Literature DB >> 26858551

Unraveling the efficiency of RAPD and SSR markers in diversity analysis and population structure estimation in common bean.

Sajad Majeed Zargar1, Sufia Farhat1, Reetika Mahajan1, Ayushi Bhakhri1, Arjun Sharma1.   

Abstract

Increase in food production viz-a-viz quality of food is important to feed the growing human population to attain food as well as nutritional security. The availability of diverse germplasm of any crop is an important genetic resource to mine the genes that may assist in attaining food as well as nutritional security. Here we used 15 RAPD and 23 SSR markers to elucidate diversity among 51 common bean genotypes mostly landraces collected from the Himalayan region of Jammu and Kashmir, India. We observed that both the markers are highly polymorphic. The discriminatory power of these markers was determined using various parameters like; percent polymorphism, PIC, resolving power and marker index. 15 RAPDs produced 171 polymorphic bands, while 23 SSRs produced 268 polymorphic bands. SSRs showed a higher PIC value (0.300) compared to RAPDs (0.243). Further the resolving power of SSRs was 5.241 compared to 3.86 for RAPDs. However, RAPDs showed a higher marker index (2.69) compared to SSRs (1.279) that may be attributed to their higher multiplex ratio. The dendrograms generated with hierarchical UPGMA cluster analysis grouped genotypes into two main clusters with various degrees of sub clustering within the cluster. Here we observed that both the marker systems showed comparable accuracy in grouping genotypes of common bean according to their area of cultivation. The model based STRUCTURE analysis using 15 RAPD and 23 SSR markers identified a population with 3 sub-populations which corresponds to distance based groupings. High level of genetic diversity was observed within the population. These findings have further implications in common bean breeding as well as conservation programs.

Entities:  

Keywords:  Common bean; Dendrogram; MI, marker index; PAGE, polyacrylamide gel electrophoresis; PCA; PCA, principle component analysis; PIC, polymorphic information content; Population structure; QTL, quantitative trait loci; RAPD; RAPD, random amplified polymorphic DNA; RFLP, restriction fragment length polymorphism; Rp, resolving power; SSR; SSR, simple sequence repeat; UPGMA, unweighted pair group method with arithmetic averages

Year:  2014        PMID: 26858551      PMCID: PMC4705283          DOI: 10.1016/j.sjbs.2014.11.011

Source DB:  PubMed          Journal:  Saudi J Biol Sci        ISSN: 1319-562X            Impact factor:   4.219


Introduction

For direct human consumption, common bean (Phaseolus vulgaris L.) is the most important legume in the developing world (Broughton et al., 2003). Beans are an inseparable part of the food for millions around the globe, representing a major chunk of dietary protein (Biswas et al., 2010). Beans are also a rich source of essential vitamins and minerals, soluble fiber, starch and phytochemicals, and are also reported to have low fat content (Nyombaire et al., 2007, Svetleva et al., 2006, Beebe et al., 2000). In many regions/countries it provides about 15% of total daily calories and greater than 30% of daily protein intake. Being such an important part of the diet around the world, common bean as a crop is subjected to various improvement programs (Hanai et al., 2010). Edible parts and growing habits of the common bean show a high degree of genetic variation (Biswas et al., 2010). Different molecular markers have been used to study genetic diversity among common bean. RFLP was used in constructing first molecular linkage map of common bean (Adam-Blondon et al., 1994, Nodari et al., 1993; Vallejos et al., 1992). The high density linkage map of common bean was developed using various other markers, mainly RAPD (Freyre et al., 1998), SSR’s or microsatellite (Yu et al., 2000, Blair et al., 2003). SSR markers have also been used to evaluate intra-specific diversity within the genus of Phaseolus (Gaitan-solis ewwwwt al., 2002). Among all the markers, SSR’s have been deployed for population structure studies from time to time in various cereals e.g.: rice (Zhang et al., 2009), maize (Liu et al., 2003), wheat (Liu et al., 2010, Zoric et al., 2012) as well as legume crops. Race structure analysis was done in cultivated Andean and Mesoamerican beans (Díaz and Blair, 2006, Blair et al., 2007). Further, the inferences about population structure of 349 common bean genotypes which includes both cultivated and wild accessions using 26 microsatellite marker was done (Kwak and Gepts, 2009). An effective breeding program essentially requires a good knowledge of the extent and nature of genetic diversity within the crop species. The availability of genetically diverse landraces of a crop is an important genetic resource that can be used for the improvement of that crop. The evaluation of population structure and genetic diversity of germplasm could also provide valuable information for association mapping, allele mining for novel traits and crop breeding. In the present study we employed two different markers i.e. RAPD and SSR to evaluate the efficiency of these markers in diversity analysis of common bean collected from foot hills of the Himalayan region of Jammu and Kashmir, India. Moreover, we have considered various parameters to elucidate genetic diversity and population structure among these genotypes as detailed in results and discussion.

Materials and methods

Genotypes

Fifty-one genotypes of common bean collected from various unexploited regions of Jammu and Kashmir, India (Zargar et al., 2014), were used in this study.

DNA extraction

Doyle and Doyle (1987), method with little modifications was followed for extraction of genomic DNA from young leaf tissue of common bean genotypes. The DNA quantity as well as quality was checked by Nanodrop (mySPEC, Wilmington, USA). Isolated high quality DNA was diluted to concentration of 25 ng/μL for further use.

Molecular analysis

RAPD genotyping

15 RAPD primers synthesized at IDT (Integrated DNA Technologies, Coralville, Iowa, USA) were used for studying polymorphism among 51 common bean genotypes. 25 μL reaction mixture containing 3 μL of template DNA (25 ng/μL), 1X PCR Buffer, 2 mM MgCl2, 0.2 mM of each dNTPs (dTTPs, dGTPs, dCTPs, dATPs), 20 pico molar primer concentration, 1 U Taq DNA polymerase (Taq polymerase from Thermus acquaticus, Sigma Aldrich, USA) was amplified in a 96 well Universal Gradient Thermal Cycler (PEQLAB, Deutschland and Osterrtich, United kingdom). Products were separated on a normal agarose gel along with standard molecular weight marker (100 bp ladder) (Sigma Aldrich, USA). The gel was visually examined under UV and documented using gel documentation system (MiniLumi, Sigma-Svi Bio Solutions Pvt. Ltd. New Delhi, India). The list of RAPD primers used is detailed in Table 1.
Table 1

Details of RAPD primers with various parameters revealing the discriminatory power of each primer.

S.No.PrimerSequence5′→3′NBNPBNMBNUBPPBPIC2fi (1-fi)MIRp
1OPA-02TGC CGA GCT G12120021000.222.643.93
2OPA-03AGT CAG CCA C12120031000.242.884.08
3OPA-05AGG GGT CTT G17170001000.213.574.44
4OPA-07GAA ACGGGTG11110021000.192.093.36
5OPA-09GGG TAA CGC C14140021000.243.364.92
6OPA-10GTG ATC GCA G12120021000.273.244.56
7OPA-11CAA TCG CCG T14140041000.172.383.28
8OPB-10CTG CTG GGA C07070001000.322.243.24
9OPC-02GTG AGG CGT C09090001000.232.072.96
10OPC-08TGG ACC GGT G10100001000.222.22.88
11OPD-07TTG GCA CGG G10100031000.242.243.30
12OPD-18GAG AGC CAA C10100021000.303.004.86
13OPE-01CCC AAG GTC C15150051000.223.34.96
14OPE-02GGT GCG GGA A08080011000.282.242.80
15OPE-03CCA GAT GCA C10100011000.303.004.36
Average11.411.4001.81000.2432.693.86

NB: number of bands, NPB: number of polymorphic bands, NMB: number of monomorphic bands, NUB: number of unique bands, PPB: percentage of polymorphic bands, PIC: polymorphism information content, MI: marker index, Rp: resolving power.

SSR genotyping

23 SSR selected from Yu et al., 2000, Gaitan-Solis et al., 2002, Grisi et al., 2007, Hanai et al., 2010, Córdoba et al., 2010, were used for studying polymorphism among common bean genotypes. Details of SSRs are given in Table 2. DNA concentration of primers was adjusted to 25 ng/μL. PCR amplification was carried out in 96 well Universal Gradient Thermal Cycler (PEQLAB, Deutschland and Osterrtich, United Kingdom) in a 25 μL reaction mixture. The reaction mixture contained 5 μM of each forward and reverse primers, 1 U of Taq polymerase (D1806- Sigma Aldrich, USA), 5 μL of 10X PCR buffer with MgCl2, 2.5 mM of each dNTP (dTTPs, dGTPs, dCTPs, dATPs). Amplifications were performed as follows: Initial denaturation of 1 min at 94 °C, followed by 35 cycles of 94 °C 1 min, 50–55 °C 1.30 min, 72 °C 2 min, and a final extension of 10 min at 72 °C. PCR products were mixed with loading dye (3–4 μL). The amplified products of some primers were resolved on 2.5% metaphor agarose gel and those which could not give clear polymorphic pattern on metaphor agarose were further tested on 8% denaturing PAGE. PCR products resolved on metaphor agarose gel were visually examined under UV and documented using gel documentation system (MiniLumi, Sigma-Svi Bio Solutions Pvt. Ltd. New Delhi, India). However, the PCR products that had resolved on PAGE at constant power (120 W) in 1 X TBE running buffer for 3–4 h were visualized by silver-staining method as described by Bassam et al. (1991). Gels were visually scored and scanned for records. The clear and reproducible alleles amplified by each SSR among 51 genotypes were scored according to their fragment size (bp) corresponding to the 50 bp molecular weight marker (Sigma Aldrich, USA).
Table 2

Details of SSR primers with various parameters revealing the discriminatory power of each primer.

S.No.PrimerSequence5′→3′Chromosome numberNBNPBNMBNUBPPBPIC2fi (1-fi)MIRp
1Pvm097F CAAGAGTGAAGGGGCAGTTTR CGGCCAACCACTACTTTTAG1090900001000.270.6563.44
2BM156F CTTGTTCCACCTCCCATCATAGCR TGCTTGCATCTCAGCCAGAATC2111100001000.4342.6047.696
3X59469F AAACACACAAAAAGTTGGACGCACR TTCGTGAGGTAGGAGTTTGGTGG2040400021000.0230.0380.61
4U77935F CGTTAGATCCCGCCCAATAGTR CCGTCCAGGAAGAGCGAGC2121200001000.3391.3745.885
5BM159F GGTGCTGTTGCTGCTGTTATRGGGAGATGTGGTAAGATAATGAAA3212100001000.4074.96313.5
6X96999F AGTCGCCATAGTTGAAATTTAGGTGR TATTAAAACGTGAGCATATGTATCATTC3090900001000.340.7524.253
7X57022F AAGGATGGGTTCCGTGCTTGR AAGGATGGGTTCCGTGCTTG4272700001000.3242.4148.75
8X04660F TTGATGACGTGGATGCATTGCR AAAGGGCTAGGGAGAGTAAGTTGG407070001000.4001.5904.67
9BM155F GTTCATGTTTGTTTGACAGTTCAR CAGAAGTTAGTGTTGGTTTGATACA51312010092.30.2721.2494.96
10X74919F CCGTTGCCTGTATTTCCCCATR CGTGTGAAGTCATCTGGAGTGGTC514140001000.4142.0119.29
11BM158F CCGAGCACCGTAACTGAATGCR CGCTCGCTTACTCACTGTACGC6181800011000.2390.8245.86
12X61293F AATCTGCCGAGAGTGGTCCTGCCR GATTGAAATATCAAAGAGAATTGTTAC616160021000.1810.6953.76
13PVBR93F TGGGGTGAGAGAGAAAGGTGR TACCATAGCAGGCGTTGTTG7101000001000.290.9043.96
14BM150F CGAACTATTTGATACTCATGTGCR TTGCAGGACAGATAAGTTAGAAGA7880001000.2830.7763.125
15PVBR185F TGGTAAAGCAAAAACGATGGR GACAGAAGAGTGAGGGTGTGAA8070700011000.230.2452.44
16BM151F CACAACAAGAAAGACCTCCTR TTATGTATTAGACCACATTACTTCC8880001000.4031.7695.134
17PvBR213F ACAATGTAGACAGCGCAGCAR GCTCTTTCTCCTCCCATCCT9880041000.1520.2521.577
18X80051F GTTAAATTATACGAGGTTAGCCTAAATCR CATTCCCTTCACACATTCACCG9990001000.3240.3233.927
19BM154F TCTTGCGACCGAGCTTCTCCR CTGAATCTGAGGAACGATGACCAG9090900001000.4471.9376.501
20BM157F ACTTAACAAGGAATAGCCACACAR GTTAATTGTTTCCAATATCAACCTG10202000051000.2170.4426
21BMb152F ACGCAGAGAAATCTCCAATAR CCTTCCATGATTTGTTGTTT1013130001000.4832.42310.823
22BMb654F CGCATCGATCAAAGATAGTCR CTCTTTCCCAACAAATGAAG11060600001000.2790.6892.65
23M75856F GGGAGGGTAGGGAAGCAGTGR GCGAACCACGTTCATGAATGA11990021000.1630.5011.732
Average11.6511.650.040.7399.60.3001.2795.241

NB: number of bands, NPB: number of polymorphic bands, NMB: number of monomorphic bands, NUB: number of unique bands, PPB: percentage of polymorphic bands, PIC: polymorphism information content, MI: marker index, Rp: resolving power.

Data analysis

The profile developed by each marker was scored (1) for the presence and (0) for the absence of a band for each genotype. In order to compare the efficiency of these two marker systems in genotype identification, differentiation and diversity analysis, we considered the following parameters for each assay unit (U). Number of polymorphic bands (np); Number of monomorphic bands (nnp); Average number of polymorphic bands per unit assay (np/U); Number of loci (L): number of loci in case of RAPD is equal to the total number of bands (np + nnp) obtained; Number of loci per assay unit: nu = L/U; Fraction of polymorphic loci (β) according to Powell et al. (1996): β = np/np + nnp; Effective multiplex ratio (E) according to Powell et al. (1996): E = nuβ; Polymorphic information content (PIC) according to Powell et al. (1996): PIC = 2fi (1-fi); Marker index (MI) according to Powell et al. (1996): MI = PIC × β × α; Resolving power (RP) according to Prevost and Wilkinson (1999): RP = ΣIb Scored data were used for the estimation of Jaccard’s similarity coefficient using NTSYS-pc version 2.02e (Rohlf, 1998) package to compute pair-wise Jaccard’s similarity coefficient (Jaccard, 1908) and this similarity matrix was used in cluster analysis using the unweighted pair-group method with arithmetic averages (UPGMA) and sequential, agglomerative, hierarchical and nested (SAHN) clustering algorithm to obtain dendrogram. Model based cluster analysis was performed to infer genetic structure and to define the number of clusters in the data set using the software STRUCTURE version 2.3.4 (Pritchard et al., 2000). The number of presumed populations (K) was set from 1 to 10, and the analysis was repeated 2 times. For each run the burn-in and MCMC were set to 50,000 each and iterations were set to 5. The run with maximum likelihood was used to assign individual genotypes into groups. Within a group, genotypes with inferred ancestry based on probability values ⩾80% were assigned to a different group, and those with <80% were treated as “admixture”, i.e., these genotypes seem to have a mixed ancestry from parents belonging to different geographical origins or gene pools. The expected heterozygosity (gene diversity) and population differentiation (Fst) between individuals in a sub-population was also worked out using STRUCTURE programme.

Results and discussion

Allele diversity in the common bean using two different marker systems

Both the marker techniques (RAPD and SSR) proved to be highly effective in discriminating the 51 genotypes. Results obtained are summarized in Table 1, Table 2, Table 3. 15 RAPD and 23 SSR primers used in the present study amplified 171 and 268 polymorphic bands for RAPD and SSR respectively. An average number of 11.40 polymorphic bands per assay unit were identified for RAPD, whereas in SSR it was 11.65 (Table 3). The utility of a given marker is a balance between the level of polymorphism it can detect, and its capacity to identify multiple polymorphisms (Powell et al., 1996). Marker index is a feature of a marker which elucidates the discriminatory power of a marker and therefore it was calculated for all the markers. Due to high multiplex ratio component (11.4) for RAPD, higher marker index value was observed for RAPD (2.69) in comparison to SSR (1.279) (Table 3). Maras et al. (2008) observed a higher multiplex ratio for AFLP (11.20) than for SSR (1.00) in 29 common bean accessions. In another study a higher multiplex ratio of 5.19 for RAPD was observed as compared to SSRs (1.00) in 32 olive cultivars (Belaj et al., 2002). For RAPD markers only two alleles per locus are considered, however for SSR an average of 11.65 alleles per locus, ranging from 4 (X59469) to 27 (X57022) was observed. The average number of alleles per locus for SSR’s observed in the present study is higher than earlier studies carried out by Maras et al. (2008), where they found an average of 7.14 alleles per locus for 14 SSR loci scored for 29 common bean accessions. Since a higher number of genotypes as well as SSR primers were used in this study and that can be the reason for higher number of alleles per locus observed in case of SSR’s. PIC is an important feature of a primer which indicates its potential to differentiate various individuals. An average PIC of 0.243 was observed for RAPD where as it was 0.300 for SSR markers (Table 1, Table 2). Highest PIC was observed for primers OPD-18 and OPE-03 (0.300) in RAPD assay (Table 1) while the highest PIC was observed for primer BM154 (0.447) in SSR assay (Table 2). Ahmed et al. (2012) also observed a higher PIC value in SSR (0.39) than in RAPD (0.250) in genetic diversity estimation of 82 walnut cultivars. Further resolving power/discriminatory power of a marker, which indicates the discriminatory potential of the primer to distinguish the genotypes or individuals, was estimated for each primer. An average resolving power of 3.86 was observed for RAPD whereas for SSR it was 5.241. Highest resolving power of 4.96 was observed for primer OPE-01 among RAPD markers while as highest resolving power of 13.5 was observed for primer BM159 among the SSR markers. Higher resolving power for SSR markers can also be attributed to the fact that SSR markers were resolved on low melting agarose (metaphor) and PAGE, both of which have higher resolving capacity than normal agarose.
Table 3

Levels of polymorphism and comparison of the discriminating power of RAPD and SSR markers.

Indexes with their abbreviationsMarker systems
RAPDSSR
Number of assay unitsU1523
Number of polymorphic bandsnp171268
Number of monomorphic bandsnnp01
Average number of polymorphic bands/assay unitnp/U11.411.65
Number of lociL17123
Number of loci/assay unitnu11.41
Average number of alleles per locusnav211.65
Fraction of polymorphic lociβ10.99
Effective multiplex ratioE11.40.99
Marker indexMI2.691.279
Expected heterozygosityHe0.08780.147

Genetic relationship among common bean genotypes

Both the marker systems showed a high degree of similarity in the topology of their respective dendrograms. Although some differences in positioning of some genotypes was observed. However, all the dendrograms reflected similar pattern of relationship among most of the genotypes, depending upon the area of their cultivation (Fig. 1A-C).
Figure 1

(A) Cluster tree derived by SHAHN method based on 15 RAPD markers among 51 genotypes of common bean, (B) Cluster tree derived by SHAHN method based on 23 SSR markers among 51 genotypes of common bean, (C) Cluster tree derived by SHAHN method based on 15 RAPD and 23 SSR markers among 51 genotypes of common bean.

In order to find out the genetic relationship among the common bean genotypes, analysis was done separately as well as in combination for RAPD and SSR data sets. The Jaccard’s similarity coefficient for RAPD based diversity analysis ranged from 0.20 to 0.91 (Fig. 1A), whereas for SSR it ranged from 0.29 to 0.74 (Fig. 1B). Further, the Jaccard’s similarity coefficient ranged from 0.25 to 0.79 for the combined RAPD and SSR based data sets (Fig. 1C). The dendrogram generated from RAPD data grouped genotypes in two main clusters as represented in Fig. 1A, in which K-19 was totally distinguished from remaining other genotypes that had grouped together. The similarity coefficients of the common bean genotypes based on 15 RAPD ranged from to 0.185 to 0.905. Among the 51 pair-wise combinations of genotypes, K-13 and K-14 showed the highest similarity index (0.905), while the genotypes P1 and K19 showed the lowest (0.185). As such RAPD markers generated a mean similarity index of 0.545 among 51 diverse common bean genotypes. The dendrogram obtained with SSR markers as represented in Fig. 1B, also divided the genotypes into two main clusters. Cluster-I represented only two genotypes (K-17 and K-19) whereas rest of the genotypes were grouped in the Cluster-II. Cluster-II further divided the genotypes into two sub clusters. Most of the genotypes from Poonch, along with a few genotypes collected from Rajouri were grouped together. Whereas most of the genotypes collected from Kashmir along with some from Rajouri gathered together. Certainly the genotypes from Rajouri and Bhaderwah formed separate sub-clusters within these groups. SSR based similarity coefficient of the common bean genotypes ranged from 0.260 to 0.738. Of the 51 pair wise combinations of genotypes, P-17 and P-18 showed the highest similarity index (0.738), while the genotypes P1 and K19 showed the lowest similarity index (0.260). The dendrogram generated from the combined RAPD and SSR based data sets exhibited a pattern almost similar to that obtained from the SSR data as represented in Fig. 1C. In this dendrogram K-17 and K-19 clustered together as observed in case of SSR based dendrogram. Here the similarity coefficients among 51 genotypes ranged from 0.232 to 0.788. Among all the pair-wise combinations, P-17 and P-18 showed the highest similarity index (0.788), while the genotypes P1 and K19 showed the lowest similarity index (0.232). In all the three data sets P-1 and K-19 were farthest from one another and as such they showed lowest similarity coefficient values as revealed in Fig. 1A-C. Principal component analysis (PCA) of 51 common bean genotypes using 15 RAPD and 23 SSR markers revealed similar results as observed by UPGMA based clustering (Fig. 2). Belaj et al. (2002) got similar results regarding the dendrogram topologies in diversity studies of 32 olive cultivars using RAPD, AFLP and SSR markers. Combination of the data sets of RAPD, AFLP and SSR revealed a better representation of the relationship for most of the olive cultivars as represented in the dendrogram, according to the geographic area of diffusion.
Figure 2

PCA analysis based results of 51 common bean genotypes using 15 RAPD and 23 SSR primers.

Population structure and relationship among 51 genotypes

Further STRUCTURE analysis was carried out to observe the number of populations that may be generated from 51 genotypes using 15 RAPD and 23 SSR markers. Here we acquired three populations with slight mixing of genotypes as represented in Fig. 3 and Table 4. Since the locations of collection (Rajouri, Poonch and Kashmir) are connected to each other, as such this may be a reason of having admixture among 3 distinguished populations. Moreover, population structure analysis confirmed the grouping of the genotypes, as observed by PCA and UPGMA clustering analyses. The STRUCTURE simulations were carried out by varying K from 1 to 10 with 10 run for each K using all 51 genotypes. In this analysis, the two populations initially separated at K = 2 and then further subgroups were formed at K = 3. The admixtures obtained in three distinguished populations are an indication of sub grouping of genotypes as evident from UPGMA based analysis. The sub grouping can be owed to geographic structuring or adaptation in different seasons. This confirms the classification of 51 common bean genotypes into three distinct population groups with high resolution population structure. Using this approach, 51 accessions were assigned to the corresponding A-C sub-populations, representing 37.25% (19), 25.49% (13) and 21.56% (11) of the total germplasm analyzed. Of the 51 genotypes, only 13.7% (7) showed admixtures (membership probability <0.8, Table 4). Similar results were observed by Sharma and coworkers while analyzing genetic diversity of two Indian common bean germplasm collections based on morphological and microsatellite markers (Sharma et al., 2013). A total of 149 genotypes were evaluated using 24 microsatellites and initial separation of the gene pools was observed at K = 2 and the further sub-groups were formed at K = 3, which indicated some level of sub-grouping in each gene pool and they also found it to be in tone with UPGMA analysis. The expected heterozygosity which measures the probability that two randomly chosen individual will be different (heterozygous) at a given locus ranged from 0.219 in the first sub-population to 0.282 in the third sub-population with an average of 0.2379 (Table 5). Similarly population differentiation measurements (Fst) which is the summary of genetic differentiation among groups, and on the basis of which two different clusters or populations corresponding closely are assigned to different populations ranged from 0.2059 (in the 3rd sub-population) to 0.4047 (in the 1st sub-population) with an average of 0.3301 (Table 5, Table 6), which is relatively high confirming the separation of all the sub-populations and their diversity in RAPD and SSR alleles. Blair et al. (2012), analyzed 108 common bean genotypes using 36 fluorescently labeled SSRs and they also observed a high Fst value (0.203) for genetic differentiation between all the five populations. Yet in our study we have obtained a higher Fst value and it may be due to the use of different types of markers in our study.
Figure 3

Graphical representation of population structure. Each common bean genotype is shown by a vertical line representing membership of subgroup 1 (blue), subgroup 2 (green), and subgroup 3 (red). Genotypes are arranged as per estimated membership coefficients (q) in K = 3 clusters.

Table 4

Assignment of individuals to the sub populations (K) based on probability.

CodeGenotypeK-1K-2K-3Assignment to sub-populations
1P10.9670.0160.0171
2P20.8960.0340.0701
3P30.9750.0030.0221
4P40.9500.0460.0051
5P50.9990.0010.0001
6P60.9710.0240.0051
7P70.9990.0000.0011
8P80.9980.0010.0011
9P90.9970.0010.0021
10P100.9990.0010.0001
11P110.9980.0010.0011
12P120.9850.0060.0091
13P130.9980.0010.0011
14P140.9090.0830.0081
15P150.9900.0090.0011
16P160.8930.1040.0031
17P170.9970.0020.0011
18P180.9980.0020.0011
19P190.9700.0150.0151
20R10.5770.4130.010ADMIXTURE
21R20.5870.4120.001ADMIXTURE
22R30.4970.5010.002ADMIXTURE
23R40.3890.6080.003ADMIXTURE
24R50.0910.8910.0182
25R60.0040.9950.0012
26R70.0010.9980.0012
27R80.0010.9980.0012
28R90.0020.9980.0012
29R100.1980.4720.330ADMIXTURE
30KS10.0030.9970.0012
31KS20.0010.9960.0032
32KS30.0070.9900.0032
33KS40.0020.9970.0012
34KS50.0180.9810.0012
35KS60.0020.9960.0012
36KS70.0030.9950.0022
37KS80.0070.7310.262ADMIXTURE
38KS90.0030.9650.0322
39KS100.0020.4470.551ADMIXTURE
40KS110.0100.1900.8003
41K120.0130.1490.8383
42K130.0010.0100.9893
43K140.0010.0310.9683
44K150.0020.1140.8843
45K160.0030.0130.9843
46K170.1480.0080.8443
47K180.0020.0030.9953
48K190.1220.0030.8753
49K200.0030.0010.9963
50B10.0030.0010.9963
51B20.0010.0010.9983
Table 5

Heterozygosity and Fst value calculated for 3 common bean sub-populations.

Sub-population (K)Expected heterozygosityFst value
10.21920.4047
20.21240.3799
30.28210.2059
Average0.23790.3301
Table 6

Genetic differentiation based on Fst values between three common bean sub-populations identified by population structure analysis.

Pop APop BPop C
Pop A0.09690.1028
Pop B0.09690.0737
Pop C0.10280.0737

Conclusion

Both RAPD and SSR marker techniques have provided useful information regarding the level of polymorphism in common bean. Thus they have a higher utility in characterizing the common bean genotypes. RAPD based analysis have the limitation of reliability and transferability (Jones et al., 1997). But if a standard protocol is followed the reliability of RAPD data can become high. Both the marker systems have comparable accuracy in grouping genotypes according to their origin of cultivation. And this has a high significance with respect to the management of germplasm from different geographic locations (Singh et al., 1991). However, it is worth to note here that SSRs proved to be better by showing higher values for most of the parameters that determine the potential of markers in diversity analysis. Further, the information obtained from the population structure analysis will be useful in carrying out association mapping in common bean for various traits. All the observations made in this study will provide valuable evidence for decision making in choosing of markers for future work, characterization of germplasm, breeding and common bean germplasm management.

Conflict of interest

Authors have no conflict of interest.

Submission declaration

The work described has neither been published nor is under consideration for publication in any other journal, and if accepted, it will not be published anywhere in this form or any other form.

Contribution of authors

SF, RM, AB and AS have contributed equally in conducting the experiment. SMZ has designed the experiment and prepared the manuscript along with SF. SMZ and SF did data analysis.
  19 in total

1.  Inference of population structure using multilocus genotype data.

Authors:  J K Pritchard; M Stephens; P Donnelly
Journal:  Genetics       Date:  2000-06       Impact factor: 4.562

2.  Genetic structure and diversity among maize inbred lines as inferred from DNA microsatellites.

Authors:  Kejun Liu; Major Goodman; Spencer Muse; J Stephen Smith; Ed Buckler; John Doebley
Journal:  Genetics       Date:  2003-12       Impact factor: 4.562

3.  Development of a genome-wide anchored microsatellite map for common bean (Phaseolus vulgaris L.).

Authors:  M W Blair; F Pedraza; H F Buendia; E Gaitán-Solís; S E Beebe; P Gepts; J Tohme
Journal:  Theor Appl Genet       Date:  2003-09-20       Impact factor: 5.699

4.  Genetic mapping of a new set of microsatellite markers in a reference common bean (Phaseolus vulgaris) population BAT93 x Jalo EEP558.

Authors:  M C M Grisi; M W Blair; P Gepts; C Brondani; P A A Pereira; R P V Brondani
Journal:  Genet Mol Res       Date:  2007-09-30

5.  Population structure in a wheat core collection and genomic loci associated with yield under contrasting environments.

Authors:  Miroslav Zorić; Dejan Dodig; Borislav Kobiljski; Steve Quarrie; Jeremy Barnes
Journal:  Genetica       Date:  2012-09-12       Impact factor: 1.082

6.  SSR and RAPD analysis of genetic diversity in walnut (Juglans regia L.) genotypes from Jammu and Kashmir, India.

Authors:  Nazeer Ahmed; J I Mir; Reyazul Rouf Mir; Nazir Ahmad Rather; Rizwan Rashid; Shabir H Wani; Wajida Shafi; Hidayatullah Mir; M A Sheikh
Journal:  Physiol Mol Biol Plants       Date:  2012-04-05

7.  Genetic diversity and relationships in olive ( Olea europaea L.) germplasm collections as determined by randomly amplified polymorphic DNA.

Authors:  A. Belaj; Z. Satovic; L. Rallo; I. Trujillo
Journal:  Theor Appl Genet       Date:  2002-06-19       Impact factor: 5.699

8.  Genetic structure and differentiation of Oryza sativa L. in China revealed by microsatellites.

Authors:  Dongling Zhang; Hongliang Zhang; Meixing Wang; Junli Sun; Yongwen Qi; Fengmei Wang; Xinghua Wei; Longzhi Han; Xiangkun Wang; Zichao Li
Journal:  Theor Appl Genet       Date:  2009-08-01       Impact factor: 5.699

9.  Diversification and population structure in common beans (Phaseolus vulgaris L.).

Authors:  Matthew W Blair; Alvaro Soler; Andrés J Cortés
Journal:  PLoS One       Date:  2012-11-07       Impact factor: 3.240

10.  Integration of physical and genetic maps of common bean through BAC-derived microsatellite markers.

Authors:  Juana M Córdoba; Carolina Chavarro; Jessica A Schlueter; Scott A Jackson; Matthew W Blair
Journal:  BMC Genomics       Date:  2010-07-16       Impact factor: 3.969

View more
  9 in total

1.  Genetic diversity among mulberry genotypes from seven countries.

Authors:  Zhenjiang Wang; Yufei Zhang; Fanwei Dai; Guoqing Luo; Gengsheng Xiao; Cuiming Tang
Journal:  Physiol Mol Biol Plants       Date:  2017-03-24

2.  The efficiency of Cytochrome P450 gene-based markers in accessing genetic variability of drumstick (Moringa oleifera Lam.) accessions.

Authors:  R S Drisya Ravi; E A Siril; Bindu R Nair
Journal:  Mol Biol Rep       Date:  2020-03-31       Impact factor: 2.316

3.  Allelic Diversity, Structural Analysis, and Genome-Wide Association Study (GWAS) for Yield and Related Traits Using Unexplored Common Bean (Phaseolus vulgaris L.) Germplasm From Western Himalayas.

Authors:  Reyazul Rouf Mir; Neeraj Choudhary; Vanya Bawa; Sofora Jan; Bikram Singh; Mohd Ashraf Bhat; Rajneesh Paliwal; Ajay Kumar; Annapurna Chitikineni; Mahendar Thudi; Rajeev Kumar Varshney
Journal:  Front Genet       Date:  2021-01-28       Impact factor: 4.599

4.  Identification of QTLs/ Candidate Genes for Seed Mineral Contents in Common Bean (Phaseolus vulgaris L.) Through Genotyping-by-Sequencing.

Authors:  Muslima Nazir; Reetika Mahajan; Sheikh Mansoor; Sheezan Rasool; Rakeeb Ahmad Mir; Ravinder Singh; Vandana Thakral; Virender Kumar; Parvaze A Sofi; Hamed A El-Serehy; Daniel Ingo Hefft; Sajad Majeed Zargar
Journal:  Front Genet       Date:  2022-03-14       Impact factor: 4.599

5.  Morphological and molecular characterization of some pumpkin (Cucurbita pepo L.) genotypes collected from Erzincan province of Turkey.

Authors:  Halil İbrahim Öztürk; Veysel Dönderalp; Hüseyin Bulut; Recep Korkut
Journal:  Sci Rep       Date:  2022-04-26       Impact factor: 4.996

6.  iPBS-Retrotransposon Markers in the Analysis of Genetic Diversity among Common Bean (Phaseolus vulgaris L.) Germplasm from Türkiye.

Authors:  Kamil Haliloğlu; Aras Türkoğlu; Halil Ibrahim Öztürk; Güller Özkan; Erdal Elkoca; Peter Poczai
Journal:  Genes (Basel)       Date:  2022-06-25       Impact factor: 4.141

7.  Determining Genetic Diversity and Population Structure of Common Bean (Phaseolus vulgaris L.) Landraces from Türkiye Using SSR Markers.

Authors:  Güller Özkan; Kamil Haliloğlu; Aras Türkoğlu; Halil Ibrahim Özturk; Erdal Elkoca; Peter Poczai
Journal:  Genes (Basel)       Date:  2022-08-08       Impact factor: 4.141

8.  Comparative assessment of genetic diversity in Sesamum indicum L. using RAPD and SSR markers.

Authors:  Aejaz Ahmad Dar; Sushma Mudigunda; Pramod Kumar Mittal; Neelakantan Arumugam
Journal:  3 Biotech       Date:  2017-04-08       Impact factor: 2.893

9.  A Case Study in Saudi Arabia: Biodiversity of Maize Seed-Borne Pathogenic Fungi in Relation to Biochemical, Physiological, and Molecular Characteristics.

Authors:  Abdulaziz A Al-Askar; Khalid M Ghoneem; Elsayed E Hafez; WesamEldin I A Saber
Journal:  Plants (Basel)       Date:  2022-03-21
  9 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.