Literature DB >> 26840893

Correction: Body Size Adaptations to Altitudinal Climatic Variation in Neotropical Grasshoppers of the Genus Sphenarium (Orthoptera: Pyrgomorphidae).

.   

Abstract

Entities:  

Year:  2016        PMID: 26840893      PMCID: PMC4739697          DOI: 10.1371/journal.pone.0148329

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


× No keyword cloud information.
Table 1 appears incorrectly in the published article. Please see the corrected Table 1 below.
Table 1

List of amplified loci indicating their approximate size (bp), annealing temperature (Tm) and the pairs of primers used for the PCR reactions.

LociSize (bp)Tm (°C)Primer ASequence (5'-3')
F1360050ORMET [48]CATAAGCTAATGGGTTCATAC
ORRLYS [48]GAGACCAGTACTTGCTTTCAGTCATC
F2210050OR16SN BAGAAACCGACCTGGCTCACGC CGG
OR12SN BCGTGCCAGCAGCCGCGGTTATACG
CO1118058SPHCO1F CTAGATCATCAATGGTTAATACAGG
SPHCO1R CCTGATATGAGTGTTCTGCAGGAGG
CO255058C2J3138 [49]GGAGCTTCACCATTAATAGAACA
C2N3661 [49]CCACAAATTTCTGAACATTGACCA
12S36058SRJ14233 [49]AAGAGCGACGGGCGATGTGT
SRN14588 [49]AAACTAGGATTAGATACCCTATTAT
H332960HexAF [50]ATGGCTCGTACCAAGCAGACGGC
HexAR [50]ATATCCTTGGGCATGATGGTGAC
ITS232060CAS5p8sFc [51]TGAACATCGACATTTYGAACGCACAT
CAS28sB1d [51]TTCTTTTCCTCCSCTTAYTRATATGCTTAA

A source of primers is indicated within brackets and superscript letters.

B designed by H. Song

C designed by S. Sanabria-Urbán

A source of primers is indicated within brackets and superscript letters. B designed by H. Song C designed by S. Sanabria-Urbán The legend of Fig 1 is incomplete in the published article. Please see Fig 1 and its complete legend below.
Fig 1

Phylogeny based on a concatenated Bayesian analysis of the total genetic evidence retrieved from 67 Sphenarium and 15 outgroup taxa.

Tip labels indicate current taxonomic classification, voucher numbers and locality ID for all included terminals, except for those whose genetic information was retrieved from GenBank (*). Black vertical bars indicate the phylogenetic position of the identified species based on our integrative taxonomy approach (names and coloured symbols in front of the black bars). Particularly, the black vertical bars indicating the phylogenetic position of S. purpurascens, S. variabile, S. macrophallicum, S. sp. nov. 7, S. mexicanum, S. magnum and S. histrio represent cases where species differentiation was primarily morphological and they did not separate in individual monophyletic groups (See methods and results sections for details). The numbers positioned closely to the nodes indicate posterior probability values. G1, Monophyletic Group 1; G2, Monophyletic Group 2; G3, Monophyletic Group 3. S. p. purpurascens (1) intermediate form between S. p. purpurascens and S. p. minimum. S. m. mexicanum (2) intermediate form between S. m. mexicanum and S. m. histrio.

Phylogeny based on a concatenated Bayesian analysis of the total genetic evidence retrieved from 67 Sphenarium and 15 outgroup taxa.

Tip labels indicate current taxonomic classification, voucher numbers and locality ID for all included terminals, except for those whose genetic information was retrieved from GenBank (*). Black vertical bars indicate the phylogenetic position of the identified species based on our integrative taxonomy approach (names and coloured symbols in front of the black bars). Particularly, the black vertical bars indicating the phylogenetic position of S. purpurascens, S. variabile, S. macrophallicum, S. sp. nov. 7, S. mexicanum, S. magnum and S. histrio represent cases where species differentiation was primarily morphological and they did not separate in individual monophyletic groups (See methods and results sections for details). The numbers positioned closely to the nodes indicate posterior probability values. G1, Monophyletic Group 1; G2, Monophyletic Group 2; G3, Monophyletic Group 3. S. p. purpurascens (1) intermediate form between S. p. purpurascens and S. p. minimum. S. m. mexicanum (2) intermediate form between S. m. mexicanum and S. m. histrio. The fourth paragraph of the Methods section under the subheading “Phylogenetic reconstruction” is erroneously included in the published article, and should be omitted.
  1 in total

1.  Body Size Adaptations to Altitudinal Climatic Variation in Neotropical Grasshoppers of the Genus Sphenarium (Orthoptera: Pyrgomorphidae).

Authors:  Salomón Sanabria-Urbán; Hojun Song; Ken Oyama; Antonio González-Rodríguez; Martin A Serrano-Meneses; Raúl Cueva Del Castillo
Journal:  PLoS One       Date:  2015-12-18       Impact factor: 3.240

  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.