Stage-Specific Profiling of Transforming Growth Factor-β, Fibroblast Growth Factor and Wingless-int Signaling Pathways during Early Embryo Development in The Goat.

OBJECTIVE: This research intends to unravel the temporal expression profiles of genes in- volved in three developmentally important signaling pathways [transforming growth factor-β (TGF-β), fibroblast growth factor (FGF) and wingless/int (WNT)] during preand peri-implan- tation goat embryo development.
MATERIALS AND METHODS: In this experimental study, we examined the transcripts that encoded the ligand, receptor, intracellular signal transducer and modifier, and the down- stream effector, for each signaling pathway. In vitro mature MII oocytes and embryos at three distinctive stages [8-16 cell stage, day-7 (D7) blastocysts and day-14 (D14) blas- tocysts] were separately prepared in triplicate for comparative real-time reverse tran- scriptase polymerase chain reaction (RT-PCR) using the selected gene sets.
RESULTS: Most components of the three signaling pathways were present at more or less stable levels throughout the assessed oocyte and embryo developmental stages. The transcripts for TGF-β, FGF and WNT signaling pathways were all induced in unfertilized MII-oocytes. However, developing embryos showed gradual patterns of decrease in the activities of TGF-β, FGF and WNT components with renewal thereafter.
CONCLUSION: The results suggested that TGF-β, FGF and WNT are maternally active signaling pathways required during earlier, rather than later, stages of preand peri- implantation goat embryo development.

Introduction

Pre-implantation embryo development is a characteristic feature of mammalian embryo development which encompasses a series of crucial events suchas the transition from oocyte to embryo, first cell divisions, and establishment of cellular contacts. These processes are under strict control of spatial and temporal regulation of gene expression, cell polarization, and cell-cell interactions (1).

The transcriptional circuitry that regulates embryo development comprises several hundred genes responsible for cell division, growth, differentiation, polarity, and apoptosis of embryonic cells. By combining several functions, such as cross-linking and other interactions, these genes provide pathways to form a complicated network of interactions that take shape in the context of various cell-signaling pathways which include fibroblast growth factors (FGF), mitogen-activated protein kinase (MAPK), phosphatidylinositol 3-kinase (PtdIns3K)⁄protein kinase B (PKB), also known as Akt and Janus-activated kinase (JAK)⁄signal transducer and activator of transcription (STAT), the wingless/int (WNT)⁄b-catenin pathway, notch, bone morphogenetic protein (BMP)-Smad, and hedgehog (1).

Pluripotency and self-renewal in the absence of differentiation are three fundamental traits of embryonic stem cells (ESCs) which are mostly maintained by the core transcription triad-OCT4, SOX2, and NANOG (2). Importantly, it has been established that the pluripotency transcription triad is highly responsive to upstream and downstream signals induced by WNT, transforming growth factor-β (TGF-β) and FGF signaling pathways. A functional WNT signaling system operates in the pre-implantation embryo and activation of the canonical pathway affects embryonic development in bovines (3), ESC self-renewal in humans and mice (4), as well as tumor progression (5). It is well established that phosphorylation inhibition of TGF-β signaling by SB(4-(5-Benzol[1,3] dioxol-5-yl-4-pyrldin-2-yl-1H-imidazol-2-yl)- benzamide hydrate, 4-[4-(1,3-Benzodioxol-5-yl)- 5-(2-pyridyridyl)-1H-imidazol-2-yl]-benzamide hydrate) supports mouse ESC self-renewal in the differentiation (6). The growth of primed stem cells are dependent on the FGF signaling pathway and notably, dual inhibition of extracellular signalregulated protein kinases 1 and 2 (ERK1/2) and glycogen synthase kinase 3 (GSK3), designated as 2i, has been shown to improve the efficacy of ESC-derivation in mice (7).

Despite two decades of effort, derivation of authentic ungulate ESCs remains challenging for embryologists. To date, ESCs have been successfully isolated only in rodents and primates. A clear understanding of the signaling pathways that regulate early embryo development will greatly benefit the current understanding of developmental biology and approaches to capture pluripotent stem cells in vitro. The current study has attempted to investigate the dynamics of expression of components from the three developmental signaling pathways (WNT, TGF-β, and FGF) at four distinctive stages of goat embryo development: i. Unfertilized in vitro mature (MII)-oocytes, ii. 8-16 cell stage which coincides with the stage concomitant with zygote genome activation in the goat, iii. Day-7 (D7) blastocysts and IV. Day-14 (D14) blastocysts.

Materials and methods

Chemicals and media

Unless otherwise stated, all chemicals were obtained from Sigma Chemical Co. (USA) and media from Gibco (Grand Island, USA).

Selection of gene sets

Due to the lack of sufficient data in the goat species, we searched related studies in humans (8), mice (9), bovine (10) and porcine (11) for the conserved upstream and downstream components of the TGF-β, FGF, and WNT signaling pathways. Accordingly, we selected 4 transcripts for the TGF-β (Bmpr1a, Alk4, Sdma1 and 5, Id3), 4 transcripts for the FGF (Lifr1, Akt, Fgf4, Erk1, Cdc25a) and 3 transcripts for the WNT (Fzd, Ctnnb, c-Myc) signaling pathways. The genes involved in both the core pluripotency triad (Oct4, Nanog, Sox2) and cell lineage commitment (Rex1, Cdx2, Gata4) were also considered. We took into consideration the lack of a previous report or database on gene sequences of many of these genes and designed the primers according to the conserved regions of these markers in bovine, ovine, humans and mice. For Erk1, Alk4, Bmpr1, Fgfr4 and Lifr1, portions of the cDNA were initially sequenced and registered in the NCBI site under the following accession numbers:

KC687077 (http://www.ncbi.nlm.nih.gov/nuccore/KC687077),

KF039752 (http://www.ncbi.nlm.nih.gov/nuccore/KF039752),

KF039753 (http://www.ncbi.nlm.nih.gov/nuccore/KF039753),

KF039754 (http://www.ncbi.nlm.nih.gov/nuccore/KF039754), and

KF356183 (http://www.ncbi.nlm.nih.gov/nuccore/KF356183).

Specific primers were subsequently designed from these recognized sequences (Table 1).

Table 1

Specific real-time primers designed for gene sequences

Gene	Primer sequences	Length of PCR product	TM
Lifr1	F: ATTTTTCGGTGTATGGGTGC	117	56
	R: CAGATGTATCCTCAACGGTA
Bmpr1	F: CCTGTTCGTCGTGTCTCAT	116	58
	R: CTGGTGCTAAGGTTACTCC
Alk4	F: TCTCCAAGGACAAGACGCTC	152	62
	R: ACGCCACACTTCTCCAAACC
Smad1	F: TCACCATTCCTCGCTCCCT	140	60
	R: AAACTCGCAGCATTCCAACG
Smad5	F: ACAGCACAGCCTTCTGGTTC	136	60
	R: GGGGTAGGGACTATTTGGAG
Id3	F: CGGCTGAGGGAACTGGTA	198	58
	R: CCTTTGGTCGTTGGAGATG
Ctnnb	F: AGTGGGTGGCATAGAGG	160	54
	R: CACAGGTAGCCCGTAG
Akt	F: TTCAGCAGCATCGTGTGGCA	98	60
	R: TCATCAAAATACCTGGTGTCCG
Oct4	F: GCCAGAAGGGCAAACGAT	96	56
	R: GAGGAAAGGATACGGGTC
Rex1	F: GCAGCGAGCCCTACACAC	94	61
	R: ACAACAGCGTCATCGTCCG
Fzd	F: CATCGGCACTTCCTTTATCC	89	59
	R: GCTTGTCCGTGTTCTCCC
C-myc	F: CAACACCCGAGCGACACC	160	61
	R: GCCCGTATTTCCACTATCCG
Sox2	F: ATGGGCTCGGTGGTGA	182	54
	R: CTCTGGTAGTGCTGGGA
Fgfr4	F: GCTGACTGGTAGGAAAGG	193	56
	R:AGTGGCTGAAGCACATCG
Nanog	F: GATTCTTCCACAAGCCCT	137	54
	R:TCATTGAGCACACACAGC
Erk1	F:TCAAGCCGTCCAACATCCT	204	58
	R:CGACCGCCATCTCAACC
Gata4	F:TCCCCTTCGGGCTCAGTGC	128	64
	R:GTTGCCAGGTAGCGAGTTTGC
Cdx2	F:CCCCAAGTGAAAACCAG	144	53
	R:TGAGAGCCCCAGTGTG
Cdc25a	F:TGGCAAGCGTGTTATCGTG	119	58
	R:GGTAGTGGAGTTTGGGGTA
ACTB	F:CCATCGGCAATGAGCGGT	146	60
	R:CGTGTTGGCGTAGAGGTC

PCR; Polymerase chain reaction and TM; Melting temperature.

In vitro production of goat embryos

This experimental study was conducted from 2011-2014.We used 850 goat ovaries that hadbeen derived from local breed does (Isfahani, Najdi) immediately after slaughter. The procedure for in vitro production of goat embryos has been previously described (12). In brief, goat ovaries were used for in vitro maturation of cumulus-oocyte complexes (COCs) in tissue culture medium-199 (TCM199) plus 10% fetal calf serum) FCS, (2.5 mM sodium pyruvate, 100 IU/mL penicillin, 100 μg/mL streptomycin, 10 μg/mL follicle stimulating hormone (FSH), 10 μg/mL luteinizing hormone (LH), 1 μg/mL estradiol-17β, and 0.1 mM cysteamine under mineral oil for 20-22 hours at 39˚C, 5% CO2, and maximum humidity. Next, they were divided into six groups and placed in 20 μl droplets that consisted of a modified formulation of synthetic oviductal fluid (mSOF) (12) and maintained at 39˚C, 6% CO2, 5% O2, and maximum humidity for embryo development. The MII oocytes at 20-22 hours post-maturation, day 3 (D3) developing embryos at the 8-16 cell stage, and day 7 (D7) blastocysts were collected, washed three times in phosphate-buffered saline (PBS), collected in pools of 60 (oocytes), 35-40 (D3 developing embryos), and 20 (D7 blastocysts) in 500 μL microtubes that contained lysis buffer RLT. They were subsequently frozen and stored at -70˚C until RNA extraction. All oocyte and embryo pools used for RNA extractions were collected and analyzed in triplicate. This system of embryo development had adequate rates of in vitro embryo development with cleavage rates between 85 to 92% and blastocyst rates between 40-45%.

Derivation of day-14 embryos

In order to extend the in vitro culture of goat blastocysts, we prepared a feeder later of caprine fetal fibroblasts (CFF) as described by Behboodi et al. (13). For this purpose, the CFF line was derived from three 40-day male fetuses surgically from donors. A single-cell suspension was prepared by mincing fetal tissue and culturing the tissue in Dulbecco’s modified eagle’s medium (DMEM) supplemented with 10% FBS, 0.25% amphotericin-B, 1% penicillin-streptomycin, and 1% gentamicin in 25 cm2 culture flasks at 37˚C and 6% CO2 until the appearance of a confluent monolayer from D4 onwards. The monolayer was trypsinized and further cultured for proliferation of the CFF source. Each passage took approximately 3-4 days until confluency. Passages 2-4 CFFs were treated with mitomycin (10 mg/mL) for 2 hours. Mitomycin treated cells were washed twice with DMEM and treated with trypsin-Ethylenediaminetetraacetic acid (EDTA) 0.25% (Supplemented by EDTA) and gently pipetted the confluent monolayer in order to obtain single cells. Cells were then seeded at 1×105cells/ml in 100 μl DMEM drops in the vicinity of a feeder-free 100 μl droplet of DMEM supplemented with 10% FBS, 1% Lglutamine, 1% non-essential amino acids, and 0.1% β-mercaptoethanol under mineral oil. We transferred 5-6 D7 blastocysts to each 100 μl droplet of feeder-free DMEM. By the aid of the tip of a draw pipette glass, the DMEM drops that contained blastocysts were gently connected to their adjacent DMEM that had a CFF monolayer. This joined culture system provided the beneficial effects of a feeder layer for extended in vitro embryo culture, but prevented attachment and flattening of the elongating blastocysts. The joined droplets were refreshed every other day until D14 of embryo development when pools of 7-10 well-developed spherical D14 embryos were pooled for RNA extraction as previously described.

RNA extraction and real time-polymerase chain reaction

The procedure for quantitative real-time PCR (qRT-PCR) has been previously described (14). In brief, total RNA from MII-oocytes, 8-16 (D3), blastocysts (D7) and elongating embryos (D14) was extracted with the RNeasy Micro kit (Qiagen, Canada) followed by treatment with DNase I (Ambion, Canada) according to the manufacturer’s protocol. RNA quality and quantity were determined using a WPA Biowave spectrophotometer (Cambridge, United Kingdom). For reverse transcription, 10 μl of total RNA was used in a final volume of a 20 μl reaction that contained 1 μl of random hexamer, 4 μl RT buffer (10x), 2 μl of dNTP, 1μl of RNase inhibitor (20 IU), and 1μl of reverse transcriptase (Fermentas, Canada). Reverse transcription was carried out at 25˚C for 10 minutes, 42˚C for 1 hour and 70˚C for 10 minutes.

Quantitative analysis of transcripts by real time-polymerase chain reaction

The transcripts abundance of the mentioned genes (Table 2) and ACTB as the housekeeping gene were analyzed with real-time RTPCR. Briefly, total RNA from the oocytes, D3 embryos, D7 blastocysts, and D14 blastocysts were extracted. Each of the RNA samples was used for cDNA synthesis. Real-time RT-PCR was carried out using 1 μl of cDNA (50 ng), 5 μl of the SYBR Green/0.2 μl ROX qPCR Master Mix (2X, Fermentas, Germany) and 1 μl of forward and reverse primers (5 pM) adjusted to a total volume of 10 μl using nuclease-free water. The primer sequences, annealing temperatures and the size of amplified products are shown in table 1.

Table 2

Detailed results of relative expressions of goat embryo during developmental stages by quantitative real-time PCR (qRT-PCR)

Gene	MII oocytes	8-16 cell	D7 blastocysts	D14 blastocysts
Lifr1	1a	0.402a	0.014b	0.001b
Bmpr1	1a	0.227b	0.015b	0.005b
Alk4	1a	0.242b	0.002c	0.002c
Smad1	1a	0.332b	0.028c	0.014c
Smad5	1a	0.592b	0.002c	0.002c
Id3	1a	0.118b	0.0001c	0.0001c
Fzd	1b	14.16a	0.170c	0.240c
Ctnnb	1a	0.327b	0.012c	0.004c
c-Myc	1b	60.00a	0.420bc	0.080c
Fgfr4	1c	218.0a	3.000c	9.000b
Erk1	1a	0.189b	0.004b	0.126b
Cdc25a	1b	2.884a	0.003c	0.016c
Akt	1a	0.640a	0.040b	0.050b
Oct4	1a	1.000a	0.280b	0.010c
Rex1	1a	0.718b	0.004c	0.010c
Sox2	1b	22.15a	0.080c	0.060c
Nanog	1c	6.700b	0.600c	12.30a
Gata4	1b	0.280c	0.020c	1.780a
Cdx2	1b	0.530bc	0.190c	4.220a

Significant difference at P<0.05%. a, b, c; No significant differences between the same letter and D; Day.

Statistical analysis

Statistical significance analysis was considered to be P<0.05 and determined by the two-tailed Fisher’s exact test in SPSS software version 20 for developmental data using two-tailed student’s t test with equal variance for cell counts and realtime PCR data.

Results

In vitro embryo development

The system used in this study for in vitro goat embryo development supported over 90% in vitro maturation based on the assessment of first polar body extrusion with cleavage rates from 85-92% and blastocyst rates between 40-45%. The quality of embryos were quite reasonable. In our routine system of goat embryo development, approximately 50% of in vitro developed blastocysts resulted in successful pregnancy and delivery of healthy kids (15). The culture system used to culture the blastocysts provided the beneficial effects of a feeder layer for extended in vitro embryo culture and prevented both attachment and flattening of the elongating blastocysts. From 50- 65% of the developed blastocysts progressed to the elongation stage.

Gene expression results

Table 2 lists the detailed results of real-time RTPCR of the 19 genes for each of the in vitro goat embryo developmental stages. In order to better illustrate the dynamics of each gene in a certain signaling pathway, we have adjusted the expression level of each gene to 100%; the expression levels at other time points were normalized to the peak level percentage (16). The transformed data were subsequently used to extrapolate the expression status of different components of the TGF-β, FGF, and WNT signaling pathways.

Transforming growth factor-β signaling pathway

Figure 1 shows the stage-specific expression status of different components of the TGF-β signaling pathway in association with the core pluripotency triad. As shown, MII-oocytes contained the highest transcript amounts of Bmpr1, Alk4, Smad1, Smad5, and Id3 compared to the other embryo stages. At the 8-16 cell stage, the relative abundance of all transcription factors decreased by 10% (Id3) to 60% (Smad5) of the initial abundances observed in the MII-oocytes. Further development of the embryos to D7 blastocysts was concomitant with the minimum relative abundances of these transcripts compared to the MII and 8-16 cell stages. The expression status of D14 embryos for different components of the TGF-β signaling was the same as for D7 blastocysts.

Fibroblast growth factor signaling pathway

Figure 2 shows the stage-specific expression status of different components of the FGF signaling pathway in association with the core pluripotency triad. As shown, there were two different expression patterns observed for components of the FGF signaling pathway. In the first pattern, MII-oocytes had the highest transcript abundances of Erk1, Bmpr1 and Akt compared to the other embryo stages. At the 8-16 cell stage, the relative abundances of all transcription factors decreased from 20% (Erk1) to 60% (Akt) of the initial abundances observed in the MII-oocytes. Further development of the embryos to D7 blastocysts was concomitant with the minimum relative abundances of these transcripts compared to the MII and 8-16 cell stages. Development to D14 blastocysts did not change their expressions compared to D7 blastocysts. In the second expression pattern, Fgfr4 and Cdc25a had maximum expression levels at the 8-16 cell stage compared to the other stages. Embryos that developed to D14 showed a medium increase in transcription of Fgfr4.

Wingless/int signaling pathway

Figure 3 shows the stage-specific expression status of different components of the WNT signaling pathway in association with the core pluripotency triad. As shown, Fzd and c-Myc both had a similar pattern in which a peak of expression was observed at the 8-16 cell stage, whereas their expressions either before (MII-oocyte) or after (D7 and D14 blastocysts) were at minimum levels. Ctnnb had the highest transcript level at the MII-oocyte stage which substantially decreased atthe 8-16 cell stage. Further development to D7 and D14 blastocysts did not induce a change in transcription when compared to the 8-16 cell stage.

Comparison of transforming growth factor-β (TGF-β) mRNA transcript expression during pre-implantation developmental stages. Oocyte stage gene expression as calibrator. All core pluripotency markers, with the exception of Nanog reduced from the 8-16 cell stage to the day-14 (D14) blastocyst stage. These factors possibly promote or antagonize interconversion between differentiation and pluripotency.

Expression of genes involved in the fibroblast growth factor (FGF) signaling pathway during goat pre-implantation development. qRT-PCR indicates low or lack of Rex1 expression during the8-16 cell stage; Akt, Gata4, Sox2 and Erk1/2 in the day-7 (D7) blastocyst stage; and Akt, Rex1, Oct4 and Sox2 in the day-14 (D14) blastocyststage.

Wingless/int (WNT) signaling in goat pre-implantation embryos. Expressions of c-Myc, Nanog and Sox2 were detected at higher levels in 8-16 cell embryos. Nanog, Cdx2 and Gata4 expressed at higher levels in the day-14 (D14) developmental stage. Values are of fold change calculated by using 2-ΔΔCT.

Core pluripotency triad

Oct4 showed its highest transcript abundance in MII-oocytes which persisted until the 8-16 cell stage but sharply decreased at the D7 and D14 developed blastocysts stages. The highest abundance of Sox2 was observed at the 8-16 cell stage compared to its lowest transcript abundance in the MIIoocyte stage. And also Sox2 had the lowest amount of transcript in D7 and D14 blastocysts stage compared to other stages. The lowest transcript levels of Nanog were found at MII-oocytes and D7 blastocysts with a medium burst in transcription at the 8-16 cell stage. Development to the D14 blastocyst was concomitant with a sharp increase in transcription activation of Nanog to its highest level at the D14 blastocyst stage.

Lineage specific markers

Figures 1-3 represent the stage-specific expression status of three specific linage markers. As shown, both Gata4 and Cdx2 showed their lowest expression levels in D7 blastocysts, whereas the highest expression levels were at the D14 blastocyst stage. Their transcript abundances at MII-oocyte stage were moderate but decreased to 10% of the levels observed in D14. In contrast, the highest transcript level of Rex1 was observed in MIIoocytes with a 30% decrease in 8-16 cell stage embryos and significant decrease to its minimum levels in D7 and D14 blastocysts.

Discussion

Mammalian development is based upon the capacity of pluripotent inner cell mass (ICM) cells for specification to over 200 cell lineages. This capacity has been captured ex vivo in rodents, then in primates through extrapolation of molecular pathways responsible for pluripotency in ICM cells (17). However, despite two decades of effort, derivation of authentic ungulate ESC remains an ongoing challenge for embryologists. Outstanding issues that include species-specific differences in pre-implantation embryo development, pluripotency pathways, and culture conditions may hinder the efforts to establish authentic ungulate ESC lines (17, 18). Here, we have attempted to unravel the transcriptional status of genes involved in three principal signaling pathways in association with pluripotency and cell linage commitment genes.

Generally, a signaling pathway is considered to be active if multiple components of signal transduction are expressed and if their patterns of expression of these genes are developmentally regulated (16). For the TGF-β, FGF, and WNT pathways, we have observed that the transcripts which encode ligands, receptors (Fgfr4, Lifr1, Bmpr1a, Alk4, and Fzd), intracellular signal transducers and modifiers (Ctnnb, Erk1, Akt, and Smad1, 5), and nuclear effectors (c-Myc, Id3, Cdc25a, Oct4, Sox2, Nanog, Cdx2, Gata4, and Rex1) were present. However, a number of signal transduction transcripts were more or less abundant with great fluctuations throughout preand peri-implantation development. Accordingly, while Oct4, Erk1, and Nanog continuously expressed throughout the analysis, Lifr1, Bmpr1, Alk4, Id3, Ctnnb, Smad2, 3, Akt, and Rex1 were abundant during the earliest stages of development and substantially decreased thereafter. In contrast, Gata4 and Cdx2 transcripts were highly abundant during the later stages of embryo development. Fzd, cMyc, Cdc25a, Sox2, and Fgfr4 highly expressed during the 8-16 cell stage but were at minimum levels before and after this stage. These patterns of gene expression corresponded to the zygote genome activation in 8-16 cell stages ofgoat species.

The TGF-β superfamily is considered a major regulator of cell growth, pluripotency/differentiation, and tumor suppression in the context of a large variety of biological systems. The main body of the TGF-β superfamily is composed of nearly 30 growth and differentiation factors that include TGF-β ligands (TGF-βs, Activins, Nodals) and BMP ligands (BMP-2, 4-7, MIS) (19). The interplay within TGF-β and between TGF-β, BMP and other signaling pathways is a stringent mechanism for the definition of the stem cell fate (20). Smad and co-Smad transcription factors (Smads) along with their inhibitors (I-Smads) are the main mediators. In this context, we have found that different components of TGF-β were highly abundant in MII-oocytes and subsequently decreased with no trend of re-initiation during transcription. This might suggest that TGF-β signal transduction was a maternally regulated system which might be in a relatively repressive state during early stages of embryo development in the goat.

As the key players of proliferation and differentiation in a wide range of cells and tissues, the FGF family of growth factors are amongst the most studied pathway for ex vivo induction and maintenanceof pluripotent stem cells (PSCs). It has been well established that ESCs that are null for FGF4 or those cultured in the presence of FGF receptor inhibitors such as PD0325901 are refractory to BMP-induced differentiation. Importantly, even in the absence of FGF4 in Fgf4-null cells, provision of FGF protein can restore the capacity of ESCs for differentiation. We have found that components of FGF signal transduction were differently expressed during preand peri-implantation in the goat. Highest expressions of Fgfr4 and Cdc25 were observed at the 8-16 cell stage. Erk1, Lifr1 and Akt were highly abundant in MII-oocytes and decreased thereafter. Possibly, FGF signal transduction might not be active during early stages of embryo development, in particular D7 blastocysts, in the goat.

Double inhibition of FGF (by small molecule PD0325901) and GSK3 (by small molecule CHIR) can promote ground state pluripotency, which in turn reflect the importance of an FGF inductive signaling (21). Harris et al. (22) applied 2i throughout bovine in vitro development and observed accelerated blastocyst development, increase numbers of ICM and TE cells, and notably increased expressions of Nanog and SOX2, with repressed putative hypoblast marker Gata4. These findings mightsupport the suggestion that suppression of the FGF pathway could pose an active pluripotency state in goat D7 and D14 blastocysts without the need for 2i inhibition. Further studies to clarify this issue would require precise detection of the expression state of the FGF signaling pathway at the protein level.

The WNT pathways comprise a wide variety of conserved glycoproteins that act as regulators of cancer, embryonic development, and cell fate/ proliferation. WNT pathway integrates signals at several points of the cascade with other pathways, including FGF and TGF-β (4,23). Activation of the WNT canonical pathway is important for selfrenewal in human and mice ESCs (4), in addition to tumor progression (5). Here, we have observed peak Fzd receptor transcripts at the 8-16 cell stage which quenched during D7 and D14 blastocyst development. Although Ctnnb transcripts were highly abundant in MII-oocytes, they sharply decreased during later developmental stages. The absence of Ctnnb hindered its translocation into the nucleus. The 2-amino-4-( 3,4-(methylenedioxy) benzylamino)-6-(3-methoxyphenyl)pyrimidine (AMBMP) and Dickkopf-related protein 1 (DKK1) are known activators and inhibitors of theWNT pathway. Interestingly, AMBMP-mediated activation of WNT signal transduction has decreased in vitro development of bovine embryos and reduced numbers of ICM and TE. It has been shown that day 6 bovine morula express 16 WNT genes and other genes involved in WNT signaling. They concluded that activation of the canonical WNT pathway inhibited bovine embryonic development (3). Therefore, our observation that a downstream signal of WNT was repressed in the goat blastocyst might suggest a poised state of developmental capacity in goat embryos compared to bovine embryos.

Conclusion

This study has provided the first set of data on the transcriptional states of TGF-β, FGF and WNT which are well established regulators of pluripotency and differentiation during preand peri-implantation goat embryo development. The resultant data suggested that TGF-β, FGF and WNT were highly active in unfertilized MII-oocytes.Their activities were repressed during subsequent stages of embryo development. This information suggested that TGF-β, FGF and WNT were maternally active signaling pathways required during earlier rather than later stages of preand peri–implantation embryo development in the goat. These data would increase our knowledge of signaling pathways that control early embryo development in this valuable farm species and would greatly benefit current chemical approaches used for manipulation of the ICM fate in vitro.