Venkat Shankar Raman1, Minu Bajpai2, Abid Ali2. 1. Department of Pediatric Surgery, Army Hospital R&R, Dhaula Kuan, India. 2. All India Institute of Medical Sciences, New Delhi, India.
Abstract
PURPOSE: The Bladder Exstrophy-Epispadias Complex (BEEC) is the most serious form of midline abdominal malformation. The etiology of BEEC is unknown and is thought to be multifactorial. Methylenetetrahydrofolate reductase (MTHFR) polymorphism C677T is strongly associated with other midline abnormalities such as neural tube defects. No proper case-control study existed comparing MTHFR polymorphism with BEEC. We sought to find an association with MTHFR polymorphism and patients with bladder exstrophy (BE). MATERIALS AND METHODS: The design of the study was a case-control study, involving 50 children with BEEC and 50 normal healthy school children. Genetic analysis for MTHFR 677 polymorphism was carried out after DNA extraction and polymerase chain reaction amplification. Epidemiological analysis was done by using the birth defect questionnaire on parents of BEEC. RESULTS: Forty-two classical BE, two cloacal exstrophies (CE), four epispadias, and two exstrophy variant patients were a part of this study. Severe variety of BE had a significant association with C667T MTHFR polymorphism as compared to the normal control population (P = 0.01). CONCLUSION: C677T MTHFR polymorphism has a strong association with severe variety (CE) of BEEC occurrence.
PURPOSE: The Bladder Exstrophy-Epispadias Complex (BEEC) is the most serious form of midline abdominal malformation. The etiology of BEEC is unknown and is thought to be multifactorial. Methylenetetrahydrofolate reductase (MTHFR) polymorphism C677T is strongly associated with other midline abnormalities such as neural tube defects. No proper case-control study existed comparing MTHFR polymorphism with BEEC. We sought to find an association with MTHFR polymorphism and patients with bladder exstrophy (BE). MATERIALS AND METHODS: The design of the study was a case-control study, involving 50 children with BEEC and 50 normal healthy school children. Genetic analysis for MTHFR 677 polymorphism was carried out after DNA extraction and polymerase chain reaction amplification. Epidemiological analysis was done by using the birth defect questionnaire on parents of BEEC. RESULTS: Forty-two classical BE, two cloacal exstrophies (CE), four epispadias, and two exstrophy variant patients were a part of this study. Severe variety of BE had a significant association with C667T MTHFR polymorphism as compared to the normal control population (P = 0.01). CONCLUSION:C677TMTHFR polymorphism has a strong association with severe variety (CE) of BEEC occurrence.
The bladder exstrophy-epispadias complex (BEEC) presents with a variable expression involving the infraumbilical abdominal wall, including the symphysis pubis, lower urinary tract, and external genitalia.[1] In view of its profound impact on continence and sexual function, BEEC represents one of the most severe urological birth defects.The etiology of BEEC remains unknown though an estimated risk of recurrence, which is higher than the general population, points to a strong genetic predisposition.[2]Periconceptional folate supplementation has been shown to reduce the risk of several isolated midline defects, for example, neural tube defects (NTDs), cleft lip and palate (CLP), and omphalocele.[3] There is considerable evidence that the impact of periconceptional folate intake on pregnancy outcome is modified by variants in both maternal and fetal genes coding for critical enzymes in the folate pathway.[4] Among these enzymes, special attention has been drawn to the 5,10-methyltetrahydrofolate reductase (MTHFR) enzyme.Previous studies have suggested association for the homozygous MTHFR 677TT genotype and the occurrence of nonsyndromic cases with NTDs, CLP, and omphalocele.[5] Insofar only few molecular genetic studies investigating genetic factors in the development of BEEC have been carried out[6] but none looking into the association of MTHFR polymorphism and BEEC.We aimed to establish a correlation between MTHFR gene 677 polymorphism and BEEC.
MATERIALS AND METHODS
This was a prospective case-control study done over a period of 24 months in a tertiary care pediatric surgery center. BEEC being a rare entity with an incidence of 1 in 1,17,000 in males and 1 in 4,00,000 in females,[7] the endeavor was to recruit as many patients as possible. From January 2000 to December 2010 we operated on 75 patients of BEEC. We included all the 50 children who were either on regular follow-up in our Pediatric Urology outpatient department (OPD) (31 patients) or who responded to our postal correspondence (19 patients) requesting them to review in the OPD. As control group for the genetic study we included 50 healthy school children appropriately age- and sex-matched.Ethical permission was obtained from the hospital ethical committee. Written informed consent was taken from both parents and children. Three milliliters intravenous blood was collected from all study subjects after informed consent in ethylenediaminetetraacetic acid-anticoagulated vacutainer. Genomic DNA was extracted from these samples following the manual of genomic DNA isolation kit from blood (bioserve). Polymerase chain reaction (PCR) amplification of exon four of MTHFR gene was performed in a programmable thermal cycler for C677T mutation analysis in two batches. Chr1: 11778792-11778989 (198base pair)TGAAGGAGAAGGTGTCTGCGGGAGC/T CGATTTCATCATCACGCAGCTTTTCTTTGAGG CTGACACATTCTTCCGCTTTGTGAAGGCA TGCACCGACATGGGCATCACTTGCCCCATCGTCCC CGGGATCTTTCCCATCCAGGTGAGGGGCCCAG GAGAGCCCATAAGCTCCCTCCACC CCACTCTCACC GCACCGTCCTThe sequences of the forward and reverse primers were:MTHFR FP: 4F: 5′ - TGAAGGAGAAGGTGTCTGCGGGA-3′ MTHFR RP: 4R: 5′ - AGGACGGTGCGGTGAGA-3′ respectivelyThe PCR reactions were carried out in a total volume of 10 μL. It contained 4.2 μL of milli Q water, 1.0 μL of 10X PCR buffer, 0.8 μL of MgCl2 (25 mM), 1 μL each of forward (10 picomole/μL) and reverse primer (10 picomole/μL), 0.8 μL deoxynucleotide mix (mix 2.5 each), 1.0 μL of genomic DNA (80 ng/μL), and 0.2 μL Taq DNA polymerase (fermentas). The mixture was subjected to amplification with initial denaturation at 94°C for 5 min, followed by 35 cycles of denaturation at 94°C for 30 s, annealing at 63°C for 30 sec, and extension at 72°C for 1 min where the extension step in thirty-fifth cycle was for 7 min. The amplified 198 base pair fragment was visualized by gel electrophoresis in 2% agarose gel with 100 base pair ladder. The amplified fragment was then digested with Hinf I at 37°C for 3 h. The digested products were visualized after separation by gel electrophoresis in 3% agarose gel with 100 base pair ladder. The digested products if the heterozygous mutation of C677T of MTHFR gene was present were of 176 bp and 22 bp size [Figure 1] and if the homozygous mutation was present were of 96 bp and 51 bp size. The primary outcome of this study was to study the genetic correlation and the secondary outcome that we studied was the epidemiological profile of BEEC patients for which the parents of BEEC patients, were requested to fill the questionnaire provided [Table 1]. Statistical analysis was done using Fisher exact two-tailed test.
Figure 1
Three percentage agarose gel after restriction digestion — Heterozygous mutation in lane 10
Table 1
Birth Defect Questionnaire
Three percentage agarose gel after restriction digestion — Heterozygous mutation in lane 10Birth Defect Questionnaire
RESULTS
Fifty bladder exstrophy (BE) patients were included out of which 44 were males and six females (M:F: 7.3:1). There were 42 classical BE, two cloacal exstrophies (CE), four epispadias (Epi), and two exstrophy variant (Var). The median age at the time of the study was 9.5 years (range 4-15). The median maternal age at the time of childbirth was 25.5 years (range 23-32) and the median paternal age was 28 years (range 24-29). The control population consisted of 42 males and eight females (M:F: 5.2:1). The median age of the controls was 10 years (range 5-11).Ten (20%) patients of BE had C677T polymorphism of the MTHFR gene out of which there were six patients (15%) with BE, one each of Epi and Var group, and both patients with CE (100%). Amongst the controls, four children (8%) had C677TMTHFR polymorphism while 46 (92%) were homozygous normal. Using two-tailed Fisher exact test to compare the test group and control group, the difference between the CE group and the controls was found to be statistically significant (P = 0.01). There was no statistical difference between the other individual subtypes of BEEC and the control group [Table 3].
Table 3
MTHFR polymorphism in BEEC and Controls
Six (12%) patients in the BEEC group had associated anomalies, out of which cardiac anomalies were predominated. Cardiac anomalies (two atrial septal defects [ASD], one ventricular septal defect [VSD]) were seen in three patients (50%) and cleft palate, Down's syndrome and hypothyroidism in one each. None of the mothers gave a history of periconceptional folic acid. Postconceptional folic acid consumption was present in only 20 (40%) mothers. History of folic acid consumption was absent in both the Var cases. Twenty-six mothers (52%) had undergone antenatal ultrasound (USG) examination, however, antenatal diagnosis of BE was present in only four cases (8%) and all were cases of BE [Table 2].
Table 2
Miscellaneous distribution
Miscellaneous distributionMTHFR polymorphism in BEEC and ControlsHistory of prior miscarriages was seen in 7 (14%) mothers. Family history of BE was seen in 2 (4%) patients and both were first cousins. Three (6%) mothers were on regular medications, one was on antihypertensives, one was on antiepileptics, and one was on antidiabetics [Table 2]. Seven (14%) mothers had a history of oral contraceptive usage and 6 (12%) had a history of intrauterine contraceptive device inserted. The remaining 37 (74%) had no history of any contraception. Two couples (4%) had conceived through in utero insemination while the remaining had conceived naturally.
DISCUSSION
Although several epidemiological reports have been published, the exact etiology of BE remains unknown. What is known, however, is that BE predominates in males ranging from 1.5:1 to 6:1.[7] The male-female ratio in our series was 7.3:1. Boyadjiev et al. noted increased parental age to be a risk factor for BE when they compared the parental age of BE patients with the parental age of specific birth defects based on the US national registry.[7] However, in our study, the median maternal age was 25.5 and the median paternal age was 28, showing no predilection for increased parental age.The genetic basis of BEEC has always fascinated researchers who started by studying cases of familial BEEC. In 1994, Messelink et al. after reviewing four cases of BEEC in two families[8] suggested that the underlying cause of BEEC is a multifactorial mode of inheritance caused by genetic susceptibility and environmental factors. Nye et al.[9] reported on a large Filipino-American family with progressive matrilineal hearing loss disorders, myelocystocele, Arnold-Chiari type I malformation, and CE. This was associated with the A1555G mutation in the 12S rRNA gene (MTRNR1) in affected individuals as well as unaffected maternal relatives.However, only a few BEEC patients show distinctive cytogenetic features such as numeric or structural chromosomal abnormalities. Reutter et al.,[10] reviewing seven fresh cases of isolated familial BEEC, found X-chromosomal aneuploidy in three of those cases suggesting a genetic locus or loci for CE on chromosome X. The observation of a patient with classical exstrophy of the bladder carrying a balanced 46, XY, t(2;9)(q13;q32) translocation,[11] represented a case of chromosomal rearrangements involving chromosome 9.Almost all studies on the relation between MTHFR variants and congenital anomalies have focused on NTDs. In an initial report from the Netherlands,[5] homozygosity for the C677T allele was associated with an approximately threefold increased risk of being affected with spina bifida or having an affected child.BEEC being a midline defect like NTDs; investigators have tried to find a link between the complex interaction of BEEC, periconceptional folic acid, and MTHFR polymorphism.To confirm the association, Reutter et al., investigated the MTHFR 677CT polymorphism for association with the occurrence of the isolated nonsyndromic BEEC.[12] They found no significant deviation from random transmission to children with the BEEC. Furthermore, the investigation of subgroups revealed no biased transmission of the MTHFR alleles to either EC or other forms of BEEC.In the Indian population, the incidence of MTHFR heterozygosity varies from 9% to 17% and homozygosity varies from 0% to 4%.[13] In our study, the incidence of heterozygosity in BEEC patients was 20% and 8% amongst controls. This is the first case-control study to compare the incidence of MTHFR polymorphism between BEEC patients and normal controls. The incidence of C677TMTHFR polymorphism was 15% in BE, 25% in Epi, 50% in Var, and 100% in CE group. The difference between CE and the controls was statistically significant (P = 0.01). There was no significant statistical difference between the other groups of BEEC and the controls; BE (P = 0.50), Epi (P = 0.33), and Var (P = 0.18).Although the familial occurrence is rare, 30 reported multiplex families support the idea of genetic susceptibility underlying BEEC.[14] In most of these families, two members are affected. In rare families, the inheritance of BEEC may be consistent with autosomal dominant inheritance with reduced penetrance or with an autosomal recessive trait or X-linked transmission.[10] The two patients in our series, who reported a history of BE in their cousins have been planned for further genetic studies to ascertain the significance and the mode of inheritance.Cardiac anomalies were the commonest associated anomalies in one of the largest epidemiological surveys conducted of BE patients (5 out of 438 patients).[15] In our study, there were a total of six associated anomalies. Majority were cardiac in the form of ASD in two and VSD in one. There was one case each of CLP, Down's syndrome, and hypothyroidism. However, none of the patients with associated anomalies had a heterozygous mutation of the MTHFR gene.With the availability of high-resolution USG, antenatal diagnosis of BEEC can be made from the 15th week of gestation.[16] Nonvisualization of the fetal bladder should always alert the possible diagnosis of BEEC and other relevant supportive signs should be sought. In spite of the technological advances, the incidence of antenatal diagnosis of BE continues to remain low. Only 15% of children in our study had an antenatal diagnosis of BE.Seven mothers in our study had a history of previous abortions. None of the large population-based studies on families of BEEC,[715] have shown any relationship between parity or previous abortions on the incidence of BEEC. It is still unclear whether in vitro fertilization (IVF) increases the risk of BE. In a large cohort of BE patients[12] it was noticed that 3.6% (8 out of 217 patients) were born by assisted reproductive techniques (IVF or intracytoplasmic sperm injection [ICSI]). There were no IVF or ICSI conceptions in our study group.
CONCLUSION
The etiology of BE is mutifactorial with no clear evident risk factor. No case-control study has ever been performed looking into relation between MTHFR gene polymorphism and BEEC. We found that there appears to be a strong association of MTHFR gene polymorphism in the severe variety of BEEC. BEEC being such a rare entity, further case-control multicentric studies with larger numbers would help us arrive at a clearer conclusion regarding the association of MTHFR gene polymorphism and BE.
Authors: Heiko Reutter; Tim Becker; Michael Ludwig; Niklas Schäfer; Birte Detlefsen; Sylvie Beaudoin; Margit Fisch; Anne-Karoline Ebert; Wolfgang Rösch; Markus M Nöthen; Thomas M Boemers; Regina C Betz Journal: Am J Med Genet A Date: 2006-11-15 Impact factor: 2.802
Authors: Seerat Sachdeva; Kallur N Saraswathy; Mahima Gulabani; Shweta Kaushik; M P Sachdeva; Manju Puri; S L Malik Journal: Biochem Genet Date: 2012-08-05 Impact factor: 1.890
Authors: Heiko Reutter; Simeon A Boyadjiev; Lisa Gambhir; Anne-Karoline Ebert; Wolfgang H Rösch; Raimund Stein; Annette Schröder; Thomas M Boemers; Enrika Bartels; Hannes Vogt; Boris Utsch; Martin Müller; Birte Detlefsen; Nadine Zwink; Sebastian Rogenhofer; Rita Gobet; Goedele M A Beckers; Arend Bökenkamp; Abdol-Mohammad Kajbafzadeh; Enrique Jaureguizar; Markus Draaken; Yegappan Lakshmanan; John P Gearhart; Michael Ludwig; Markus M Nöthen; Ekkehart Jenetzky Journal: J Pediatr Date: 2011-06-16 Impact factor: 4.406