Literature DB >> 26839489

Isolation of Middle East Respiratory Syndrome Coronavirus from a Patient of the 2015 Korean Outbreak.

Wan Beom Park1, Nak-Jung Kwon2, Pyoeng Gyun Choe3, Su-Jin Choi4, Hong Sang Oh3, Sang Min Lee3, Hyonyong Chong2, Jong-Il Kim5, Kyoung-Ho Song3, Ji Hwan Bang3, Eu Suk Kim3, Hong-Bin Kim3, Sang Won Park3, Nam Joong Kim1, Myoung-Don Oh1.   

Abstract

During the 2015 outbreak of Middle East respiratory syndrome coronavirus (MERS-CoV) in Korea, 186 persons were infected, resulting in 38 fatalities. We isolated MERS-CoV from the oropharyngeal sample obtained from a patient of the outbreak. Cytopathic effects showing detachment and rounding of cells were observed in Vero cell cultures 3 days after inoculation of the sample. Spherical virus particles were observed by transmission electron microscopy. Full-length genome sequence of the virus isolate was obtained and phylogenetic analyses showed that it clustered with clade B of MERS-CoV.

Entities:  

Keywords:  Korea; Microscopy, Electron; Middle East Respiratory Syndrome; Middle East Respiratory Syndrome Coronavirus; Phylogeny

Mesh:

Substances:

Year:  2016        PMID: 26839489      PMCID: PMC4729515          DOI: 10.3346/jkms.2016.31.2.315

Source DB:  PubMed          Journal:  J Korean Med Sci        ISSN: 1011-8934            Impact factor:   2.153


Middle East respiratory syndrome coronavirus (MERS-CoV) is a betacoronavirus causing a severe acute respiratory infection (1,2). It was first isolated from the sputum of a patient with severe pneumonia in Saudi Arabia in 2012 (3). Since then, 26 countries have reported 1,618 laboratory-confirmed cases of infection with MERS-CoV to the World Health Organization (WHO), including 579 fatalities (4). The Korean outbreak of MERS-CoV was initiated in May 2015 by a business man returning from the Middle East (5). The transmission of MERS-CoV continued until early July, resulting in 186 cases with 38 deaths. One of the most important characteristics of the Korean outbreak was 4 large clusters of cases due to superspreading event at hospitals, accounting for > 80% of the total cases. Another characteristic was that many cases of second- and third-generation of transmission occurred (5,6). This finding is quite contrast to the previous studies suggesting limited person-to-person transmissibility of MERS-CoV (7,8). To better understand transmissibility and assess epidemic risk, characterization of MERS-CoV of the Korean outbreak would be of paramount importance (9). Here, we report the MERS-CoV isolated from a patient of the Korean outbreak. A 39-year-old healthcare worker was admitted to the hospital because of fever and cough. On May 27, 2015, he was unknowingly exposed to the index case (designated as patient number 14 by Korea Ministry of Health and Welfare) of the hospital outbreak of Middle East respiratory syndrome coronavirus (MERS-CoV) at emergency department of a hospital (10). Two days later, he developed fever and dry cough. On June 2, he was diagnosed with MERS-CoV infection as sputum sample was positive on real-time reverse transcriptase polymerase chain reaction (RT-PCR) assay, and admitted to the isolation unit of the MERS-designated hospital by the government. He had a history of cough variant asthma, but did not take any regular medication, and otherwise healthy. On admission (June 2, 2015), the physical examination revealed a body temperature of 38.8°C, a respiratory rate of 22 breaths per minute, a pulse of 78 per minute, and a blood pressure of 118/71 mmHg. Chest radiography showed patchy consolidation in the upper zone of the left lung. His pneumonia progressed, and on June 8, he developed shortness of breath, his arterial oxygen saturation decreased below 90%, requiring oxygen supplementation, and chest radiography showed multiple consolidations in the both lungs. On June 10, he was intubated and mechanical ventilation was started. His hypoxemia worsened rapidly, and veno-venous extracorporeal membrane oxygenation support was started since June 11. On July 2 (day 35 of his illness), real-time RT-PCR for MERS-CoV turned negative, and was removed from the isolation unit. He recovered gradually. The patient’s oropharyngeal samples were obtained by using UTMTM kit containing 3 mL of viral transport media (Copan Diagnostics Inc., Murrieta, CA). The samples were stored at -70°C until assays. We inoculated monolayers of Vero cells with the samples and cultured the cells at 37°C in a 5% carbon dioxide atmosphere. Cytopathic effects consisting of rounding and detachment of cells were observed 3 days after the inoculation of the sample taken on day 11 of his illness (Fig. 1A and B). The RNA titer in the sample was 5.80 × 107 copies/mL for upE gene and 4.97 × 107 copies/mL for ORF1a gene.
Fig. 1

Cytopathic effects of MERS-CoV in Vero cell cultures and Electron microscopy image of MERS-CoV. Vero cells were inoculated with oropharyngeal swab sample. (A) Vero cell cultures in negative control. (B) Cytopathic effects (rounding and detachment of cells) in Vero cell cultures 3 days after inoculation of the sample. (C, D) Transmission electron microscopy image of Vero cells infected with MERS-CoV. White arrow denotes nuclear membrane. Brown scale bar indicates 100 μm (A and B). Black scale bar indicates 500 nm (C) and white scale bar does 200 nm (D).

In order to observe virus particles, Vero cell monolayer showing the cytopathic effects was fixed as previously described (11). It was cut on ultramicrotome (RMC MT-XL) at 65 nm. Ultrathin sections were stained with saturated 4% uranyl acetate and 4% lead citrate before examination with a transmission electron microscope (JEM-1400; JEOL USA Inc., Peabody, MA, USA) at 60 kV. Spherical particles ranging 77 to 131 nm in diameter were observed within the cytoplasm of infected cells (Fig. 1C and D). For full-length genome sequencing of the virus isolate (MERS-CoV Hu/KOR/SNU1_035/2015), Vero cell monolayer showing cytopathic effects was harvested and used for RNA extraction. RNA was extracted by using QIAamp viral RNA mini kit (QIAGEN, Valencia, CA), according to the manufacturer’s instructions. The RNA was used for cDNA synthesis using SuperScript III Reverse Transcriptase (Invitrogen, MA, USA) by each specific RT primer as described previously (12). Finally, about 2.5 kb PCR products were amplified by each primer pair (Table 1), and the amplicons were sheared by Covaris S2 according to the 200 bp target BP condition (Covaris, MA, USA). To generate the Next Generation Sequencing (NGS) library, the fragments were ligated with adapter and index (barcode) using TruSeq Nano DNA HT Library Prep kit (Illumina, CA, USA), and the library was sequenced by MiSeq (Illumina, CA, USA). The NGS data were aligned to MERS-CoV, NC_019843, used for Binary Sequence Alignment/Map (BAM) file generation, and genome assembly. In order to evaluate genetic relationship between this isolate and Homo sapiens and Camelus dromedaries MERS-CoV sequences reported from other countries, phylogenetic analyses were conducted using the whole genome, the S gene and the OFR1a gene.
Table 1

PCR primer pairs used in this study

No.Forwardsequence (5'-->3')Reversesequence (5'-->3')
1FEP_1_FGATTTAAGTGAATAGCTTGGCTATCTCFCO_TM58_70342_1_RGGAATATTAGAGACTCCCTGCCG
22497FTCCCATCGGGAACCTATTACTGTGFCO_TM58_68466_RTGTAACCACCATTAGTGCGGAC
34477FACGTTAAGTTAAACCCTTCAGAAGFCO_TM58_67825_1_RAATGAAGCCCTAAATAGTAACTTCACT
4new2_15F_6427TGCTTAGATTGCACACCGTTFCO_TM58_68526_RAGGTGGTTAACCGGAAAGCTAAA
6506FAGAATTTGCTACCCGCACTTTCACTGFCO_TM58_68526_RAGGTGGTTAACCGGAAAGCTAAA
5new2_19F_8393GGATGCACTTAAACGACAGAFCO_TM58_33984_RGTGTAACCAACACTACCACAAGAAC
8496FTGGTGCTCCTACATGGTTTAATGCGFCO_TM58_33984_RGTGTAACCAACACTACCACAAGAAC
610477FACACCAAGGAGGGTAGTGTGATCFCO_TM58_67887_RGAATTACAACGCGAAGTTTATTTGAAG
7FCO_TM58_2977_FAAGGCTTTGCAGAAGGCTGTTAFCO_TM58_68115_RGAATTACAACGCGAAGTTTATTTGAAG
12488FAGGTAGTCACATATCCCTCGCTTAACFCO_TM58_68115_RTCATCAACTCCTTAAGAGAGAGCCTAT
814481FTGGATGTTAGTCTCCATAGACATAGFCO_TM58_34102_RTGTAATCACCACTTTCAGTCCAGT
916476FTCGGCTTATACAAGAATATGTGCACFCO_TM58_981_RCATGAGCCCAACAAACAAACGTA
1018490FACGACGTATAGTGCAAATGTTGTCFCO_TM58_69145_RAGCTTTAAATCTATAACAGAACACACC
11new2_42F_20357AAGAAGCAACAGGAAGGTCAFCO_TM58_34878_RTAGAAGGCAGCCCAAGCTTTT
20490FAAGACCTTGGCGTAGTATCCAAGGFCO_TM58_34878_RTAGAAGGCAGCCCAAGCTTTT
12FCO_TM58_67088_1_FCCACCTTGCCTGTTTATGATACTATTAFCO_TM58_72579_RCTGTTTGCATAGCTCCCAGAG
22481FTGATTTGTCACAACTCCACTGCFCO_TM58_72579_RCTGTTTGCATAGCTCCCAGAG
13FCO_TM58_66781_FTGGACTGCTGGCTTATCCTCFCO_TM58_66820_RGCTTAAATCTATGTATGTTAGCACAGT
24512FTCAGAAGGTTCAGGATGCTGTGAACFCO_TM58_66820_RGCTTAAATCTATGTATGTTAGCACAGT
1426470FTGAGTTCGCCTTGCTGCGCAAAACFCO_TM58_69858_RTGTAATTACCTGCCTTATATCTATGGT
15new2_59F_28427GGCAAAGCTACGGAACTAATFEP_3_RGCAAATCATCTAATTAGCCTAATCTAATTG
28490FAACTTGCATTGCTTCGAGCTTAGGFEP_3_RGCAAATCATCTAATTAGCCTAATCTAATTG
The full-length genome sequence (30,119 bp) of the virus isolate was obtained and deposited in the GenBank (accession no. KU308549). The genome sequence of the virus had high level of nucleotide identity (97.80%–99.95%) to those of MERS-CoV reported previously (Fig. 2A). Of note, the closest ones were KOREA/Seoul/035-1-2015 and 035-2-2015 (GenBank accession no. KT374054–5), that were directly sequenced from sputum of the same patient as ours (13). A previous study about S gene of MERS-CoV reported from Korea showed that a culture isolate from patient number 002 contained two nonsynonymous variants (S137R and V530L) (14). These variants were not found in our isolate and there was no difference in amino acids of S protein between our isolate and directly sequenced ones (KT374054-5). This difference can be explained by cell culture-adaptation in that our culture isolate was obtained before passage whereas one with nonsysnonymous variant was from the third passage in Vero cells.
Fig. 2

Molecular phylogenetic analysis. Phylogenetic tree on complete genome (A), S genes (B), and ORF1ab genes (C) for the 101 gene sequences of MERS-CoV. The evolutionary history was inferred by using the maximum likelihood method based on the Tamura-Nei model (16). Evolutionary analyses were conducted in MEGA6 (17). Red box indicates our virus isolate.

Phylogenetic analyses of the whole genome showed that this virus closely clustered with those reported from Korea (GenBank accession nos. KT029139, KT374050– KT374057), China (GenBank accession no. KT006149.2) and Saudi Arabia in 2015 (GenBank accession no. KT026453–6). Phylogenetic analyses based on ORF1ab genes revealed that this virus fell into the group 3, but those based on S genes showed that this virus belongs to the group 5 along with other viruses reported from Korea (Fig. 2B and C). These findings are compatible to a previous study (15). In summary, we isolated MERS-CoV from a patient with severe pneumonia who had been infected during the Korean outbreak in 2015. We also obtained full-length sequence of the virus isolate. Phylogenetic analyses showed that the isolate belongs to clade B of MERS-CoV.
  14 in total

1.  MEGA6: Molecular Evolutionary Genetics Analysis version 6.0.

Authors:  Koichiro Tamura; Glen Stecher; Daniel Peterson; Alan Filipski; Sudhir Kumar
Journal:  Mol Biol Evol       Date:  2013-10-16       Impact factor: 16.240

Review 2.  Middle East respiratory syndrome coronavirus: another zoonotic betacoronavirus causing SARS-like disease.

Authors:  Jasper F W Chan; Susanna K P Lau; Kelvin K W To; Vincent C C Cheng; Patrick C Y Woo; Kwok-Yung Yuen
Journal:  Clin Microbiol Rev       Date:  2015-04       Impact factor: 26.132

3.  Isolation of a novel coronavirus from a man with pneumonia in Saudi Arabia.

Authors:  Ali M Zaki; Sander van Boheemen; Theo M Bestebroer; Albert D M E Osterhaus; Ron A M Fouchier
Journal:  N Engl J Med       Date:  2012-10-17       Impact factor: 91.245

4.  Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees.

Authors:  K Tamura; M Nei
Journal:  Mol Biol Evol       Date:  1993-05       Impact factor: 16.240

5.  Middle East Respiratory Syndrome Coronavirus Outbreak in the Republic of Korea, 2015.

Authors: 
Journal:  Osong Public Health Res Perspect       Date:  2015-09-05

6.  Origin and Possible Genetic Recombination of the Middle East Respiratory Syndrome Coronavirus from the First Imported Case in China: Phylogenetics and Coalescence Analysis.

Authors:  Yanqun Wang; Di Liu; Weifeng Shi; Roujian Lu; Wenling Wang; Yanjie Zhao; Yao Deng; Weimin Zhou; Hongguang Ren; Jun Wu; Yu Wang; Guizhen Wu; George F Gao; Wenjie Tan
Journal:  MBio       Date:  2015-09-08       Impact factor: 7.867

7.  Transmission and evolution of the Middle East respiratory syndrome coronavirus in Saudi Arabia: a descriptive genomic study.

Authors:  Matthew Cotten; Simon J Watson; Paul Kellam; Abdullah A Al-Rabeeah; Hatem Q Makhdoom; Abdullah Assiri; Jaffar A Al-Tawfiq; Rafat F Alhakeem; Hossam Madani; Fahad A AlRabiah; Sami Al Hajjar; Wafa N Al-nassir; Ali Albarrak; Hesham Flemban; Hanan H Balkhy; Sarah Alsubaie; Anne L Palser; Astrid Gall; Rachael Bashford-Rogers; Andrew Rambaut; Alimuddin I Zumla; Ziad A Memish
Journal:  Lancet       Date:  2013-09-20       Impact factor: 79.321

8.  Variations in Spike Glycoprotein Gene of MERS-CoV, South Korea, 2015.

Authors:  Dae-Won Kim; You-Jin Kim; Sung Han Park; Mi-Ran Yun; Jeong-Sun Yang; Hae Ji Kang; Young Woo Han; Han Saem Lee; Heui Man Kim; Hak Kim; A-Reum Kim; Deok Rim Heo; Su Jin Kim; Jun Ho Jeon; Deokbum Park; Joo Ae Kim; Hyang-Min Cheong; Jeong-Gu Nam; Kisoon Kim; Sung Soon Kim
Journal:  Emerg Infect Dis       Date:  2016-01       Impact factor: 6.883

9.  Interhuman transmissibility of Middle East respiratory syndrome coronavirus: estimation of pandemic risk.

Authors:  Romulus Breban; Julien Riou; Arnaud Fontanet
Journal:  Lancet       Date:  2013-07-05       Impact factor: 79.321

10.  Transmission characteristics of MERS and SARS in the healthcare setting: a comparative study.

Authors:  Gerardo Chowell; Fatima Abdirizak; Sunmi Lee; Jonggul Lee; Eunok Jung; Hiroshi Nishiura; Cécile Viboud
Journal:  BMC Med       Date:  2015-09-03       Impact factor: 8.775

View more
  9 in total

1.  Analysis of intrapatient heterogeneity uncovers the microevolution of Middle East respiratory syndrome coronavirus.

Authors:  Donghyun Park; Hee Jae Huh; Yeon Jeong Kim; Dae-Soon Son; Hyo-Jeong Jeon; Eu-Hyun Im; Jong-Won Kim; Nam Yong Lee; Eun-Suk Kang; Cheol In Kang; Doo Ryeon Chung; Jin-Hyun Ahn; Kyong Ran Peck; Sun Shim Choi; Yae-Jean Kim; Chang-Seok Ki; Woong-Yang Park
Journal:  Cold Spring Harb Mol Case Stud       Date:  2016-11

Review 2.  Middle East respiratory syndrome: what we learned from the 2015 outbreak in the Republic of Korea.

Authors:  Myoung-Don Oh; Wan Beom Park; Sang-Won Park; Pyoeng Gyun Choe; Ji Hwan Bang; Kyoung-Ho Song; Eu Suk Kim; Hong Bin Kim; Nam Joong Kim
Journal:  Korean J Intern Med       Date:  2018-02-27       Impact factor: 2.884

3.  The influence of interferon-lambda on restricting Middle East Respiratory Syndrome Coronavirus replication in the respiratory epithelium.

Authors:  Yung Jin Jeon; Chan Hee Gil; Ara Jo; Jina Won; Sujin Kim; Hyun Jik Kim
Journal:  Antiviral Res       Date:  2020-06-19       Impact factor: 5.970

4.  Culture of SARS-CoV-2 in a panel of laboratory cell lines, permissivity, and differences in growth profile.

Authors:  Nathalie Wurtz; Gwilherm Penant; Priscilla Jardot; Nathalie Duclos; Bernard La Scola
Journal:  Eur J Clin Microbiol Infect Dis       Date:  2021-01-02       Impact factor: 5.103

5.  Ultrastructural Characterization of Human Bronchial Epithelial Cells during SARS-CoV-2 Infection: Morphological Comparison of Wild-Type and CFTR-Modified Cells.

Authors:  Flavia Merigo; Virginia Lotti; Paolo Bernardi; Anita Conti; Andrea Di Clemente; Marco Ligozzi; Anna Lagni; Claudio Sorio; Andrea Sbarbati; Davide Gibellini
Journal:  Int J Mol Sci       Date:  2022-08-27       Impact factor: 6.208

Review 6.  In Vitro Models for Studying Entry, Tissue Tropism, and Therapeutic Approaches of Highly Pathogenic Coronaviruses.

Authors:  Saeid Najafi Fard; Linda Petrone; Elisa Petruccioli; Tonino Alonzi; Giulia Matusali; Francesca Colavita; Concetta Castilletti; Maria Rosaria Capobianchi; Delia Goletti
Journal:  Biomed Res Int       Date:  2021-06-21       Impact factor: 3.411

7.  MERS-CoV spillover at the camel-human interface.

Authors:  Gytis Dudas; Luiz Max Carvalho; Andrew Rambaut; Trevor Bedford
Journal:  Elife       Date:  2018-01-16       Impact factor: 8.140

8.  Correlation between Pneumonia Severity and Pulmonary Complications in Middle East Respiratory Syndrome.

Authors:  Wan Beom Park; Kang Il Jun; Gayeon Kim; Jae-Phil Choi; Ji-Young Rhee; Shinhyea Cheon; Chang Hyun Lee; Jun-Sun Park; Yeonjae Kim; Joon-Sung Joh; Bum Sik Chin; Pyeong Gyun Choe; Ji Hwan Bang; Sang-Won Park; Nam Joong Kim; Dong-Gyun Lim; Yeon-Sook Kim; Myoung-Don Oh; Hyoung-Shik Shin
Journal:  J Korean Med Sci       Date:  2018-05-10       Impact factor: 2.153

9.  Virus Isolation from the First Patient with SARS-CoV-2 in Korea.

Authors:  Wan Beom Park; Nak Jung Kwon; Su Jin Choi; Chang Kyung Kang; Pyoeng Gyun Choe; Jin Yong Kim; Jiyoung Yun; Gir Won Lee; Moon Woo Seong; Nam Joong Kim; Jeong Sun Seo; Myoung Don Oh
Journal:  J Korean Med Sci       Date:  2020-02-24       Impact factor: 2.153

  9 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.