| Literature DB >> 26888582 |
Abstract
The Breast cancer 1, early onset gene (BRCA1) is known to be significantly associated with human familial breast cancer and is identified to play an important role in canine mammary tumors. Here, genetic variations in the coding region and DNA methylation in the 5' flanking region of BRCA1 in canine mammary tumor samples, 15 each of benign and malignant against 10 normal canine mammary tissue samples, were analyzed using the direct sequencing method. The results indicated two point mutations each in the coding region of canine BRCA1 in one benign mammary tumor sample (4702G >T and 4765G >T) and in one malignant canine mammary tumor sample (3619A >G and 4006G >A). No mutations were detected in the normal canine mammary tissue samples. The 4702G >T mutation was found to terminate further translation. The physical effect of the 4765G >T mutation was found to be the repalacement of the glutamate residue with glutamine. The physical effect of the 3619A >G mutation was found to be the replacement of the threonine residue with alanine, and that of mutation 4006G >A was the replacement of the valine residue with isoleucine in the BRCA1 protein. Bisulfite sequencing detected methylated CpG sites in one canine malignant mammary tumor sample. In conclusion, the present study elucidated the mutational status of the BRCA1 coding region and methylation status of the 5' flanking region of BRCA1 in canine mammary tumors.Entities:
Mesh:
Year: 2016 PMID: 26888582 PMCID: PMC4937153 DOI: 10.1292/jvms.15-0557
Source DB: PubMed Journal: J Vet Med Sci ISSN: 0916-7250 Impact factor: 1.267
Primer sequences used for PCR and sequencing
| Primer number | Primers sequence | Sizes | Coding exons | Extension time |
|---|---|---|---|---|
| 1 | F:AAGTGATGTGTGTGTAGGCAT | 331 bp | 1 | 30 sec |
| 2 | F: GTTTGTTGTCTTCATGGAGTGT | 564 bp | 2 | 40 sec |
| 3 | F: GCATGTAAGCTCAGTTTTCATAG | 501 bp | 3 | 40 sec |
| 4 | F: GAGCCTACAAGAAAGTACAAGA | 1,022 bp | 4, 5 | 1 min 10 sec |
| 5 | F: CCTGGAGTTTCTCTTCAAG | 182 bp | 6 | 30 sec |
| 6 | F: GCTCTGATTCAAACTTAGGA | 520 bp | 7 | 40 sec |
| 7 | F: TCCTGTTGCCCTTCCATAAAG | 511 bp | 8 | 40 sec |
| 8 | F: GGGAGTATGAGTCTGAGGATAGAAC | 2,598 bp | Part of exon 9 | 2 min 30 sec |
| 9 | F: AAGCTAAGAAGCCAGGCGATTTTGC | 2,176 bp | Part of exon 9 and exon 10 | 2 min 30 sec |
| 10 | F: CAGAGAGATACCATGCAAGATAAC | 172 bp | 11 | 30 sec |
| 11 | F: AGCCTCGTCTCAGCCAAGTAT | 588 bp | 12 | 40 sec |
| 12 | F: TGAAAAATATCCCACCTCAGC | 654 bp | 13 | 50 sec |
| 13 | F: GGTCATAAAACAGTTGGAGAAC | 697 bp | 14 | 50 sec |
| 14 | F: GTGAGCACAGACTATTTTAG | 479 bp | 15 | 30 sec |
| 15 | F: ATGCTGAGTTTGTGTGCGAACGA | 660 bp | 16, 17 | 50 sec |
| 16 | F: AGTCTCAATGAGGTGAAAAG | 549 bp | 18 | 40 sec |
| 17 | F: CGATGTTCTGATATTAGACTC | 423 bp | 19 | 30 sec |
| 18 | F: TAGAGGGTCCAGGTCAAGTG | 683 bp | 20, 21 | 50 sec |
| 19 | F: CGTGCTCCTGGTGACTTTTC | 502 bp | 22 | 40 sec |
| Sequencing primers | Sequencing primer 1: CTGAAATCAGACATGGAGAG | |||
| Sequencing primer 2: AAGGCATCAACAGTTAGCTC | ||||
| Bisulfite primers | F: TTTAGGGAAAGAATTGATGATTAAT | 217 bp | 30 sec |
Fig. 1.CpG islands in the 5′ flanking region of canine BRCA1 and bisulfite primers used for methylation analysis. Panel A: results of “CpG Island Searcher”. The bold line shows the CpG island in the 5′ flanking region of canine BRCA1. Numbers in panel A indicate the position of corresponding nucleotides relative to translation start (ATG). Panel B: CpG island sequence and bisulfite primer position. The complete sequence in panel B shows the CpG island sequence; position of every nucleotide relative to translation start (ATG) is shown. Capital letters indicate the region amplified by bisulfite PCR. Bold capital letters indicate the position of bisulfite primers. Panel C: partial results of “MethPrimer”. The primer pair “F1” and “R1” was used in the present study. Numbers in panel C indicate the position of corresponding nucleotides relative to translation start (ATG).
Fig. 2.PCR results of different BRCA1 exons. M: DNA molecular weight marker. Lanes 1–19 indicate fragments amplified by primer pairs 1–19. Sizes of amplified fragments were as expected.
Prediction of functional effects of the three nonsynonymous point mutations
| Type of mammary tumors | Positions of mutation | Changes of amino acids | PolyPhen prediction |
|---|---|---|---|
| Benign | 4765 G >C | E1589 Q | Probably damaging |
| Malignant | 3619 A >G | T1207 A | Benign |
| Malignant | 4006 G >A | V1336 I | Probably damaging |
Fig. 3.Methylation status of the 5′ flanking region of BRCA1. Panel A: bisulfite PCR results; M: DNA molecular weight marker. Using bisulfite-modified DNA (bDNA) as the template, the target fragment was successfully amplified. Using unmodified DNA (nDNA) as the template, the target fragment was not amplified, which indicated the specificity of the bisulfite primers. Panel B: the methylation status of normal mammary tissues. Panel C: the methylation status of the malignant tumor sample with methylated CpG sites. In panels B and C, each row of circles represents the methylation status of CpG sites obtained from one plasmid clone. The position of each CpG site relative to translation start (ATG) is shown. Open circles indicate the unmethylated CpG sites. Filled circles indicate the methylated CpG sites. Three clones of each sample were sequenced. As shown in panel B, all CpG sites were unmethylated in normal mammary tissues. As shown in panel C, the first four CpG sites were detected with methylation in one malignant mammary tumor sample.