Literature DB >> 26834772

Validating DNA Polymorphisms Using KASP Assay in Prairie Cordgrass (Spartina pectinata Link) Populations in the U.S.

Hannah Graves1, A L Rayburn1, Jose L Gonzalez-Hernandez2, Gyoungju Nah3, Do-Soon Kim3, D K Lee1.   

Abstract

Single nucleotide polymorphisms (SNPs) are one of the most abundant DNA variants found in plant genomes and are highly efficient when comparing genome and transcriptome sequences. SNP marker analysis can be used to analyze genetic diversity, create genetic maps, and utilize marker-assisted selection breeding in many crop species. In order to utilize these technologies, one must first identify and validate putative SNPs. In this study, 121 putative SNPs, developed from a nuclear transcriptome of prairie cordgrass (Spartina pectinata Link), were analyzed using KASP technology in order to validate the SNPs. Fifty-nine SNPs were validated using a core collection of 38 natural populations and a phylogenetic tree was created with one main clade. Samples from the same population tended to cluster in the same location on the tree. Polymorphisms were identified within 52.6% of the populations, split evenly between the tetraploid and octoploid cytotypes. Twelve selected SNP markers were used to assess the fidelity of tetraploid crosses of prairie cordgrass and their resulting F2population. These markers were able to distinguish true crosses and selfs. This study provides insight into the genomic structure of prairie cordgrass, but further analysis must be done on other cytotypes to fully understand the structure of this species. This study validates putative SNPs and confirms the potential usefulness of SNP marker technology in future breeding programs of this species.

Entities:  

Keywords:  Prairie cordgrass; SNP; Spartina; marker; polymorphism; transcriptome

Year:  2016        PMID: 26834772      PMCID: PMC4722126          DOI: 10.3389/fpls.2015.01271

Source DB:  PubMed          Journal:  Front Plant Sci        ISSN: 1664-462X            Impact factor:   5.753


Introduction

Prairie cordgrass (Spartina pectinata Link) is a native grass species of the North American Prairie that has a geographic distribution, ranging from the southern U.S. (Texas, Arkansas, and New Mexico) to northern Canada, and from the east coast through the Midwest to the western coast of the U.S. (Hitchcock, 1950; Voight and Mohlenbrock, 1979; Barkworth et al., 2007; Gedye et al., 2010). This species is adapted to a wide range of environmental conditions and, in addition, responds well to abiotic stresses, such as moderate salinity, water logged soils, drought, and cold tolerance (Montemayor et al., 2008; Boe et al., 2009; Gonzalez-Hernandez et al., 2009; Kim et al., 2011; Zilverberg et al., 2014; Anderson et al., 2015). Because of its wide adaptability, this warm season, C4, perennial grass is highly valued for conservation practices, wetland revegetation, streambank stabilization, wildlife habitat, forage production, and recently bioenergy feedstock production (Hitchcock, 1950; Barkworth et al., 2007; Montemayor et al., 2008; Gonzalez-Hernandez et al., 2009; Kim et al., 2011; Boe et al., 2013; Zilverberg et al., 2014; Guo et al., 2015). This ability to adapt to such a wide diversity of conditions results in populations becoming adapted to specific environments, ultimately leading to genetically diverse populations. Adding to the potential genetic diversity of prairie cordgrass is polyploidy. Prairie cordgrass is a polyploid species, composed of three cytotypes: tetraploid (2n = 4x = 40), hexaploid (2n = 6x = 60), and octoploid (2n = 8x = 80) (Church, 1940; Kim et al., 2010, 2012). Because of the reproductive and geographic isolation between the cytotypes, there is likely an increase in polymorphisms and potential genetic diversity, especially within the tetraploid and octoploids cytotypes (Soltis et al., 1992; Wendel and Doyle, 2005; Hirakawa et al., 2014). There is a large amount of phenotypic variation present in all cytotypes of prairie cordgrass (Boe and Lee, 2007; Kim et al., 2012; Guo et al., 2015), but there is a lack of knowledge about the genomic structure. A few studies have revealed diversity within highly polymorphic chloroplast DNA regions observed within and among tetra- and octoploid populations (Kim et al., 2013; Graves et al., 2015). In prairie cordgrass, EST-SSR markers (Gedye et al., 2010), SSR (Gedye et al., 2012), and AFLP markers (Moncada et al., 2007) have been developed. However, these technologies may not be as cost-effective, scalable, successful, or as flexible as using single nucleotide polymorphisms (SNPs) (Semagn et al., 2014). SNPs provide a highly efficient way to conveniently compare genomic and transcriptome sequences. Because they are one of the most abundant DNA variants found in plant genomes, SNPs are more likely to be related to specific biological functions and phenotypes (Rafalski, 2002; Bundock et al., 2006; Salem et al., 2012). This technology has been applied in genetic diversity analysis, genetic map construction, association map analysis, and marker-assisted selection breeding in many different types of crop species (Byers et al., 2012; Saxena et al., 2012; Semagn et al., 2014; Sindhu et al., 2014; Wei et al., 2014). SNP marker technology is also utilized in high-throughput genotyping, increasing the speed of the selection process by eliminating growing plants to maturity for phenotypic selection (Paux et al., 2012). In order to use SNP markers for genetic improvement, there is a three-step process one must follow: (1) SNP discovery after aligning sequence reads generated by next-generation sequencing technologies for different genotypes of a given species; (2) validate SNPs to distinguish DNA polymorphisms of actual allelic variants from those of other biological phenomena such as gene duplication events; (3) SNP genotyping of germplasm collection or genetic/breeding populations (Saxena et al., 2012). Step one of the process was accomplished in prairie cordgrass by using a transcriptome assembly derived from multiple genotypes and tissues (Gonzalez et al., personal communication). The second and third steps are yet to be completed for polyploid prairie cordgrass. Several parameters, such as sample size, number of SNPs to be used for analysis, cost effectiveness, and the SNP genotyping platform, must be considered in these analyses (Semagn et al., 2014). Many technologies exist for use in SNP genotyping analysis, but one technology performs well when it comes to adaptability, efficiency, and cost-effectiveness. Kompetitive allele-specific PCR (KASP), developed by LGC Genomics (Teddington, UK; www.lgcgenomics.com), is a PCR-based homogeneous fluorescent SNP genotyping system, which determines the alleles at a specific locus within genomic DNA (Semagn et al., 2014). The KASP technology has been utilized on other polyploid plant species, including switchgrass (LGC Genomics, 2014), cotton (Byers et al., 2012), wheat (Paux et al., 2012), potato (Uitdewilligen et al., 2013), and various triploid citrus species (Cuenca et al., 2013). In this study, SNPs, identified in the nuclear transcriptome, were converted to the KASP marker system in order to validate that these SNPs are true allelic variants. In addition, KASP markers were used in quality control analysis when making crosses, prairie cordgrass being a putative self-compatible species. The main objectives of this study were (1) to validate SNP polymorphisms identified in the nuclear transcriptome of natural populations of prairie cordgrass in the U.S. and (2) to assess the fidelity of specific tetraploid crosses and selfs, and to elucidate inheritance patterns of SNP markers.

Materials and methods

Development and validation of KASP genotyping assays

In a separate study by Gonzalez et al. (personal communication) at South Dakota State University, a transcriptome of prairie cordgrass was assembled using ~1.2 billion Illumina paired-end reads from various vegetative tissues (roots, leaves, and rhizomes) under various conditions (salt stress, cold stress, and differing photoperiods) in order to obtain an abundance in diversity, with regards to the number and type of transcripts. The assembly was developed using CLC Genomics Workbench 7.0 (Arhaus, Denmark) and annotated against the sorghum genes models. About 146,549 contigs, or transcript assemblies, of 230 bp or more with an N50 of 973 bp were used to mine over 1 million SNPs, insertions, and deletions using the variant detection function in CLC Genomics Workbench. Putative SNPs were filtered based on coverage (minimum of 100 X), a window of 80–100 bp free from additional SNPs and an allele frequency of 20–80%. Initially, nine bi-allelic SNPs were selected for analysis, associated with enzymes within the lignin biosynthesis pathway. Additional SNPs were selected without regard to putative function of the transcript assembly. A total of 121 bi-allelic SNPs were identified for use in this study (Table 1). SNPs were sent for primer development to be used in KASP genotyping assays. Genotyping with KASP was performed as follows.
Table 1

Summary of SNP sequences, including SNP ID, SNP sequences, and SNP alleles.

SNP IDSNP sequence/alleleSNP IDSNP sequence
pcg_00001GTCCTTGAGCTCGGC[G/A]TCCACGTCCAAGCGpcg_00032GCCAGTATTGGCAAG[A/C]ATGCAACAATTACT
*pcg_00002CGCCAGGTACACCGG[C/G]GCCGCCTGGTTAGTpcg_00033AAAGACTACCCTTCC[A/C]TATCGAATAGAGAA
pcg_00003GTCGGCCCCGGCCTC[A/G]AACCACGGGACGCCpcg_00034ACAGCTCCGGATGAA[A/G]TGGTACTTGATCCG
pcg_00004ACCCGAAGGAGAAGG[G/T]CGCGATGGCGCCCG*pcg_00035TCTTTCGACCAAGTA[A/G]CTCACCCAGTAGGC
pcg_00005AAGAACAAATTTATA[A/G]GTTAAATACATGCA*pcg_00036GCTCGTGTCGATGTC[G/A]CCGGCGAGGTCGCT
pcg_00006GCCAAAGGACAGATC[A/G]TGAATAACATGACTpcg_00037CGAGGTGTGATGCAC[T/C]AGAACGCCGCTCGT
pcg_00007CGGAACTGAGGAACA[A/G]TAGCATACATGCTT*pcg_00038GCTCACATACCCGAC[A/G]GCGAACGCCAAGTC
pcg_00008GTTCGACCGCGCGGC[A/C]ATCGCCGAGCTCGA*pcg_00039TGGGCAGGGTTGCAG[T/C]CACCCATGCCTCCC
pcg_00009GAGAAGAAGAGAGTG[A/G]TTGCATCATTGGAC*pcg_00040CGCTTCTTCCGTGCC[A/G]GTGATGACGAGGTC
pcg_00010GGTGCGGCTTGACAA[T/C]GTCACAATACAAGT*pcg_00041GTGTCCCCGGCCTCG[C/T]CGGTACACCGCCGC
pcg_00011CTGTTTGTTAAGTGC[A/G]CTGAATTTGAGATTpcg_00042GCGGTGCTTGCCGCA[A/G]CCCGTACAAGGCCT
pcg_00012GCATTCATGTTCCCA[A/G]TACATCCTGGCAAA*pcg_00043CTTCTTGAGCTTGAA[T/C]ACCCACTTCAGGGT
pcg_00013ACAATCATTGTTTTT[T/C]GTAATTGGGGAACT*pcg_00044CGGGCGGTGGCCGGC[T/C]GGCAAGTCGACGAG
pcg_00014CCAAATGGCAAAAAT[T/G]TACTCAGATTTCCApcg_00045AAGTCAGTTGTTGTC[T/A]GCAACCCTCATCGT
pcg_00015ACTTGATTTAGAGTC[G/A]GCAGACATCATTTT*pcg_00046TCTGTTTGATTACCA[C/T]GGTAAGCTCACTCA
pcg_00016AGCGCTTCACGCGAT[A/G]GAGTTCTCCGAAAT*pcg_00047TTACCAAATACCCAG[A/G]TGCAGAGTTCAAGC
pcg_00017TAGCTTTAGGTGTTG[G/A]GTTTCGCATCAGTApcg_00048AAGCAACAACTTACT[C/T]GAGCAAAGTGCAAG
pcg_00018AGAACCAACTCTTTA[C/T]ATCAGACTGCGTATpcg_00049TTACTTTCATATAAC[G/A]GGATGAAGCATGCA
pcg_00019AACAAAGACAACATG[A/G]CTCACGAGAAATTGpcg_00050CAGGGACATTCGTTT[C/T]GTCCTCCAAAAATA
pcg_00020TTTGGATGTTGAACT[G/A]TCTCAGATGTCCTTpcg_00051CCCTTGAATGGCTTC[T/C]TTTTCTTTTGTGCA
pcg_00021TTTGGATGTTGAACT[G/A]TCTCAGATGTCCTTpcg_00052CACCAACCACTTGTC[A/G]TGGTGACGCTTCGT
pcg_00022ATGAATTTTGGCACG[A/G]ACTTTTTGTTTGAApcg_00053CGAGGTTGATGTTTA[T/C]GCTCGTCGATGACG
pcg_00023GCATCCACAAGAATG[G/C]CCATGAACAATTAApcg_00054AAAGTATTTGTAGGA[G/A]ACCCCTGAGGGTTC
pcg_00024GATCGAGAAAAAAAA[A/T]TTGGATGAAGATTCpcg_00055CTCGCGTGGCCTTCT[C/G]TGTCATAAACCATG
pcg_00025TTTGAGGAGGACGGT[G/A]ATGATAGCAAATCT*pcg_00056GGAACGTATCCTGTG[T/C]ATAAGGGCTCTCCG
pcg_00026GTGAGGGATAGATTG[T/G]CAAGCAATGCAAGTpcg_00057AACTTGGTATCAGAC[C/G]GCCAAGGTTAAACC
pcg_00027CCATCTAAGGTCAGG[A/G]TTCTAAGTTCATTCpcg_00058GGCACGGTAAACCTT[T/G]GCAAAGGTCCCTTG
pcg_00028ACATTCTTCCGATCT[C/A]GGGTTTTTAACCCApcg_00059TCAACCGTCTCCCCC[G/C]AGATGATTGTCTAA
pcg_00029GGACCATTTGTTGTC[A/G]TCAAGGTTTCCCAGpcg_00060CACCCCACAAGACCA[T/A]ATGTCGGCTTTTGC
pcg_00030GAGAGCATTGATGTC[G/A]CTGGCTCTTGGAAApcg_00061AAATCTTTTTTTCCA[G/T]TATCTTTTTTCTTA
pcg_00031AGTTAGACCTGAGAT[T/C]GAACATTCTGAAAApcg_00062GTAATTGTTTGCAGA[C/G]AACTTTTCATTTGT
pcg_00063GGAAGATATGCAACA[C/T]TTTGGGGAGGAAGCpcg_00093TACTGGGAAGAAACC[G/A]TTCCACTTGTCCTG
pcg_00064GGGGATGTCACCCTT[C/T]CCCGGCGCGGTGATpcg_00094GCTCTCCGCACACGC[C/T]GCCACCGCTACATC
pcg_00065CAGCGGCAGCGACGC[G/A]GCGCTCCTGAGCCC*pcg_00095TGGTGAAAAGGTCCT[G/C]ATCCAGTTTGAGGA
pcg_00066CGGCTTCGACCCGCT[C/G]GGCCTGGCGGAGGA*pcg_00096CAGGGACCGGAACCG[G/A]TTCCACCGGTTCAG
pcg_00067GAGGATGTTGTCGAG[C/T]TTGACGTCGCGGTG*pcg_00097TTTTGTTACAAAATA[C/T]GAGCAAGCTCTGTT
*pcg_00068CAATCCTGGAAAGGA[C/T]CCACTAATGTTTGTpcg_00098GTACAATGTCTGGGC[C/A]AGTACTCCTAATGG
pcg_00069TGAAGTAACTACTAA[A/T]ATAGTACTGTTGTApcg_00099AAAAAAAAGATGATG[A/T]CAGGTTACAAATTG
pcg_00070AGGCTCTCACGATCA[T/G]TCCGAGTCGCTGTC*pcg_00100GACTCTCTACGGCTC[C/A]TCCAGGCTCACCGC
pcg_00071GGCAAGGCTTTTACA[A/C]AAGAAGTTGTCGAGpcg_00101AGTACATGCAGGAGG[G/A]GCATTCTCTTCCTT
*pcg_00072GGAGTACAATGGAAA[A/G]CTTCATGTGCCTGGpcg_00102CCATTTGAATCTCAA[G/A]GCACTGACGTGAAC
pcg_00073TTTCCCTGGATTTGG[C/T]CTGGGTCTTGTTATpcg_00103GCTAGCTTTTGCGCC[C/T]CTATACATCTTTTC
*pcg_00074CGAGCATATAATATG[G/A]CCCTAAAATGATGGpcg_00104CGTCCTCGTCGTCTT[C/G]TTCCTCTGGCTGCT
pcg_00075CGGCCGCGAGGACTC[G/C]CCGCTCGACATCATpcg_00105GCTTGTGCTCATGGA[T/C]GTGGTTCACAGCCA
pcg_00076CATCCCCACCTACGT[C/G]GTCGGAGTCAATGCpcg_00106ATTGGTGCTGTTGCT[G/C]GACGTGAAGCTGAC
*pcg_00077CTCCTGCACCACCAA[C/T]TGCCTCGCGCCCTTpcg_00107AGATGACGGAGTCGG[C/A]GACGACGTGGGAGC
pcg_00078ATGGAGGGACACAGC[C/A]GGCAAAGTGGATGTpcg_00108CTCTTTGCGCATGTG[G/A]CTCTTTTCCAGGGC
pcg_00079AGATTCTGATATTGA[T/C]TTGGATGACTATTCpcg_00109ACTCAGACCATTTTG[A/G]ACCACCTCAGATGT
pcg_00080TGCGTATATTCTCCG[T/G]GGTGAGACCAAAATpcg_00110TATGTTATCTCAATG[T/G]GATCTACACCTGCA
pcg_00081GCTCGCCCTCGCAAC[T/A]ATCGGATCTTGCGCpcg_00111GCCGACGGGATGCGG[C/G]CGATTCACATTTGC
*pcg_00082CTGGCTGTAGGAATG[G/A]CCTTTTCACCTGAApcg_00112TGACCACATGCCATG[A/G]GTATCAAGCCTATT
pcg_00083TGAAGTTATGTATGA[T/C]CTGAGAGCTAGTGGpcg_1186GACCTCGCAGAACAC[T/C]GCAGACATGACCTC
pcg_00084AAGTTCGGGATCAGC[A/T]CCGTGTATTTGGGApcg_13880TCAAGTACCTCACCG[G/A]CGAGGCCAAGGCTT
pcg_00085CTTCTGAAGTCGGAA[C/A]TGCCATCAAACTGGpcg_14142CACGCAGTTGGGGGC[C/G]AGGATGAGGACGAC
*pcg_00086AGGAGTATCCACCTG[G/T]AATAACACTTGTACpcg_2412CACATTGCGATTAGC[G/A]TATCGATCATGAAA
*pcg_00087CAACACAATGAATCG[T/G]ATTGGAAAAGGAAGpcg_37652ACTTGAAGAGAGACG[C/A]ATCTGAAGGCAGAT
pcg_00088TTTACAAATGCATAA[A/G]ATCTATGTTGGTAA*pcg_38909CACGCAGTTGGGGGC[C/G]AGGATGAGGACGAC
pcg_00089CGTACCTGCAGTTCA[T/C]GTTCGCCTACATCTpcg_77221GAGCTCGCCAGGCAC[G/T]CTGGCTTCTGTGGC
pcg_00090GAGGGGTAGTAAGAA[A/G]ACAAAGGAGACGTGpcg_7965TGACCAGCCGCAGCA[G/A]CCGCTCGTGGTAGT
pcg_00091GGTACATAGTTTGAT[C/T]CACCTCCCTTCCTCpcg_80876TGGCGTCGTAGGTGC[G/A]CCACGGAGGACGCG
*pcg_00092ATGGGAAGACAGGTT[T/C]GCAGCTTCATTATT

Failed primers.

Bold letters are actual SNPS (SNP alleles).

Summary of SNP sequences, including SNP ID, SNP sequences, and SNP alleles. Failed primers. Bold letters are actual SNPS (SNP alleles). For all samples, each amplification reaction contained 50 ng template DNA, KASP V4.0 2x Master mix standard ROX (LCG Genomics, Beverly, MA, USA) and KASP-by-Design assay mix (LGC Genomics, Beverly, MA, USA). The PCR thermocycling conditions for all primers, except pcg_1186, was 15 min at 94°C followed by 10 cycles of 94°C for 20 s and 61°C for 1 min (dropping −0.6°C per cycle to achieve a 55°C the annealing temperature) followed by 26 cycles of 94°C for 20 s and 55°C for 1 min. The PCR thermocycling conditions for primer pcg_1186 was 15 min at 94°C followed by 10 cycles of 94°C for 20 s and 65°C for 1 min (dropping −0.8°C per cycle to achieve a 57°C annealing temperature) followed by 26 cycles of 94°C for 20 s and 57°C for 1 min. After amplification, PCR plates were read with a Spectramax M5 FRET capable plate reader (Molecular Devices, Sunnyvale, CA, USA) using the recommended excitation and emission values. Data was then analyzed using Klustercaller software (LGC Genomics. Beverly, MA, USA) to identify SNP genotypes.

Core collection analysis

In order to validate SNP polymorphisms of prairie cordgrass using KASP, seeds and rhizomes of natural populations were collected from across the continental U.S.A. (Kim et al., 2013) and grown at the Energy Biosciences Institute (EBI) Farm, Urbana, Illinois, USA. Individuals from 38 of these populations were selected as core collection based on geographic distribution; and two plants from each population were sampled, for a total of 76 plants (Table 2). Leaf tissue samples were stored at −80°C until DNA extraction was performed. Total genomic DNA was extracted from frozen leaf tissue using the CTAB method (Mikkilineni, 1997) with slight modifications as described by Kim et al. (2013). Fifty-nine KASP genotyping assays out of 121 were selected and used to analyze the collection and five additional Spartina species samples, namely; S. alterniflora, S. patens (Flageo vt.), S. patens (Sharp vt.), S. patens, and S. bakeri. All of the KASP genotyping assay results were recorded as a two-letter code, or SNP code, i.e., AA, AG, GG. A DNA fingerprint was made using all the SNP genotypes creating a concatenated DNA-like sequence, which was then imported into MEGA 6 (Tamura et al., 2013) to make a phylogenetic tree. The maximum parsimony (MP) tree, inferred from 1000 replicates, was obtained using the Subtree-Pruning-Regrafting algorithm with a search level one in which the initial trees were obtained by the random addition of sequences (Felsenstein, 1985; Nei and Kumar, 2000). All positions with <95% site coverage were eliminated.
Table 2

Summary of plant materials used including, location, cytotype, and number of plants used per population.

IDLocationPloidyNumber of samples
103 4XIL4X2
9046803NY4X2
IL102IL4X2
IL99AIL4X2
MBB4XIL4X2
PC09-101CT4X2
PC09-102CT4X2
PC17-109IL4X2
PC17-111 4XIL4X2
PC19-101IA4X2
PC19-103IA4X2
PC19-105IA4X2
PC20-102KS4X2
PC20-105KS4X2
PC22-101LA4X2
PC23-101ME4X2
PC23-104ME4X2
PC29-101MO4X2
PC29-104MO4X2
PC34-101NJ4X2
PC40-101OK4X2
PC55-102WI4X2
PC55-103WI4X2
ND-2-51-4ND8X2
PC17_111 8XIL8X2
PC19-106IA8X2
PC19-107IA8X2
PC19-108IA8X2
PC20-104KS8X2
PC20-106KS8X2
PC27-103MN8X2
PC31-101NE8X2
PC31-104NE8X2
PC38-101ND8X2
PC40-104OK8X2
PC46-110SD8X2
PCG109SD8X2
Red RiverMN, SD, ND8X2
Total76
Summary of plant materials used including, location, cytotype, and number of plants used per population.

F1 cross

In order to assess the utility of the KASP marker system in confirming specific tetraploid crosses of prairie cordgrass, a reciprocal cross involving two individuals (PC17-109 × PC20-102) of two populations differing in morphological characteristics of potential agronomic importance was developed. PC17-109 is a tetraploid population from Illinois with a phalanx rhizome type and low seed mass, whereas PC20-102 is a tetraploid population from Kansas with a guerilla rhizome type and high seed mass. In a greenhouse, the female inflorescence was covered ~1 day prior to stigma emergence, while pollen was collected from the male parent. Pollen was directly applied to the stigmas with a brush, and rebagged until anthesis was completed. A total of 83 individuals, 70 F1 individuals from PC17-109 (female) × PC20-102 (male) and 13 F1 individuals from PC20-102 (female) × PC17-109 (male) were sampled. F1 seeds were planted in greenhouse setting. Leaf tissue samples of each seedling were collected and stored at −80°C until DNA extraction was performed. Total genomic DNA was extracted from frozen leaf tissue as described previously. For the F1 individuals, 12 KASP genotyping assays were selected based on the parental SNP genotypes (Table 3). All of the assay results were recorded as two-letter SNP codes. To determine if the F1 progeny followed segregation of a typical monohybrid cross in relation to SNP genotype, a χ2 analysis was performed using P = 0.05, df = 2, and χ2 critical value = 5.991. The observed, along with the expected genotype, was recorded for each KASP genotyping assay.
Table 3

Primers selected for use on the prairie cordgrass F.

pcg_00011pcg_00012pcg_00024pcg_00050*pcg_00058*pcg_00059*pcg_00106*pcg_1186*pcg_14142*pcg_00061pcg_00062pcg_7965
PC17_109 (Parent)GAGATATTGGCCCCCCGGTGGCAG
PC20_102 (Parent)GGGGAACCTTGGGGTTCCTGGCAG
13_F1001GGGGAACCTTGGGGTTCCTTCCAG
13_F1002GAGATATCGTCGCGCTGCGGGGGG
13_F1003GAGATATCGTCGCGCTGCGGGGAG
13_F1004GAGATATCGTCGCGCTGCTGGCAA
13_F1005GAGATATCGTCGCGCTGCTTCCAG
13_F1006GAGATATCGTCGCGCTGCTGGCAG
13_F1007GGGGAACCTTGGGGTTCCGGGGAG
13_F1008GGGGAATCGTCGCGCTGCTGGCAA

The first three primers indicate one parent as heterozygous and one parent as homozygous, the next six primers indicate both parents as homozygous for opposite alleles, and the last three primers indicate both parents as heterozygous. Also shown are SNP assay results for eight out of the 83 F.

Primers that can distinguish true crosses from selfed samples.

F.

Primers selected for use on the prairie cordgrass F. The first three primers indicate one parent as heterozygous and one parent as homozygous, the next six primers indicate both parents as homozygous for opposite alleles, and the last three primers indicate both parents as heterozygous. Also shown are SNP assay results for eight out of the 83 F. Primers that can distinguish true crosses from selfed samples. F.

F2 self

To assess the utility of the KASP marker system in identifying selfed individuals in the tetraploid background and gauge the segregation pattern, F2 individuals were generated and genotyped. In a greenhouse, the prairie cordgrass inflorescence was covered ~1 day prior to stigma emergence with bags constructed to view progression of inflorescence development of F1 plants. When anthesis was reached, the bags were shaken to promote self-pollination. Bags remained until anthesis was complete. F2 seeds were collected and planted in a greenhouse setting. A total of eight F1 individuals were selfed (6 F1 of PC17-109 × PC20-102 and 2 F1 of PC20-102 × PC17-109) and 8–11 individuals were sampled from the planted seeds of each of the selfed plants (total of 76). Leaf tissue samples were stored at −80°C until DNA extraction was performed. All 12 of the KASP genotyping assays selected to score the F1 individuals were also tested on the F2 individuals. All of the assay results were recorded as a SNP code as done in the F1 analysis. All SNP codes that were not accurately identified were removed from analysis.

Results

Development and validation of KASP assays

Twenty-six (21.5%) SNPs failed KASP marker development. From the remaining 95 (78.5%), 11 SNPs were found to be monomorphic when tested on the core collection DNA, resulting in 84 SNPs that were true allelic variants. Three of the eleven monomorphic markers were selected to discover if future plant samples would reveal the SNP polymorphisms previously identified in the transcriptome. From the 84 allelic variants, 56 of the most highly polymorphic SNPs were selected for further use in this study, resulting in 59 total KASP genotyping assays (Table 4).
Table 4

Sampling of DNA fingerprints created using SNP codes from 59 KASP genotyping assays.

Subject IDpcg_00006pcg_00008pcg_00009pcg_00010pcg_00011pcg_00012pcg_00013pcg_00014pcg_00015pcg_00016pcg_00017pcg_00018pcg_00021pcg_00022pcg_00023pcg_00024pcg_00025pcg_00026pcg_00027pcg_00028pcg_00029pcg_00032pcg_00034pcg_00037pcg_00042pcg_00049pcg_00050pcg_00058pcg_00059pcg_00060
PC19_103_1AAAATTGAGACTGTAGGAAGTCAGAACGAAGGGTGAACGACAGGCCGGAGTTGGCCTT
PC19_103_2AAAATTGAGACTGTAGGAAGTCAGAACGAAGGGTGAACGACAGGCCGGAGTTGGCCTT
PC20_104_1GACTGTAGGAAGTCAGGACGTAAGGTGAACGACAGACTGAGGCCGTGGAT
PC20_104_2GACTGTAGGAAGTCAGGACGTAAGGTGAACGACAGACTGAGGCCGTGGAT
PC34_101_1GACATTGAGACCGGAAAAAATTAAAACCGGGGGGAAGGCCGGCCGGAATTGGCGTT
PC34_101_2GAAACTGACTGTAGAGTCAGCGTAGTACGACACCGT
PC38_101_1GACAGAAAAATTGTGGGGCCGGGAGGTAAGTTAACCAAAAGACTGAGGCCGTGG
PC38_101_2GATTGAGAGTAGAGTCAGAACGTAGGGTGAACGAGGCCGGAATTGGCCAT
Red_River_1AACAGACTGAGACTGTAGGAAGTCAGGACGTAAGGTGAACGACAGACTGAAGCCGTGGTT
Red_River_2AAAAAACTGAGACTGGAGAAAGTCAGAACGAAGGGTACGACAGACTGAAGCCGTCGAT
PC17_109GACATTGAGACCGGAAAAAATTAAAACCTAGGGGGGAAGGCCGGCCGGAATTGGCCTT
PC20_102GAAAAATTGGGGCCGGAAAAAATTAAAACCAAGGGGGGAAGGCCGGCCGGAGCCTTGGTT
S. alterniflora (East)AACCAATTAAAACCGGGGCCAAAACCAAGGGGGGAAGGCCGGCCGGCCGGGGAA
S. bakeriAACCAATTAAAACCGGGGCCAAAACCTAGGGGGGAAGGCCGGCCGGCCGGGGAA
S. patens (Sharp)AACCAATTAAAACCGGGGCCAAAACCAAGGGGGGAAGGCCGGCCGGCCGGGGAA
S. patens (Flageo)AACCAATTAAAACCGGGGCCAAAACCAAGGGGGGAAGGCCGGCCGGCCGGGGAA
S. patensAACCAATTAAAACCGGGGCCAAAACCAAGGGGGGAAGGCCGGCCGGCCGGGGAA
Subject IDpcg_00061pcg_00062pcg_00065pcg_00066pcg_00078pcg_00081pcg_00083pcg_00084pcg_00085pcg_00088pcg_00092pcg_00093pcg_00098pcg_00101pcg_00102pcg_00103pcg_00104pcg_00106pcg_00109pcg_00110pcg_00111pcg_00112pcg_7965pcg_14142pcg_1186pcg_77221pcg_13880pcg_2412pcg_37652
PC19_103_1GGGGGGGGACTTCTTAAACCGGCCGGAGTCCCCGGGGGCCAAAGGCCTGGGGGGCC
PC19_103_2GGGGGGACTTCTTAAACCGGCCGGAGTCCCCGGGGGCCAAAGGCCTGGGGGGCC
PC20_104_1TGGCGCACATTTAAACGACCAGGGAGCCGCGAGTCCAAGGGCCTTTGGGGCC
PC20_104_2TGGCGCACATTTAAACGACCAGGGAGCCGCGAGTCCAAGCGTTTGGGGCC
PC34_101_1TGGCAGGGACTTCTTAAACTGGCCGGAATCCCCCGGGGGCAAGGGGCTGGGGGGCC
PC34_101_2TGAGGCTTCTTACCCTGGACAGAGCCCCCGGGGGAATTGGGGGGCC
PC38_101_1GGGGGGGCACTTCTTTACGACTAGCCAGAGTCGCCGGACCAAGGGCTTGGGGGGCC
PC38_101_2GGGGGGGCCCTTCCTTCCGGTTGGAAAGCCCCCCGGGGGCAAAGGGCTGGGGGGCC
Red_River_1TGGCAGGCACATCTTACCGACTAGACAGGGGCGGGTGCAAGGGCCTGGGGGGCC
Red_River_2TGGCGCCCATCTTACCGACTAGACGGAGCCCCGGGTGCAAAGTTGGGGGGCC
PC17_109TGGCAGGGCCTTCCTTACGGTTGGACAGAGTCCCCCGGGGGCAAAGGGCCGGGGGGCC
PC20_102TGGCGGGCCCATCTTACCGACTAGCCGGAACCCCGGGAGTCCAAAGCCTTGGGGGGCC
S. alterniflora (East)CCGGGCCCTTTTAACCGGTTGGAAGGGGCCCGGGTTAAGGCC
S. bakeriTTCCGGGCCCTTTTAACCGGCCAGAAGGGGTTCCCGGGTTCCAAGGCC
S. patens (Sharp)TTCCGGGCCCTTTTAACCGGCCAGAAGGGGTCCCGGGGTTCCAAGGCC
S. patens (Flageo)TTCCGGGCCCTTTTAACCGGCCAGAAGGGGCCCCGGGGTTCCAAGGCC
S. patensTTCCGGGCCCTTTTAACCGGCCGGAAGGGGCCCCGGGGTTCCAAGGCC
Sampling of DNA fingerprints created using SNP codes from 59 KASP genotyping assays.

Core collection

The resulting data set from the DNA fingerprint contained 118 characters. There was an average of 3.8 missing character data points (SNP codes) per population. The maximum parsimony tree identified one clade after correcting for the missing data (Figure 1). For 47.4% of the populations, plants sampled from the same populations were observed to form subclades; however, intrapopulational variation was observed.
Figure 1

Phylogenetic tree based on maximum parsimony analysis of combined SNP codes to create a DNA fingerprint sequence for the 38 prairie cordgrass core collection populations with a total of 76 plants and 5 . Bootstrap values are indicated on the nodes as percentages. One main clade is identified.

Phylogenetic tree based on maximum parsimony analysis of combined SNP codes to create a DNA fingerprint sequence for the 38 prairie cordgrass core collection populations with a total of 76 plants and 5 . Bootstrap values are indicated on the nodes as percentages. One main clade is identified. Out of the 38 prairie cordgrass populations, 52.6% showed polymorphisms within populations. Of the 52.6% polymorphic populations, 50% were octoploid and 50% were tetraploid. Out of the 15 octoploid populations sampled, 66.7% of the populations showed polymorphisms between the two plants sampled and 43.5% of the 23 tetraploid populations showed polymorphisms. The average number of polymorphisms that occurred within each population was 16. In the octoploid populations, 16.4 was the average number of polymorphisms observed, and 15.5 polymorphisms were observed as the average for tetraploids.

F1 analysis

Only 6 out of 59 possible KASP genotyping assays showed both parents as homozygous SNPs but for opposite alleles. Three representative assays were selected which showed one SNP heterozygous for one parent and one SNP homozygous for the other parent, and three representative assays were selected which showed both parents as heterozygous SNPs (Table 3). All SNP codes that could not be accurately identified or called, due to not appearing in one of the three genotypes, were removed from the χ2 analysis. Four individuals did not consistently satisfy the expected heterozygous SNP genotype, with regards to KASP genotyping assays for which both parents were homozygous for opposite alleles (pcg_00050, pcg_00058, pcg_00059, pcg_000106, pcg_1186, and pcg_14142). These four individuals, after being analyzed across all 12 assays, were identified as being selfs, and were removed from the χ2 analysis (Table 3). Using the resulting trimmed data, the χ2 analysis indicated normal monohybrid 1:2:1 and 1:1 Mendelian inheritance patterns and could not be rejected for any of the primers (Table 5).
Table 5

Summary of χ.

Primer IDObserved X AlleleExpected X AlleleObserved Y AlleleExpected Y AlleleObserved XY AlleleExpected XY Alleleχ2
1:1 TEST
pcg_00011004439.53539.51.025
pcg_0001200433935390.821
pcg_0002443390035390.821
pcg_00050000077770
pcg_00058000077770
pcg_00059000078780
pcg_00106000075750
pcg_1186000078780
pcg_14142000079790
1:2:1 TEST
pcg_000612719.81519.83739.53.962
pcg_000621519.82719.83739.53.962
pcg_79651719.82019.84239.50.544

Analysis indicates that all primers produce expected results from a monohybrid Mendelian cross. df = 2, p = 0.05, critical χ.

Summary of χ. Analysis indicates that all primers produce expected results from a monohybrid Mendelian cross. df = 2, p = 0.05, critical χ.

F2 analysis

The F1 parent genotype was identified in order to find SNPs that indicated the parent was homozygous (Table 6). For 3 F1 parents that were selfed, there were F2 progeny that did not fall into the expected homozygous parental genotype (example in Table 7). Two F2 progeny were identified consistently as unexpected offspring genotype of 13-F1008, 1 progeny of 14-F1014, and 4 progeny of 14-F1071. Individuals that consistently fell into the heterozygous (unexpected) genotype category across multiple homozygous primers were considered outcrosses and not true selfs of the F1(Table 7). Most of the F2 progeny were identified as expected SNP genotypes when considering the parental genotype.
Table 6

SNP assay results for the F.

Parentpcg_00011pcg_00012pcg_00024pcg_00050pcg_00058pcg_00059pcg_00106pcg_1186pcg_14142pcg_00061pcg_00062pcg_7965
13-F1008GG*GG*AA*TCGTCGCGCTGCTGGCAA*
13-F1011GG*GG*AA*TCGTCGCGCTGCGG*GG*AG
14-F1008GAGATATCGTCGCGCTGCTT*CC*AG
14-F1014GG*GG*AA*TCGTCGCGCTGCTGGCAG
14-F1015GG*GG*AA*TCGTCGCGCTGCTT*CC*AG
14-F1042GG*GG*AA*TCGTCGCGCTGCGG*GG*AG
14-F1067GG*GG*AA*TCGTCGCGCTGCTGGCGG*
14-F1071GAGATATCGTCGCGCTGCTGGCAA*

Indicates homozygous SNPs.

Table 7

SNP assay results for F.

pcg_00011*pcg_00012*pcg_00024*pcg_00050pcg_00058pcg_00059pcg_00106pcg_1186pcg_14142pcg_00061pcg_00062pcg_7965*
13-F1008 (Parent)GGGGAATCGTCGCGCTGCTGGCAA
F2:2012_13_F1_008_1GGGGAATCGTCGGGTTGGGGGGAA
F2:2012_13_F1_008_2GGGGAATTGTCGGGTTGGTGGCAA
F2:2012_13_F1_008_3GGGGAATCGTCGCGCTGCTGGCAA
F2:2012_13_F1_008_4GGGGAATCGGCCCGCTGCTGGCAA
F2:2012_13_F1_008_5GAGATATTTTGGCGCCGGTTCCAG
F2:2012_13_F1_008_6GAGATATCGTCGCCCCGCTGCCAG
F2:2012_13_F1_008_7GGGGAATCTTGGCGCCGCTTCCAA
F2:2012_13_F1_008_8GGGGAACCTTGGCGTTGCGGGGAA
F2:2012_13_F1_008_9GGGGAATCGGCCGGCTGCTGGCAA
pcg_00011*pcg_00012*pcg_00024*pcg_00050pcg_00058pcg_00059pcg_00106pcg_1186pcg_14142pcg_00061*pcg_00062*pcg_7965
13-F1011 (Parent)GGGGAATCGTCGCGCTGCGGGGAG
F2:2012_13_F1_011_1GGGGAATCTTGGGGCTGCGGGGAG
F2:2012_13_F1_011_3GGGGAATTGTCGCGCTGCGGGGAG
F2:2012_13_F1_011_4GGGGAACCGTCGGGCTGCGGGGAG
F2:2012_13_F1_011_5GGGGAATTGTCGCGCTGCGGGGGG
F2:2012_13_F1_011_6GGGGAACCGTCGCGCCGCGGGGAA
F2:2012_13_F1_011_7GGGGAACCGGCCGGCCGCGGGGAG
F2:2012_13_F1_011_8GGGGAATCGTCGCGCTGCGGGGAA
F2:2012_13_F1_011_9GGGGAATCGTCGCGCTGCGGGGAG
F2:2012_13_F1_011_10GGGGAACCTTGGCGCCGCGGGGAG
F2:2012_13_F1_011_2GGGGAATCGTCGCGCTGCGGGGAA

Indicated are samples that can be identified as true selfs and as outcrossed.

Primers that can distinguish true selfs from outcrossed samples.

F.

SNP assay results for the F. Indicates homozygous SNPs. SNP assay results for F. Indicated are samples that can be identified as true selfs and as outcrossed. Primers that can distinguish true selfs from outcrossed samples. F.

Discussion

In order to validate SNP polymorphisms in prairie cordgrass, 121 SNPs identified from the nuclear transcriptome were sent for KASP assay development. Among 121 SNPs, the assay success rate was 78.5% with 26 assays failing development. This is comparable with findings in the literature of success rates of 83% (Cockram et al., 2012), 88.4% (Saxena et al., 2012), and 80.9% (Semagn et al., 2014). The assays failed mainly due to paralogs within the prairie cordgrass genome. Because not all of the populations used to develop the transcriptome were in the core collection of DNA used in this study, some assays appeared as monomorphic. These selected SNPs may have been derived from the octoploid populations not present in the core collection. Three monomorphic SNPs were selected for further analysis, to see if the SNPs would be polymorphic in future studies. With the failed and monomorphic assays removed, 84 putative SNPs were validated as true allelic variants and 59 SNPs were selected for this study. The 59 highly polymorphic assays were selected based on the criteria that there were at least two of the three genotypes present in a large portion of the samples analyzed. These assays were tested on the 38 natural populations, creating a phylogenetic tree that resulted in one clade containing all of the prairie cordgrass populations. If subclades were observed, the two plants of a single population were represented in the subclade. Just over half of the populations showed polymorphisms within, with an equal number of octoploid and tetraploid populations. The average number of polymorphisms that occurred within each population did not vary between octoploid and tetraploid populations. This is different from a chloroplast DNA study of prairie cordgrass, in which there was little, if any, polymorphisms observed in the tetraploid cytotype (Graves et al., 2015). SNPs were successfully identified in nuclear transcriptomes of prairie cordgrass and validated as allelic variants that can be used in prairie cordgrass. SNP markers were used to detect significant polymorphisms in prairie cordgrass populations collected from distinct geographic regions in the U.S. These SNP polymorphisms appear to reflect genetic relationships in prairie cordgrass and, therefore, can be used to assess genetic diversity within and among populations in future studies. The F1 population, consisting of 83 plants, allows for the assessment of the fidelity of a specific tetraploid cross. Due to the lack of synchronization between the pollen and the ovaries, fewer seeds were obtained when PC20-12 was used as the female, compared with crosses involving PC17-109 as the female. Progeny that had SNP genotypes matching the female parent only were determined to be selfs. Of the F1 progeny, 95.2% were identified to be hybrids. Prairie cordgrass is a protogynous outcrossing species (Gedye et al., 2012), leading to the possibility that later-maturing stigmas could have been exposed to pollen from the same female parent, resulting in 4.8% of the F1 being selfs. The analysis of the 76 F2 progeny obtained by selfing eight F1 plants indicate that the SNPs, and the SNP markers chosen, could distinguish between a true selfed plant and an outcrossed plant. This is based on individuals consistently being genotyped as heterozygous (outcrossed) rather than being homozygous (selfed) as expected. Ninety-one percent of the F2 progeny were identified as successful selfs. Because of the protogynous nature of this species, there is already a natural element working against selfing. This could explain why outcrossed individuals were identified. There is also a possibility that some of the early-maturing stigmas were exposed to pollen in the greenhouse before bagging. This could explain why more F2 progeny were identified as unexpected genotypes (outcrosses) than the expected genotype (selfs) of the F1 progeny. There is evidence that the tetraploid cytotype is an allotetraploid that may follow a disomic inheritance pattern. Two divergent copies in the Waxy lineages of Spartina genus support the allotetraploid origin of S. pectinata (Fortune et al., 2007). The bivalent pairing that occurs during meiosis (Church, 1940; Marchant, 1968a,b; Bishop, 2015) and the observation of disomic inheritance using genotyping-by-sequencing (Crawford, 2015) both suggest a disomic inheritance pattern in S. pectinata. This hypothesis was tested in a cross between two prairie cordgrass populations, exploiting the bi-allelic nature of the KASP technology to suggest Mendelian segregation ratios in a monohybrid type cross. The analysis of the F1 hybrids and F2 selfs conclude that disomic inheritance of SNPs in tetraploid prairie cordgrass is in agreement with the chromosomal and genomic evidence, and a possibility in this cross (Marchant, 1968a,b; Fortune et al., 2007; Bishop, 2015; Crawford, 2015). The primary requirement of any breeding program is to ensure that accurate crosses are made (Glaszmann et al., 2010). The small flower size of prairie cordgrass and the large number of flowers per head make it hard to perform physical emasculation. Possibilities of self-pollination always exist and, therefore, developing a molecular way to confirm true crosses from selfs is warranted (Fang et al., 2004; Gedye et al., 2012). In prairie cordgrass, SSR markers have been developed that identified successful crosses in this protogynous species without the need for emasculation. This study also confirms that hybrids of prairie cordgrass can be created and verified with molecular markers. However, utilizing SSRs can be time-consuming, limited in number, and more expensive than SNP markers, making a way for the introduction of these newly developed and validated KASP assays.

Conclusion

This study reports the first research of SNP marker development for use in prairie cordgrass. SNP markers developed from the nuclear transcriptome were tested on a core collection of DNA and found to be polymorphic among and within populations. The amount of variation differs from previous findings based on chloroplast DNA, which identified the octoploid cytotype as the most variable. However, one must recognize these SNP markers cover a wide range of expressed genomic DNA vs. two non-coding chloroplast DNA regions, giving nucleic SNP markers an advantage in identifying random genetic variation. These markers were used to assess the validity of true crosses that were made between two different populations using F1 and F2 (selfs of F1) progeny. Utilizing the biallelic nature of the KASP system, χ2 analysis of the F1 samples suggests that tetraploid prairie cordgrass may follow Mendelian disomic inheritance although other modes of inheritance were not ruled out. This analysis provides insight into the genomic structure of this species, supporting the hypothesis that tetraploid prairie cordgrass is an allotetraploid. However, further analysis must be done on other cytotypes to completely understand the genome structure of this species and to evaluate genetic diversity. In addition, this study underlines the usefulness of using SNP marker technology in future breeding programs of prairie cordgrass, and opens up the ability for the final step using SNP markers in genotyping germplasm collections or genetic/breeding populations of prairie cordgrass.

Conflict of interest statement

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
  15 in total

Review 1.  Applications of single nucleotide polymorphisms in crop genetics.

Authors:  Antoni Rafalski
Journal:  Curr Opin Plant Biol       Date:  2002-04       Impact factor: 7.834

2.  Accessing genetic diversity for crop improvement.

Authors:  J C Glaszmann; B Kilian; H D Upadhyaya; R K Varshney
Journal:  Curr Opin Plant Biol       Date:  2010-02-16       Impact factor: 7.834

3.  Evolutionary dynamics of Waxy and the origin of hexaploid Spartina species (Poaceae).

Authors:  P M Fortune; K A Schierenbeck; A K Ainouche; J Jacquemin; J F Wendel; M L Ainouche
Journal:  Mol Phylogenet Evol       Date:  2006-11-29       Impact factor: 4.286

4.  Robust allele-specific polymerase chain reaction markers developed for single nucleotide polymorphisms in expressed barley sequences.

Authors:  P C Bundock; M J Cross; F M Shapter; R J Henry
Journal:  Theor Appl Genet       Date:  2005-11-19       Impact factor: 5.699

5.  MEGA6: Molecular Evolutionary Genetics Analysis version 6.0.

Authors:  Koichiro Tamura; Glen Stecher; Daniel Peterson; Alan Filipski; Sudhir Kumar
Journal:  Mol Biol Evol       Date:  2013-10-16       Impact factor: 16.240

Review 6.  Sequence-based marker development in wheat: advances and applications to breeding.

Authors:  Etienne Paux; Pierre Sourdille; Ian Mackay; Catherine Feuillet
Journal:  Biotechnol Adv       Date:  2011-10-01       Impact factor: 14.227

7.  Development and mapping of SNP assays in allotetraploid cotton.

Authors:  Robert L Byers; David B Harker; Scott M Yourstone; Peter J Maughan; Joshua A Udall
Journal:  Theor Appl Genet       Date:  2012-01-18       Impact factor: 5.699

8.  RNA-Seq identifies SNP markers for growth traits in rainbow trout.

Authors:  Mohamed Salem; Roger L Vallejo; Timothy D Leeds; Yniv Palti; Sixin Liu; Annas Sabbagh; Caird E Rexroad; Jianbo Yao
Journal:  PLoS One       Date:  2012-05-04       Impact factor: 3.240

9.  A next-generation sequencing method for genotyping-by-sequencing of highly heterozygous autotetraploid potato.

Authors:  Jan G A M L Uitdewilligen; Anne-Marie A Wolters; Bjorn B D'hoop; Theo J A Borm; Richard G F Visser; Herman J van Eck
Journal:  PLoS One       Date:  2013-05-08       Impact factor: 3.240

10.  Advances towards a Marker-Assisted Selection Breeding Program in Prairie Cordgrass, a Biomass Crop.

Authors:  K R Gedye; J L Gonzalez-Hernandez; V Owens; A Boe
Journal:  Int J Plant Genomics       Date:  2012-11-26
View more
  12 in total

1.  Meiotic pairing as an indicator of genome composition in polyploid prairie cordgrass (Spartina pectinata Link).

Authors:  Jeffrey W Bishop; Sumin Kim; María B Villamil; D K Lee; A Lane Rayburn
Journal:  Genetica       Date:  2017-02-27       Impact factor: 1.082

2.  Fine mapping and candidate gene screening of the downy mildew resistance gene RPF1 in Spinach.

Authors:  Hongbing She; Wei Qian; Helong Zhang; Zhiyuan Liu; Xiaowu Wang; Jian Wu; Chunda Feng; James C Correll; Zhaosheng Xu
Journal:  Theor Appl Genet       Date:  2018-09-22       Impact factor: 5.699

3.  Advantages of Amplifluor-like SNP markers over KASP in plant genotyping.

Authors:  Satyvaldy Jatayev; Akhylbek Kurishbayev; Lyudmila Zotova; Gulmira Khasanova; Dauren Serikbay; Askar Zhubatkanov; Makpal Botayeva; Aibek Zhumalin; Arysgul Turbekova; Kathleen Soole; Peter Langridge; Yuri Shavrukov
Journal:  BMC Plant Biol       Date:  2017-12-28       Impact factor: 4.215

4.  An RNA Sequencing Transcriptome Analysis of Grasspea (Lathyrus sativus L.) and Development of SSR and KASP Markers.

Authors:  Xiaopeng Hao; Tao Yang; Rong Liu; Jinguo Hu; Yang Yao; Marina Burlyaeva; Yan Wang; Guixing Ren; Hongyan Zhang; Dong Wang; Jianwu Chang; Xuxiao Zong
Journal:  Front Plant Sci       Date:  2017-10-31       Impact factor: 5.753

5.  Single nucleotide polymorphisms associated with postoperative inadequate analgesia after single-port VATS in Chinese population.

Authors:  Xiufang Xing; Yongyu Bai; Kai Sun; Min Yan
Journal:  BMC Anesthesiol       Date:  2020-02-05       Impact factor: 2.217

6.  Novel bioassay to assess antibiotic effects of fungal endophytes on aphids.

Authors:  Nicholas Paul Collinson; Ross Cameron Mann; Khageswor Giri; Mallik Malipatil; Jatinder Kaur; German Spangenberg; Isabel Valenzuela
Journal:  PLoS One       Date:  2020-02-10       Impact factor: 3.240

7.  Introgression of Maize Lethal Necrosis Resistance Quantitative Trait Loci Into Susceptible Maize Populations and Validation of the Resistance Under Field Conditions in Naivasha, Kenya.

Authors:  Luka A O Awata; Beatrice E Ifie; Eric Danquah; MacDonald Bright Jumbo; L Mahabaleswara Suresh; Manje Gowda; Philip W Marchelo-Dragga; Michael Scott Olsen; Oluwaseyi Shorinola; Nasser Kouadio Yao; Prasanna M Boddupalli; Pangirayi B Tongoona
Journal:  Front Plant Sci       Date:  2021-05-03       Impact factor: 5.753

8.  Quantitative trait loci (QTL) analysis of leaf related traits in spinach (Spinacia oleracea L.).

Authors:  Zhiyuan Liu; Hongbing She; Zhaosheng Xu; Helong Zhang; Guoliang Li; Shifan Zhang; Wei Qian
Journal:  BMC Plant Biol       Date:  2021-06-24       Impact factor: 4.215

9.  Identification of SNP and SSR Markers in Finger Millet Using Next Generation Sequencing Technologies.

Authors:  Davis Gimode; Damaris A Odeny; Etienne P de Villiers; Solomon Wanyonyi; Mathews M Dida; Emmarold E Mneney; Alice Muchugi; Jesse Machuka; Santie M de Villiers
Journal:  PLoS One       Date:  2016-07-25       Impact factor: 3.240

10.  Genetic characterization of indigenous goat breeds in Romania and Hungary with a special focus on genetic resistance to mastitis and gastrointestinal parasitism based on 40 SNPs.

Authors:  Daniela Elena Ilie; Szilvia Kusza; Maria Sauer; Dinu Gavojdian
Journal:  PLoS One       Date:  2018-05-09       Impact factor: 3.240

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.