performed in the presence of RRL, an ATP-regenerating system, and purified Flag–UL42 (+). TAg–NLS, 1 mM SV40 TAg–NLS peptide was added to the import mixture. A1-M9, 1 mM hnRNP A1-M9 peptide was added to the import mixture. The merged FITC and DAPI signals are shown. Images are representative of three independent nuclear import assays. (B) GTP dependence of UL42 nuclear uptake. Nuclear import was performed in the presence of RRL, an ATP-regenerating system, and purified Flag–UL42 (+). GTPγS, GTP was omitted and 1 mM GTPγS was added. The merged FITC and DAPI signals are shown. Images are representative of three independent nuclear import assays. (C) UL42 gains entry to the nucleus in the presence of importins α and β. Reconstitution assays were performed in transport buffer (TB), with a Ran mixture (3 μM Ran and 0.5 μM NTF2) (Ran), and the addition of 1 μM purified importin α4 (α) or 1 μM importin β (β) or 1 μM concentrations of both importin α4 and importin β (α+β), with 200 μg/ml purified Flag–UL42 as the import substrate. The merged FITC and DAPI signals are shown. Images are representative of three independent nuclear import assays.
Figure 7An UL42 NLS-null mutant confined the PRV DNA polymerase holoenzyme to the cytoplasm. (A) Co-IP of HEK293T cells transfected with pCMV-Flag–UL42ΔNLS and/or pCAGGS-HA–UL30. IP was performed with an MAb recognizing the Flag tag, and the western blotting (WB) was probed with the antibodies indicated on the left. The cytoskeletal protein β-actin was used as the internal control. The asterisk indicates the heavy chain of IgG. The positions of the molecular mass markers (kDa) are indicated on the left. The WB results are representative of three or more independent experiments. (B) Reverse Co-IP of HEK293T cells transfected with pCMV-Flag–UL42ΔNLS and/or pCAGGS-HA–UL30. IP was performed with an MAb recognizing the HA tag, and the WB was probed using the antibodies indicated on the left. The cytoskeletal protein β-actin was used as the internal control. The asterisk indicates the heavy chain of IgG. The positions of the molecular mass markers (kDa) are indicated on the left. The WB results are representative of three or more independent experiments. (C) HeLa cells transfected with pCMV-Flag–UL42ΔNLS and/or pCAGGS-HA–UL30 were analyzed by immunofluorescence assays using an MAb recognizing the Flag tag (FITC, green) and/or a PcAb recognizing the HA tag (TRITC, red). The DNA was stained with Hoechst reagent (DAPI, blue). The merged FITC, TRITC, and DAPI signals are shown. Image for each construct is representative of three independent transfection experiments. (D) To analyze the localization patterns of Flag–UL42ΔNLS and HA–UL30 statistically, 100 positive cells expressing Flag–UL42ΔNLS or HA–UL30 or coexpressing Flag–UL42ΔNLS and HA–UL30 were scored from independent transfections in three repeated experiments and the relative percentages of the different subcellular localization categories were calculated. C > N, more cytoplasmic than nuclear; C, strictly cytoplasmic.
Figure 8Schematic representation of the nuclear import pathway for the PRV DNA polymerase holoenzyme. (A) UL30 is not independently transported into the nucleus because it is large (116 kDa) and lacks a functional NLS. (B) UL42 can be independently imported into the nucleus via the classical importin α/β pathway. First, UL42 binds to the importin α/β heterodimer via its bipartite NLS to form a heterotrimeric complex in the cytoplasm, which then binds to the NPC via importin β. Second, the complex is translocated into the nucleus, where UL42 is released from the complex when importin β binds to nuclear RanGTP, and the transport receptors importins α and β are then recycled back to the cytoplasm for another round of import. (C) Nuclear import of the PRV DNA polymerase holoenzyme relies on the bipartite NLS present in its accessory subunit UL42. The UL42/UL30 holoenzyme complex was first assembled in the cytoplasm and then transported into the nucleus by the importin α/β pathway.