| Literature DB >> 26858551 |
Sajad Majeed Zargar1, Sufia Farhat1, Reetika Mahajan1, Ayushi Bhakhri1, Arjun Sharma1.
Abstract
Increase in food production viz-a-viz quality of food is important to feed the growing human population to attain food as well as nutritional security. The availability of diverse germplasm of any crop is an important genetic resource to mine the genes that may assist in attaining food as well as nutritional security. Here we used 15 RAPD and 23 SSR markers to elucidate diversity among 51 common bean genotypes mostly landraces collected from the Himalayan region of Jammu and Kashmir, India. We observed that both the markers are highly polymorphic. The discriminatory power of these markers was determined using various parameters like; percent polymorphism, PIC, resolving power and marker index. 15 RAPDs produced 171 polymorphic bands, while 23 SSRs produced 268 polymorphic bands. SSRs showed a higher PIC value (0.300) compared to RAPDs (0.243). Further the resolving power of SSRs was 5.241 compared to 3.86 for RAPDs. However, RAPDs showed a higher marker index (2.69) compared to SSRs (1.279) that may be attributed to their higher multiplex ratio. The dendrograms generated with hierarchical UPGMA cluster analysis grouped genotypes into two main clusters with various degrees of sub clustering within the cluster. Here we observed that both the marker systems showed comparable accuracy in grouping genotypes of common bean according to their area of cultivation. The model based STRUCTURE analysis using 15 RAPD and 23 SSR markers identified a population with 3 sub-populations which corresponds to distance based groupings. High level of genetic diversity was observed within the population. These findings have further implications in common bean breeding as well as conservation programs.Entities:
Keywords: Common bean; Dendrogram; MI, marker index; PAGE, polyacrylamide gel electrophoresis; PCA; PCA, principle component analysis; PIC, polymorphic information content; Population structure; QTL, quantitative trait loci; RAPD; RAPD, random amplified polymorphic DNA; RFLP, restriction fragment length polymorphism; Rp, resolving power; SSR; SSR, simple sequence repeat; UPGMA, unweighted pair group method with arithmetic averages
Year: 2014 PMID: 26858551 PMCID: PMC4705283 DOI: 10.1016/j.sjbs.2014.11.011
Source DB: PubMed Journal: Saudi J Biol Sci ISSN: 1319-562X Impact factor: 4.219
Details of RAPD primers with various parameters revealing the discriminatory power of each primer.
| S.No. | Primer | Sequence | NB | NPB | NMB | NUB | PPB | PIC | MI | Rp |
|---|---|---|---|---|---|---|---|---|---|---|
| 1 | OPA-02 | TGC CGA GCT G | 12 | 12 | 0 | 02 | 100 | 0.22 | 2.64 | 3.93 |
| 2 | OPA-03 | AGT CAG CCA C | 12 | 12 | 0 | 03 | 100 | 0.24 | 2.88 | 4.08 |
| 3 | OPA-05 | AGG GGT CTT G | 17 | 17 | 0 | 00 | 100 | 0.21 | 3.57 | 4.44 |
| 4 | OPA-07 | GAA ACGGGTG | 11 | 11 | 0 | 02 | 100 | 0.19 | 2.09 | 3.36 |
| 5 | OPA-09 | GGG TAA CGC C | 14 | 14 | 0 | 02 | 100 | 0.24 | 3.36 | 4.92 |
| 6 | OPA-10 | GTG ATC GCA G | 12 | 12 | 0 | 02 | 100 | 0.27 | 3.24 | 4.56 |
| 7 | OPA-11 | CAA TCG CCG T | 14 | 14 | 0 | 04 | 100 | 0.17 | 2.38 | 3.28 |
| 8 | OPB-10 | CTG CTG GGA C | 07 | 07 | 0 | 00 | 100 | 0.32 | 2.24 | 3.24 |
| 9 | OPC-02 | GTG AGG CGT C | 09 | 09 | 0 | 00 | 100 | 0.23 | 2.07 | 2.96 |
| 10 | OPC-08 | TGG ACC GGT G | 10 | 10 | 0 | 00 | 100 | 0.22 | 2.2 | 2.88 |
| 11 | OPD-07 | TTG GCA CGG G | 10 | 10 | 0 | 03 | 100 | 0.24 | 2.24 | 3.30 |
| 12 | OPD-18 | GAG AGC CAA C | 10 | 10 | 0 | 02 | 100 | 0.30 | 3.00 | 4.86 |
| 13 | OPE-01 | CCC AAG GTC C | 15 | 15 | 0 | 05 | 100 | 0.22 | 3.3 | 4.96 |
| 14 | OPE-02 | GGT GCG GGA A | 08 | 08 | 0 | 01 | 100 | 0.28 | 2.24 | 2.80 |
| 15 | OPE-03 | CCA GAT GCA C | 10 | 10 | 0 | 01 | 100 | 0.30 | 3.00 | 4.36 |
| Average | 11.4 | 11.4 | 00 | 1.8 | 100 | 0.243 | 2.69 | 3.86 |
NB: number of bands, NPB: number of polymorphic bands, NMB: number of monomorphic bands, NUB: number of unique bands, PPB: percentage of polymorphic bands, PIC: polymorphism information content, MI: marker index, Rp: resolving power.
Details of SSR primers with various parameters revealing the discriminatory power of each primer.
| S.No. | Primer | Sequence | Chromosome number | NB | NPB | NMB | NUB | PPB | PIC | MI | Rp |
|---|---|---|---|---|---|---|---|---|---|---|---|
| 1 | Pvm097 | F CAAGAGTGAAGGGGCAGTTT | 1 | 09 | 09 | 00 | 00 | 100 | 0.27 | 0.656 | 3.44 |
| 2 | BM156 | F CTTGTTCCACCTCCCATCATAGC | 2 | 11 | 11 | 00 | 00 | 100 | 0.434 | 2.604 | 7.696 |
| 3 | X59469 | F AAACACACAAAAAGTTGGACGCAC | 2 | 04 | 04 | 00 | 02 | 100 | 0.023 | 0.038 | 0.61 |
| 4 | U77935 | F CGTTAGATCCCGCCCAATAGT | 2 | 12 | 12 | 00 | 00 | 100 | 0.339 | 1.374 | 5.885 |
| 5 | BM159 | F GGTGCTGTTGCTGCTGTTAT | 3 | 21 | 21 | 00 | 00 | 100 | 0.407 | 4.963 | 13.5 |
| 6 | X96999 | F AGTCGCCATAGTTGAAATTTAGGTG | 3 | 09 | 09 | 00 | 00 | 100 | 0.34 | 0.752 | 4.253 |
| 7 | X57022 | F AAGGATGGGTTCCGTGCTTG | 4 | 27 | 27 | 00 | 00 | 100 | 0.324 | 2.414 | 8.75 |
| 8 | X04660 | F TTGATGACGTGGATGCATTGC | 4 | 07 | 07 | 00 | 0 | 100 | 0.400 | 1.590 | 4.67 |
| 9 | BM155 | F GTTCATGTTTGTTTGACAGTTCA | 5 | 13 | 12 | 01 | 00 | 92.3 | 0.272 | 1.249 | 4.96 |
| 10 | X74919 | F CCGTTGCCTGTATTTCCCCAT | 5 | 14 | 14 | 00 | 0 | 100 | 0.414 | 2.011 | 9.29 |
| 11 | BM158 | F CCGAGCACCGTAACTGAATGC | 6 | 18 | 18 | 00 | 01 | 100 | 0.239 | 0.824 | 5.86 |
| 12 | X61293 | F AATCTGCCGAGAGTGGTCCTGCC | 6 | 16 | 16 | 00 | 2 | 100 | 0.181 | 0.695 | 3.76 |
| 13 | PVBR93 | F TGGGGTGAGAGAGAAAGGTG | 7 | 10 | 10 | 00 | 00 | 100 | 0.29 | 0.904 | 3.96 |
| 14 | BM150 | F CGAACTATTTGATACTCATGTGC | 7 | 8 | 8 | 00 | 0 | 100 | 0.283 | 0.776 | 3.125 |
| 15 | PVBR185 | F TGGTAAAGCAAAAACGATGG | 8 | 07 | 07 | 00 | 01 | 100 | 0.23 | 0.245 | 2.44 |
| 16 | BM151 | F CACAACAAGAAAGACCTCCT | 8 | 8 | 8 | 00 | 0 | 100 | 0.403 | 1.769 | 5.134 |
| 17 | PvBR213 | F ACAATGTAGACAGCGCAGCA | 9 | 8 | 8 | 00 | 4 | 100 | 0.152 | 0.252 | 1.577 |
| 18 | X80051 | F GTTAAATTATACGAGGTTAGCCTAAATC | 9 | 9 | 9 | 00 | 0 | 100 | 0.324 | 0.323 | 3.927 |
| 19 | BM154 | F TCTTGCGACCGAGCTTCTCC | 9 | 09 | 09 | 00 | 00 | 100 | 0.447 | 1.937 | 6.501 |
| 20 | BM157 | F ACTTAACAAGGAATAGCCACACA | 10 | 20 | 20 | 00 | 05 | 100 | 0.217 | 0.442 | 6 |
| 21 | BMb152 | F ACGCAGAGAAATCTCCAATA | 10 | 13 | 13 | 00 | 0 | 100 | 0.483 | 2.423 | 10.823 |
| 22 | BMb654 | F CGCATCGATCAAAGATAGTC | 11 | 06 | 06 | 00 | 00 | 100 | 0.279 | 0.689 | 2.65 |
| 23 | M75856 | F GGGAGGGTAGGGAAGCAGTG | 11 | 9 | 9 | 00 | 2 | 100 | 0.163 | 0.501 | 1.732 |
| Average | 11.65 | 11.65 | 0.04 | 0.73 | 99.6 | 0.300 | 1.279 | 5.241 |
NB: number of bands, NPB: number of polymorphic bands, NMB: number of monomorphic bands, NUB: number of unique bands, PPB: percentage of polymorphic bands, PIC: polymorphism information content, MI: marker index, Rp: resolving power.
Levels of polymorphism and comparison of the discriminating power of RAPD and SSR markers.
| Indexes with their abbreviations | Marker systems | ||
|---|---|---|---|
| RAPD | SSR | ||
| Number of assay units | U | 15 | 23 |
| Number of polymorphic bands | np | 171 | 268 |
| Number of monomorphic bands | nnp | 0 | 1 |
| Average number of polymorphic bands/assay unit | np/U | 11.4 | 11.65 |
| Number of loci | L | 171 | 23 |
| Number of loci/assay unit | nu | 11.4 | 1 |
| Average number of alleles per locus | nav | 2 | 11.65 |
| Fraction of polymorphic loci | β | 1 | 0.99 |
| Effective multiplex ratio | E | 11.4 | 0.99 |
| Marker index | MI | 2.69 | 1.279 |
| Expected heterozygosity | He | 0.0878 | 0.147 |
Figure 1(A) Cluster tree derived by SHAHN method based on 15 RAPD markers among 51 genotypes of common bean, (B) Cluster tree derived by SHAHN method based on 23 SSR markers among 51 genotypes of common bean, (C) Cluster tree derived by SHAHN method based on 15 RAPD and 23 SSR markers among 51 genotypes of common bean.
Figure 2PCA analysis based results of 51 common bean genotypes using 15 RAPD and 23 SSR primers.
Figure 3Graphical representation of population structure. Each common bean genotype is shown by a vertical line representing membership of subgroup 1 (blue), subgroup 2 (green), and subgroup 3 (red). Genotypes are arranged as per estimated membership coefficients (q) in K = 3 clusters.
Assignment of individuals to the sub populations (K) based on probability.
| Code | Genotype | K-1 | K-2 | K-3 | Assignment to sub-populations |
|---|---|---|---|---|---|
| 1 | P1 | 0.967 | 0.016 | 0.017 | 1 |
| 2 | P2 | 0.896 | 0.034 | 0.070 | 1 |
| 3 | P3 | 0.975 | 0.003 | 0.022 | 1 |
| 4 | P4 | 0.950 | 0.046 | 0.005 | 1 |
| 5 | P5 | 0.999 | 0.001 | 0.000 | 1 |
| 6 | P6 | 0.971 | 0.024 | 0.005 | 1 |
| 7 | P7 | 0.999 | 0.000 | 0.001 | 1 |
| 8 | P8 | 0.998 | 0.001 | 0.001 | 1 |
| 9 | P9 | 0.997 | 0.001 | 0.002 | 1 |
| 10 | P10 | 0.999 | 0.001 | 0.000 | 1 |
| 11 | P11 | 0.998 | 0.001 | 0.001 | 1 |
| 12 | P12 | 0.985 | 0.006 | 0.009 | 1 |
| 13 | P13 | 0.998 | 0.001 | 0.001 | 1 |
| 14 | P14 | 0.909 | 0.083 | 0.008 | 1 |
| 15 | P15 | 0.990 | 0.009 | 0.001 | 1 |
| 16 | P16 | 0.893 | 0.104 | 0.003 | 1 |
| 17 | P17 | 0.997 | 0.002 | 0.001 | 1 |
| 18 | P18 | 0.998 | 0.002 | 0.001 | 1 |
| 19 | P19 | 0.970 | 0.015 | 0.015 | 1 |
| 20 | R1 | 0.577 | 0.413 | 0.010 | ADMIXTURE |
| 21 | R2 | 0.587 | 0.412 | 0.001 | ADMIXTURE |
| 22 | R3 | 0.497 | 0.501 | 0.002 | ADMIXTURE |
| 23 | R4 | 0.389 | 0.608 | 0.003 | ADMIXTURE |
| 24 | R5 | 0.091 | 0.891 | 0.018 | 2 |
| 25 | R6 | 0.004 | 0.995 | 0.001 | 2 |
| 26 | R7 | 0.001 | 0.998 | 0.001 | 2 |
| 27 | R8 | 0.001 | 0.998 | 0.001 | 2 |
| 28 | R9 | 0.002 | 0.998 | 0.001 | 2 |
| 29 | R10 | 0.198 | 0.472 | 0.330 | ADMIXTURE |
| 30 | KS1 | 0.003 | 0.997 | 0.001 | 2 |
| 31 | KS2 | 0.001 | 0.996 | 0.003 | 2 |
| 32 | KS3 | 0.007 | 0.990 | 0.003 | 2 |
| 33 | KS4 | 0.002 | 0.997 | 0.001 | 2 |
| 34 | KS5 | 0.018 | 0.981 | 0.001 | 2 |
| 35 | KS6 | 0.002 | 0.996 | 0.001 | 2 |
| 36 | KS7 | 0.003 | 0.995 | 0.002 | 2 |
| 37 | KS8 | 0.007 | 0.731 | 0.262 | ADMIXTURE |
| 38 | KS9 | 0.003 | 0.965 | 0.032 | 2 |
| 39 | KS10 | 0.002 | 0.447 | 0.551 | ADMIXTURE |
| 40 | KS11 | 0.010 | 0.190 | 0.800 | 3 |
| 41 | K12 | 0.013 | 0.149 | 0.838 | 3 |
| 42 | K13 | 0.001 | 0.010 | 0.989 | 3 |
| 43 | K14 | 0.001 | 0.031 | 0.968 | 3 |
| 44 | K15 | 0.002 | 0.114 | 0.884 | 3 |
| 45 | K16 | 0.003 | 0.013 | 0.984 | 3 |
| 46 | K17 | 0.148 | 0.008 | 0.844 | 3 |
| 47 | K18 | 0.002 | 0.003 | 0.995 | 3 |
| 48 | K19 | 0.122 | 0.003 | 0.875 | 3 |
| 49 | K20 | 0.003 | 0.001 | 0.996 | 3 |
| 50 | B1 | 0.003 | 0.001 | 0.996 | 3 |
| 51 | B2 | 0.001 | 0.001 | 0.998 | 3 |
Heterozygosity and Fst value calculated for 3 common bean sub-populations.
| Sub-population ( | Expected heterozygosity | Fst value |
|---|---|---|
| 1 | 0.2192 | 0.4047 |
| 2 | 0.2124 | 0.3799 |
| 3 | 0.2821 | 0.2059 |
| Average | 0.2379 | 0.3301 |
Genetic differentiation based on Fst values between three common bean sub-populations identified by population structure analysis.
| Pop A | Pop B | Pop C | |
|---|---|---|---|
| Pop A | – | 0.0969 | 0.1028 |
| Pop B | 0.0969 | – | 0.0737 |
| Pop C | 0.1028 | 0.0737 | – |