Literature DB >> 26822030

Exome sequencing identifies a mutation in TMC1 as a novel cause of autosomal recessive nonsyndromic hearing loss.

Jiongjiong Hu1, Fei Liu2, Wenjun Xia3, Lili Hao4, Jun Lan5, Zhenghua Zhu6, Jing Ye7, Duan Ma8,9, Zhaoxin Ma10.   

Abstract

BACKGROUND: Autosomal recessive non-syndromic hearing loss (ARNSHL) is highly heterogeneous, and mutations in the gene encoding transmembrane channel-like 1 (TMC1) have been implicated in its development. To date, 35 homozygous mutations in TMC1, identified in over 60 families worldwide, have been shown to be associated with ARNSHL. However, few of these mutations were detected in the Chinese population. In this study, we describe a pathogenic missense mutation located in the T5-T6 domain of TMC1 in a three-generation Chinese family with 14 members.
METHODS: Whole exome sequencing was performed using samples from one unaffected individual and two affected individuals to systematically search for deafness susceptibility genes. Candidate mutations and cosegregation of the phenotype were verified by polymerase chain reaction and Sanger sequencing in all of the family members.
RESULTS: We identified a novel TMC1 mutation in exon 20, c.1979C>T, p.P660L, which segregated with prelingual autosomal recessive sensorineural hearing loss.
CONCLUSIONS: We found a new missense mutation in the T5-T6 domain of TMC1, which is highly conserved in many species. These data support the potential conserved role of p.P660L in human TMC1 function.

Entities:  

Mesh:

Substances:

Year:  2016        PMID: 26822030      PMCID: PMC4731951          DOI: 10.1186/s12967-016-0780-5

Source DB:  PubMed          Journal:  J Transl Med        ISSN: 1479-5876            Impact factor:   5.531


Background

Hearing loss (HL) is one of the most prevalent human birth defects, affecting one in 1000 individuals. Most congenital cases of HL have a genetic etiology, and nonsyndromic hearing loss (NSHL) accounts for approximately 80 % of genetic deafness [1]. To date, a total of 87 NSHL genes have been identified (http://hereditaryhearingloss.org), and most hearing impairments originating from these gene mutations are inherited in an autosomal recessive pattern. Genetic HL exhibits marked heterogeneity, which can be explained by the complexity of auditory system [2]. The proteins encoded by the identified deafness genes are involved in different functions, including gene regulation, embryonic development, ionic and osmotic homeostasis, synaptic transmission, generation of endocochlear potential, hair cell bundle morphology, and mechano-electrical transduction (MET) [3]. The gene encoding transmembrane channel-like 1 (TMC1) has been implicated in the pathogenesis of both dominant and recessive nonsyndromic HL, DFNA36 and DFNB7/11, respectively [4]. Although TMC1 is expressed in cochlear hair cells and is involved in hair-cell function [5], the expression and function of the TMC1 protein in the inner ear are unclear. Deafness (dn) and Beethoven (Bth) mutant mice carrying recessive (Tmc1dn) and dominant (Tmc1Mhdabth) TMC1 mutations show several physiological deficits in hair cell maturation, and recent studies have indicated that hair cells from Tmc1-knockout mice lack mechanosensory potential [5]. Chatzigeorgiou et al. [6] demonstrated that TMC1 from Caenorhabditis elegans encodes a sodium-sensitive ion channel; however, this study lacked a mutant control, and the observations presented in this study have not been replicated for vertebrate TMC1. Another study found that TMC1 is a component of hair cell transduction channels [7], although these results are controversial. Taken together, the results of many studies have supported that TMC1 expression is required for conventional mechanotransduction in auditory and vestibular hair cells [7-9]. To date, 35 homozygous mutations in TMC1, identified in 60 families worldwide, have been shown to be associated with ARNSHL (Additional file 1: Table S1). However, these mutations have rarely been found in the Chinese population [2]. Almost all reported recessive cases have been shown to exhibit a similar phenotype characterized by prelingual severe-to-profound HL [3]. The most common recessive mutation in TMC1 reported to affect HL is the nonsense mutation p.R34X, which accounts for over 30 % of mutant alleles of TMC1 in Asian and North African populations [10]. In this study, we identified a novel homozygous mutation in TMC1 located in exon 20, c.1979C>T, p.P660L in a three-generation, 14-member family (SH-02) presenting segregating ARNSHL with whole exome sequencing (WES). We further sequenced 500 ethnically unrelated healthy individuals and 300 sporadic deafness cases; none of these individuals carried the P660L mutation. Therefore, we concluded that the HL in this family was caused by novel homozygous mutation in TMC1.

Methods

Family recruitment and clinical evaluations

A three-generation, non-consanguineous 14-member family (SH-02) presenting with segregating ARNSHL was identified by the Department of Otolaryngology, Head and Neck Surgery of Shanghai East Hospital, Tongji University, Shanghai, China (Fig. 1). All clinical information was collected at the Department of Otolaryngology and Head and Neck Surgery, Shanghai East Hospital, Tongji University, Shanghai, China. Medical histories were obtained using a questionnaire covering the following issues: subjective degree of HL, age at onset, progression, symmetry of hearing impairment, use of hearing aids, presence of tinnitus and vertigo, medication, noise and ototoxic drug exposure, pathological changes in the ear, and other relevant clinical manifestations. Systemic medical examinations and approximate intelligence assessments were also performed for all affected individuals. Another 300 individuals with sporadic HL participated in this study, in addition to 500 ethnically matched healthy controls. All procedures were approved by the Ethics Committee of Shanghai East Hospital, which is associated with Tongji University, and were carried out only after written informed consent had been obtained from all study participants and from the parents of participants younger than 18 years of age. Participants were informed that all data collected would be used only for scientific research and not for any commercial purposes.
Fig. 1

Pedigree of the Chinese family SH-02 with nonsyndromic autosomal recessive SNHL. Open symbols denote unaffected individuals; filled black symbols denote affected individuals. The arrow indicates the proband

Pedigree of the Chinese family SH-02 with nonsyndromic autosomal recessive SNHL. Open symbols denote unaffected individuals; filled black symbols denote affected individuals. The arrow indicates the proband

Audiological tests and imaging studies

Audiological tests were performed in a standard anechoic chamber with a pure-tone audiometer (Interacoustics AD229b; Interacoustics A/S DK-5610 Assens, Denmark) at frequencies ranging from 250 to 8000 Hz. Using an acoustic emmittance measurement apparatus (Interacoustics AT235h; Interacoustics A/S DK-5610 Assens), auditory brainstem response (ABR) was recorded ipsilaterally in response to click stimuli presented at 100 dBnHL (Interacoustics Eclipse EP2; Interacoustics A/S DK-5610 Assens). Additionally, a distortion product otoacoustic emissions system (DPOAE; 2f1–f2; Interacoustics DPOAE20 + TEb; Interacoustics A/S DK-5610 Assens Denmark) was used, where f2/f1 = 1.22; the level for f1 was 65 dB SPL, and the level for f2 was 50 dB SPL (DP S/N: 5 dB SPL). Ear endoscopy, computed tomography (CT) scans, and magnetic resonance imaging (MRI) were used to exclude deafness caused by anatomical abnormalities of the middle and inner ear.

Whole exome sequencing

Genomic DNA was extracted from whole blood samples using a blood DNA kit (Qiagen, Germany), and 1 μg of purified gDNA was fragmented to 200 bp. End repair, adenylation, and adapter ligation were performed for library preparation according to the Illumina protocol. TruSeq DNA LT/HT Sample Prep Kit and TruSeq Exome Enrichment Kit were used to enrich exomes. Equal amounts of library samples were pooled and then hybridized to the customized capture array, including exons, splicing sites, and immediate flanking intron sequences. Sequencing was performed on an Illumina HiSeq 2500 to generate paired end reads. Reads that aligned to exon regions were collected for mutation identification and subsequent analysis. Samtools mpileup was used for variant calling and to identify SNPs and indels. ANNOVAR was used for annotating the genes.

Sanger sequencing

Samples from all available members from the SH-02 family were subjected to Sanger sequencing to determine whether the potential mutations in causative genes, particularly the homozygous mutation in TMC1, cosegregated with the disease phenotype in this family. The polymerase chain reaction (PCR) products were sequenced using BigDye Terminator v3.1 Cycle Sequencing Kits (Applied Biosystems, Foster City, CA, USA) and analyzed using an ABI 3700XL Genetic Analyzer. And the primers for the TMC1 sequencing were as follows: TMC1-Forward: AGGATGGGCTCCTTCTTTGC; TMC1-Reverse: ACGAGGTTTCACCGTGTTGG.

In silico analysis

In the present study, we used SIFT [11], Polyphen2 [12], and MutationTaster [13] software to determine possible changes in the protein structure that may affect the phenotype. Clustal X1.83 software was used to compare the human wild-type TMC1 protein sequence with orthologs from Mus musculus, Physeter catodon, Macaca fiscicularis, Ailuropoda melanoleuca, Octodon degus, and Lipotes vexillifer and to examine evolutionary conservation and structural prediction for this protein. Sequences were obtained from http://www.ensembl.org/.

Results

Clinical description

The proband and his sister were congenital deaf-mute, while all their parents and grandparents had normal auditory and verbal functions. The two patients were delivered full-term after normal deliveries, and none of the parents had any history of constant exposure to noise or ototoxic drugs or a history of serious infection during pregnancy. Bone and air conduction of pure tone audiometry displayed no auditory reaction at any frequency. Tympanometry indicated a type A curve for the tympanogram, demonstrating that the tympanic cavity exhibited normal function, and acoustic reflex could not be induced in either ear (the threshold of the acoustic reflex was 100 dBHL; Fig. 2a). Otoacoustic emission could not be induced at any frequency. Upon ABR examination, well-differentiated wave profiles and regular latency could not be induced by click stimuli presented at 100 dBnHL in both ears, indicating that there was no effective acoustic information generated or sent to the brain by mechanosensory hair cells in the organ of Corti. CT scans and MRI data indicated that the mastoid process, cochlea, internal auditory meatus, and membranous labyrinth were all well developed, as was the ossicular chain (Fig. 2b, c). Clinical and instrumental evaluations did not reveal any evidence of syndromic features, such as cardiovascular diseases, diabetes, visual problems, or neurological disorders. The younger brother and his elder sister both displayed normal intelligence (Table 1).
Fig. 2

The SH-02 audiometric phenotype. a Pure-tone bone and air conduction thresholds are presented for the right ears of SH-02 family patients. b Based on the CT scan and MRI data of the proband (III5) and his sister (III4), the mastoid process and cochlea were well developed, and the ossicular chain was intact. Additionally, both the internal auditory meatus and the membranous labyrinth were well developed

Table 1

Summary of the audiological features of affected members of family SH-02

PatientGenderAge (years)Use of aminoglycosideHearing test dBHL (PTA)Verbal functionLevel of hearing impairmentVertigoTinnitusIntelligence
At testingAt onsetLeft earRight ear
III-4Female35On birthNoNullNullNullAnacusiaNoNoNormal
III-5Male31On birthNoNullNullNullAnacusiaNoNoNormal
The SH-02 audiometric phenotype. a Pure-tone bone and air conduction thresholds are presented for the right ears of SH-02 family patients. b Based on the CT scan and MRI data of the proband (III5) and his sister (III4), the mastoid process and cochlea were well developed, and the ossicular chain was intact. Additionally, both the internal auditory meatus and the membranous labyrinth were well developed Summary of the audiological features of affected members of family SH-02 To systematically search for deafness susceptibility genes, we performed WES of samples from one unaffected (II-3) and two affected (III-4 and III-5) individuals from the SH-02 family pedigree. An average of 4.67 billion bases of high-quality sequence was generated per individual, with an average sequencing depth of approximately 97 in the target region; this satisfied the requirements for calling single nucleotide polymorphisms (SNPs) and indels. The sequencing data were aligned to the NCBI human reference genome and compared with dbSNP138, which contains pilot data from the 1000 Genomes Project, from eight sequenced HapMap individuals and from ten individuals in the YH database. In total, 7898 variants were identified in the two patients; 5760 of these were nonsynonymous variants, including splice acceptor and donor site mutations and coding indels, which were more likely to be pathogenic mutations. Next, these variants were prioritized for further evaluation using two filtering criteria: (1) variants within the allele frequency cutoff (less than 0.01 in the dbSNP138, HapMap, 1000 Genomes, and local datasets); and (2) variant found in all the affected individuals but not in the unaffected individual; variants meeting these criteria were retained for further analysis. These filtering criteria reduced the list of candidate variants to 25 nonsynonymous homozygous variations. Then, we screened 25 variations found among the pedigree samples by Sanger sequencing and found a missense variant, c.1979C>T, p.P660L, in exon 20 of TMC1 [NM_138691, (MIM#600974)], which co-segregated with the disease (Fig. 3a). This novel TMC1 mutation was exclusively identified in all two affected patients but was not found in the 12 unaffected family members. To assess the possibility that P660L is a disease-causing mutation, we further sequenced 500 ethnically unrelated healthy individuals and 300 sporadic deafness cases, and confirmed that none of these people carried the P660L mutation. Thus, our data suggested that P660L was a disease-causing mutation in the Chinese pedigree (SH-02) with NSHL.
Fig. 3

Mutation analysis of the Chinese family SH-02. a DNA sequences of homozygous missense c.1979C>T mutations and the wild-type control. b The structure of TMC1A depicts the position of c.1979C>T, a mutation in exon 20 and p.P660L in TM2 domain

Mutation analysis of the Chinese family SH-02. a DNA sequences of homozygous missense c.1979C>T mutations and the wild-type control. b The structure of TMC1A depicts the position of c.1979C>T, a mutation in exon 20 and p.P660L in TM2 domain To determine the potential effects of the p.P660L missense mutation on TMC1 function, we further performed in silico analyses. This mutation was predicted to be “Damaging”, “Probably Damaging”, and “Disease-causing” by SIFT, Polyphen2, and MutationTaster, respectively (Table 2). The conservation analysis indicated that the Pro residue at 660 in the TMC1 protein was conserved across Homo sapiens, Mus musculus, Physeter catodon, Macaca fiscicularis, Ailuropoda melanoleuca, Octodon degus, and Lipotes vexillifer (Fig. 3b). This finding indicated that this novel mutation may be the cause of the observed HL in this Chinese family.
Table 2

A novel variant in the proband of family SH-02

GeneMIM no.NucleotideAmino acidZygosityPrediction information
TMC1 138691c.1979C>Tp.P660LHomSIFTPolyphen2MutationTaster
DamagingProbably damagingDisease causing
A novel variant in the proband of family SH-02

Discussion

The World Health Organization has estimated that 360 million people worldwide have disabling HL (http://www.who.int/mediacentre/factsheets/fs300/en/) and that as the population ages, the global burden of diseases attributable to deafness will increase [14]. Linkage analysis was once regarded as the most powerful and widely used method for linking critical intervals to identify disease-causing genes in large pedigrees; however, this method is not appropriate for small families. Recently, with the marked advancements in sequencing technology, WES, which involves targeted sequencing of the protein-coding subset of the human genome, has been used as a convenient, rapid method for identification of new genes. Next-generation sequencing has advantages of small samples quantity, minimal cost, high-throughput sequencing, and low requirement for family size [15]. In this study, WES was used to find the disease-causing gene of a Chinese family with HL, and we identified a novel TMC1 missense mutation in exon 20, c.1979C>T, p.P660L. TMC1 on chromosome 9q21 contains 24 exons that make up a coding region of 2283 nucleotides. The gene sequence is highly conserved, which suggests strong selective pressure throughout animal evolution. Mutations in TMC1 are a common cause of autosomal recessive nonsyndromic deafness, particularly in India, Pakistani, Turkish, and Tunisian families [2]. Thirty-five reported homozygous recessive mutations in TMC1, found in over 60 families worldwide, have been identified in different parts of TMC1 and cause different structural and functional disparity in intracellular and extracellular domains (Fig. 4).
Fig. 4

Location of the p.P660L mutation and other reported exonic mutations in TMC1. The red rhombus represents a missense or nonsense mutation; the green triangle represents a deletion mutation; and the green arrow/yellow star represents the p.P660L mutation located within a predicted third extracellular loop found between the fifth and sixth transmembrane domains

Location of the p.P660L mutation and other reported exonic mutations in TMC1. The red rhombus represents a missense or nonsense mutation; the green triangle represents a deletion mutation; and the green arrow/yellow star represents the p.P660L mutation located within a predicted third extracellular loop found between the fifth and sixth transmembrane domains TMC1 topology is predicted to include six membrane-spanning domains with three extracellular loops, a large intracellular loop settled between transmembrane (TM) domains four and five, a long intracellular N-terminus, and a short intracellular C-terminus. The structure suggests that the protein may function as a receptor, transporter, pump, or channel [16]. The mutation found in this study, p.P660L, was located within a predicted third extracellular loop situated between the fifth and sixth TM domains (Fig. 4). Pro660 is located in a highly conserved glycosyltransferase domain, which is highly conserved among many species. To the best of our knowledge, this is the first report describing a missense mutation in the glycosyltransferase domain of TMC1, supporting the importance of the conserved role of P660L in human TMC1 function. TMC1 expression is constant in mature cochlear and vestibular hair cells, as shown in dn and Bth mutant mice carrying recessive (Tmc1dn) and dominant (Tmc1bth) TMC1 alleles. In the DFNA36 models, heterozygous mice (Tmc1) showed progressive hair cell degeneration [17], while homozygous mice (Tmc1) exhibited profound deafness [5]. Models of human recessive deafness, i.e., DFNB7/11, TMC1 mice, do not have cochlear responses to sound stimuli and show several physiological deficits in hair cell maturation [5]. Kim et al. [9] concluded that TMC1/2 double mutant mice lacked conventional mechanotransduction, leading them to hypothesize that TMC1 is required for targeting the MET channel to the tips of the stereocilia, where they can interact with other constituents of the transduction complex, including the tip link. Although the specific function of TMC1 is unknown, recent studies have revealed that TMC1 is necessary for MET in cochlear and vestibular hair cells. Additionally, TMC1 is thought to be a component of the mechanotransduction channel in hair cells of the mammalian inner ear [3]. Caenorhabditis eleganstmc1 has been shown to encode a sodium-sensitive ion channel. The predicted structure of TMC1 is similar to that of the α-subunit of voltage-dependent K+ channels, which have six TM segments and intracellular N- and C-termini [18], and TMC1 has been predicted to function as an ion channel or transporter mediating K+ homeostasis in the inner ear [19]. Ion channels serve many functions, including the transport of ions and water, control of electrical excitability, and regulation of ion homeostasis. The first four TM domains of the K+ channel α-subunit act as voltage sensors for activation gating [20], whereas the intervening segment between TM5 and TM6 appears to confer channel function [18]. TMC1 c.1979C>T, p.P660L is located in a predicted third extracellular loop located extracellularly between TM5 and TM6, and mutations in this loop may affect ion channel function in hair cells.

Conclusion

In this report, we described a novel missense mutation in the highly conserved T5–T6 domain of TMC1, suggesting the potentially conserved role of Pro660 in the human amino acid sequence. This is only the second homozygous mutation in TMC1 reported in the Chinese population. Moreover, this novel mutation expands the mutational spectrum of TMC1, which will contribute to the clinical understanding of HL caused by mutations in this gene.
  20 in total

Review 1.  Structure and function of voltage-dependent ion channel regulatory beta subunits.

Authors:  M R Hanlon; B A Wallace
Journal:  Biochemistry       Date:  2002-03-05       Impact factor: 3.162

2.  SIFT: Predicting amino acid changes that affect protein function.

Authors:  Pauline C Ng; Steven Henikoff
Journal:  Nucleic Acids Res       Date:  2003-07-01       Impact factor: 16.971

3.  MutationTaster evaluates disease-causing potential of sequence alterations.

Authors:  Jana Marie Schwarz; Christian Rödelsperger; Markus Schuelke; Dominik Seelow
Journal:  Nat Methods       Date:  2010-08       Impact factor: 28.547

4.  Tmc1 is necessary for normal functional maturation and survival of inner and outer hair cells in the mouse cochlea.

Authors:  Walter Marcotti; Alexandra Erven; Stuart L Johnson; Karen P Steel; Corné J Kros
Journal:  J Physiol       Date:  2006-04-20       Impact factor: 5.182

5.  High frequency of the p.R34X mutation in the TMC1 gene associated with nonsyndromic hearing loss is due to founder effects.

Authors:  Mariem Ben Saïd; Mounira Hmani-Aifa; Imen Amar; Shahid Mahmood Baig; Mirna Mustapha; Sedigheh Delmaghani; Abdelaziz Tlili; Abdelmonem Ghorbel; Hammadi Ayadi; Guy Van Camp; Richard J H Smith; Mustafa Tekin; Saber Masmoudi
Journal:  Genet Test Mol Biomarkers       Date:  2010-06

6.  Beethoven, a mouse model for dominant, progressive hearing loss DFNA36.

Authors:  Sarah Vreugde; Alexandra Erven; Corné J Kros; Walter Marcotti; Helmut Fuchs; Kiyoto Kurima; Edward R Wilcox; Thomas B Friedman; Andrew J Griffith; Rudi Balling; Martin Hrabé De Angelis; Karen B Avraham; Karen P Steel
Journal:  Nat Genet       Date:  2002-02-19       Impact factor: 38.330

7.  Dominant and recessive deafness caused by mutations of a novel gene, TMC1, required for cochlear hair-cell function.

Authors:  Kiyoto Kurima; Linda M Peters; Yandan Yang; Saima Riazuddin; Zubair M Ahmed; Sadaf Naz; Deidre Arnaud; Stacy Drury; Jianhong Mo; Tomoko Makishima; Manju Ghosh; P S N Menon; Dilip Deshmukh; Carole Oddoux; Harry Ostrer; Shaheen Khan; Sheikh Riazuddin; Prescott L Deininger; Lori L Hampton; Susan L Sullivan; James F Battey; Bronya J B Keats; Edward R Wilcox; Thomas B Friedman; Andrew J Griffith
Journal:  Nat Genet       Date:  2002-02-19       Impact factor: 38.330

8.  Mutations of TMC1 cause deafness by disrupting mechanoelectrical transduction.

Authors:  Hiroshi Nakanishi; Kiyoto Kurima; Yoshiyuki Kawashima; Andrew J Griffith
Journal:  Auris Nasus Larynx       Date:  2014-06-02       Impact factor: 1.863

9.  TMC and EVER genes belong to a larger novel family, the TMC gene family encoding transmembrane proteins.

Authors:  Gabor Keresztes; Hideki Mutai; Stefan Heller
Journal:  BMC Genomics       Date:  2003-06-17       Impact factor: 3.969

10.  A novel DFNA36 mutation in TMC1 orthologous to the Beethoven (Bth) mouse associated with autosomal dominant hearing loss in a Chinese family.

Authors:  Yali Zhao; Dayong Wang; Liang Zong; Feifan Zhao; Liping Guan; Peng Zhang; Wei Shi; Lan Lan; Hongyang Wang; Qian Li; Bing Han; Ling Yang; Xin Jin; Jian Wang; Jun Wang; Qiuju Wang
Journal:  PLoS One       Date:  2014-05-14       Impact factor: 3.240

View more
  7 in total

Review 1.  Distinct functions of TMC channels: a comparative overview.

Authors:  Xiaomin Yue; Yi Sheng; Lijun Kang; Rui Xiao
Journal:  Cell Mol Life Sci       Date:  2019-10-04       Impact factor: 9.261

Review 2.  Genetics Landscape of Nonsyndromic Hearing Loss in Indian Populations.

Authors:  Manisha Ray; Saurav Sarkar; Mukund Namdev Sable
Journal:  J Pediatr Genet       Date:  2021-12-14

Review 3.  Is TMC1 the Hair Cell Mechanotransducer Channel?

Authors:  Robert Fettiplace
Journal:  Biophys J       Date:  2016-07-12       Impact factor: 4.033

4.  Utilization of amplicon-based targeted sequencing panel for the massively parallel sequencing of sporadic hearing impairment patients from Saudi Arabia.

Authors:  Ashraf Dallol; Kamal Daghistani; Aisha Elaimi; Wissam A Al-Wazani; Afaf Bamanie; Malek Safiah; Samira Sagaty; Layla Taha; Rawabi Zahed; Osama Bajouh; Adeel Gulzar Chaudhary; Mamdooh Abdullah Gari; Rola Turki; Mohammed Hussein Al-Qahtani; Adel Mohammed Abuzenadah
Journal:  BMC Med Genet       Date:  2016-10-10       Impact factor: 2.103

5.  Mutation spectra and founder effect of TMC1 in patients with non-syndromic deafness in Xiamen area, China.

Authors:  Yi Jiang; Song Gao; Lihua Wu; Xiaohua Jin; Tao Deng; Ligang Wang; Shasha Huang; Xue Gao; Juan Chen; Dongyi Han; Huafang Gao; Pu Dai
Journal:  Am J Med Genet B Neuropsychiatr Genet       Date:  2017-11-27       Impact factor: 3.568

6.  Identification of four TMC1 variations in different Chinese families with hereditary hearing loss.

Authors:  Hongyang Wang; Kaiwen Wu; Jing Guan; Ju Yang; Linyi Xie; Fen Xiong; Lan Lan; Dayong Wang; Qiuju Wang
Journal:  Mol Genet Genomic Med       Date:  2018-04-14       Impact factor: 2.183

7.  Identification of Pathogenic Genes of Nonsyndromic Hearing Loss in Uyghur Families Using Massively Parallel DNA Sequencing Technique.

Authors:  Yu Chen; Yu Lu; Pilidong Kuyaxi; Jing Cheng; Juan Zhao; Qi Zhao; Patiguli Musha; Hua Zhang; Huijun Yuan
Journal:  Dis Markers       Date:  2018-03-05       Impact factor: 3.434

  7 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.