Literature DB >> 26821125

Kindlin-2 cooperates with talin to activate integrins and induces cell spreading by directly binding paxillin.

Marina Theodosiou1, Moritz Widmaier1, Ralph T Böttcher1, Emanuel Rognoni1, Maik Veelders1, Mitasha Bharadwaj2, Armin Lambacher1, Katharina Austen1, Daniel J Müller2, Roy Zent3,4, Reinhard Fässler1.   

Abstract

Integrins require an activation step prior to ligand binding and signaling. How talin and kindlin contribute to these events in non-hematopoietic cells is poorly understood. Here we report that fibroblasts lacking either talin or kindlin failed to activate β1 integrins, adhere to fibronectin (FN) or maintain their integrins in a high affinity conformation induced by Mn(2+). Despite compromised integrin activation and adhesion, Mn(2+) enabled talin- but not kindlin-deficient cells to initiate spreading on FN. This isotropic spreading was induced by the ability of kindlin to directly bind paxillin, which in turn bound focal adhesion kinase (FAK) resulting in FAK activation and the formation of lamellipodia. Our findings show that talin and kindlin cooperatively activate integrins leading to FN binding and adhesion, and that kindlin subsequently assembles an essential signaling node at newly formed adhesion sites in a talin-independent manner.

Entities:  

Keywords:  biochemistry; cell biology; cell spreading; focal adhesion; integrin; kindlin; mouse; paxillin; talin

Mesh:

Substances:

Year:  2016        PMID: 26821125      PMCID: PMC4749545          DOI: 10.7554/eLife.10130

Source DB:  PubMed          Journal:  Elife        ISSN: 2050-084X            Impact factor:   8.140


Introduction

Integrins are heterodimeric transmembrane receptors that mediate cell adhesion to the extracellular matrix (ECM) and to other cells (Hynes, 2002). The consequence of integrin-mediated adhesion is the assembly of a large molecular network that induces various signaling pathways, resulting in cell migration, proliferation, survival and differentiation (Winograd-Katz et al., 2014). The quality and strength of integrin signaling is controlled by the interaction between integrins and substrate-attached ligands, which is, in turn, regulated by the on- and off-rates of the integrin–ligand binding process. The on-rate of the integrin–ligand binding reaction (also called integrin activation or inside-out signaling) is characterized by switching the unbound form of integrins from an inactive (low affinity) to an active (high affinity) conformation. The affinity switch proceeds from a bent and clasped low affinity conformation to an extended and unclasped high affinity conformation with an open ligand-binding pocket (Askari et al., 2010; Springer and Dustin, 2012). This change in affinity is believed to be induced through the binding of talin and kindlin to the β integrin cytoplasmic domain (Moser et al., 2009; Shattil et al., 2010) and divalent cations to distinct sites close to the ligand-binding pocket (Gailit and Ruoslahti, 1988; Mould et al., 1995; Xia and Springer, 2014; Mould et al., 2003). The stabilisation of integrin–ligand complexes is mediated by integrin clustering and catch bond formation between integrin and bound ligand. The stabilizing effect of clustered integrins is achieved by the ability of dissociated integrin–ligand complexes to rebind before they leave the adhesion site (van Kooyk and Figdor, 2000; Roca-Cusachs et al., 2009), while catch bonds are receptor–ligand bonds whose lifetime increases with mechanical force (Kong et al., 2009; Chen et al., 2010; Kong et al., 2013). Both mechanisms extend the duration and increase the strength of integrin-mediated adhesion and signaling (also called outside-in signaling) (Koo et al., 2002; van Kooyk and Figdor, 2000; Maheshwari et al., 2000; Roca-Cusachs et al., 2009; Coussen et al., 2002), and depend on the association of integrins with the actin cytoskeleton via talin (Roca-Cusachs et al., 2009; Friedland et al., 2009), and probably kindlin (Ye et al., 2013). The talin family consists of two (talin-1 and -2) and the kindlin family of three isoforms (kindlin-1-3), which show tissue-specific expression patterns (Calderwood et al., 2013; Moser et al., 2009; Shattil et al., 2010). The majority of studies that defined integrin affinity regulation by talin and kindlin were performed on αIIbβ3 and β2-class integrins expressed by platelets and leukocytes, respectively. These cells circulate in the blood and hold their integrins in an inactive state until they encounter soluble or membrane-bound agonists (Evans et al., 2009, Bennett, 2005). The prevailing view is that agonist-induced signaling pathways activate talin-1 and the hematopoietic cell-specific kindlin-3, which cooperate to induce integrin activation (Moser et al., 2008; Han et al., 2006) and clustering (Cluzel et al., 2005; Ye et al., 2013). Integrin affinity regulation in non-hematopoietic cells such as fibroblasts and epithelial cells is poorly understood. It is not known how integrin activation is induced on these cells (no integrin-activating agonists have been identified) and it is also controversial whether talin and kindlin are required to shift their integrins into the high affinity state. While there are reports showing that talin and kindlin are required for integrin activation in epithelial cells (Montanez et al., 2008; Margadant et al., 2012), it was also shown that in myoblasts and mammary epithelial cells activation of β1 integrins, adhesion and spreading on multiple ECM substrates can proceed in the absence of talin (Conti et al., 2009; Wang et al., 2011). Likewise, it was reported that focal adhesion kinase (FAK)-deficient fibroblasts develop small, nascent adhesions (NAs) at the edge of membrane protrusions without visible talin and that integrins carrying a mutation in the talin-binding site can still nucleate and stabilize NAs (Lawson et al., 2012). Also fibroblasts lacking talin-1 and -2 were shown to adhere to fibronectin (FN) and initiate isotropic spreading (Zhang et al., 2008). Another intriguing study demonstrated that overexpression of kindlin-2 in Chinese hamster ovary (CHO) cells inhibits rather than promotes talin head-induced α5β1 integrin activation (Harburger et al., 2009). Given the fundamental importance of talin and kindlin for integrin activation in hematopoietic cells, the findings of these studies are unexpected and imply that either integrin affinity regulation is substantially different in fibroblasts and epithelial cells or the experimental approaches used to manipulate protein expression and localization were imperfect. To directly evaluate the functions of talin and kindlins for FN-binding integrins on fibroblasts, we used a genetic approach and derived fibroblasts from mice lacking either the Tln1 and -2 or the Fermt1 and -2 genes. We show that integrin affinity regulation depends on both talin and kindlin, and that kindlin has the additional function of triggering cell spreading by binding directly to paxillin in a talin-independent manner.

Results

Kindlins and talins control cell morphology, adhesion and integrin expression

To obtain cells lacking the expression of talin-1 and kindlin-2, we intercrossed mice carrying loxP flanked (floxed; fl) Tln1 or Fermt2 alleles (Figure 1A), isolated kidney fibroblasts and immortalized them with the SV40 large T antigen (parental fibroblasts). The floxed alleles were deleted by adenoviral Cre recombinase transduction resulting in T1Ko and K2Ko fibroblasts. Loss of talin-1 or kindlin-2 expression in fibroblasts was compensated by talin-2 or the de novo expression of kindlin-1, respectively, allowing adhesion and spreading, although to a lesser extent compared with control cells (Figure 1—figure supplement 1A,B). To prevent this compensation, we generated mice with floxed Tln1 and nullizygous Tln2 alleles or with floxed Fermt1 and -2 alleles (TlnCtr; KindCtr) from which we isolated, immortalized and cloned kidney fibroblasts with comparable integrin surface levels (Figure 1A and Figure 1—figure supplement 2). The floxed alleles were deleted by transducing Cre resulting in talin-1, -2 (TlnKo) and kindlin-1, -2 (KindKo) deficient cells, respectively (Figure 1A–C). Since the TlnCtr and KindCtr control cells showed similar morphologies and behaviour in our experiments, we display one control cell line in several result panels. Cre-mediated deletion of the floxed Tln1 or floxed Fermt1/2 genes was efficient (Figure 1B) and resulted in cell rounding, weak adhesion of a few cells, and reduced cell proliferation despite the immortalisation with the oncogenic large T antigen (Figure 1C and Figure 1—figure supplement 3). To minimize cell passage-induced abnormalities, we used cells only up to 12 passages after Cre-mediated gene deletions.
Figure 1.

Kindlin and talin are required for integrin-mediated cell adhesion.

() Scheme showing gene loci before and after ablation of the Tln1, -2 and Fermt1, -2 genes. Orange diamonds indicate loxP sites and rectangles exons; untranslated regions are marked grey. () Western blot of TlnKo and KindKo cells. Keratinocyte lysates (Kerat.) served to control kindlin-1 expression. () Bright field images of TlnCtr, KindCtr, TlnKo and KindKo cells. () Quantification of cell adhesion on indicated substrates 30 min after seeding by counting DAPI stained cells; n=3 independent experiments, error bars indicate standard error of the mean; t-test significances are calculated between untreated TlnKo or KindKo cells and the corresponding TlnCtr and KindCtr or Mn2+-treated TlnKo or KindKo cell lines on same substrates; only significant differences are shown. () Quantification of Mn2+-stimulated cell adhesion for indicated times on FN; cells were quantified by absorbance measurement of crystal violet staining; n=3 independent experiments; lines represent sigmoidal curve fit; error bars indicate standard deviation; significances for indicated pairs after 2.5 min were calculated by two-tailed t-test and significances for indicated pairs of the overall kinetics were calculated by two-way RM ANOVA. Bar, 10 µm. COL, collagen; DAPI, 4',6-diamidino-2-phenylindole; FN, fibronectin; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; LN, laminin-111; RM ANOVA, repeated measures analysis of variance; VN, vitronectin.

DOI: http://dx.doi.org/10.7554/eLife.10130.003

() Western blots showing talin-2 expression in floxed talin-1 (T1F) and T1Ko fibroblasts and de novo expression of the Fermt1 gene in kindlin-2-null (K2Ko) fibroblasts. Keratinocytes (Kerat.) expressing high levels of kindlin-1 served as control for the anti-kindlin-1 antibody. GAPDH served as loading control. () Talin-1- and kindlin-2-deficient fibroblasts partially spread (bright field imaging, left panels) and form paxillin-positive adhesion sites (immunostaining, right panels). Bars, 10 µm. GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

DOI: http://dx.doi.org/10.7554/eLife.10130.004

Cell surface expression of different integrin subunits on TlnCtr and KindCtr cells was measured by flow cytometry and presented as histograms. Fluorescence-activated cell sorting histograms of cells lacking expression of all integrins (pKO) served as negative control and are shown in grey.

DOI: http://dx.doi.org/10.7554/eLife.10130.005

TlnKo and KindKo cells show a significantly reduced increase in cell numbers, which were determined by cell counting at indicated time points (error bars indicate standard deviation; significances are given for indicated pairs and were calculated by two-way ANOVA). ANOVA, analysis of variance.

DOI: http://dx.doi.org/10.7554/eLife.10130.006

Cell adhesion was measured 20 min after seeding the indicated cell lines on plastic surfaces coated with the indicated FN concentrations. Cells were PFA fixed and quantified by absorbance measurement of crystal violet staining (n=3 independent experiments; lines represent hyperbolic curve fits; error bars indicate standard deviation; significances for indicated pairs of the overall kinetics were calculated by two-way RM ANOVA). FN, fibronectin, PFA, paraformaldehyde; RM ANOVA, repeated measures analysis of variance.

DOI: http://dx.doi.org/10.7554/eLife.10130.007

Figure 1—figure supplement 1.

Talin-1- and kindlin-2-deficient fibroblasts.

() Western blots showing talin-2 expression in floxed talin-1 (T1F) and T1Ko fibroblasts and de novo expression of the Fermt1 gene in kindlin-2-null (K2Ko) fibroblasts. Keratinocytes (Kerat.) expressing high levels of kindlin-1 served as control for the anti-kindlin-1 antibody. GAPDH served as loading control. () Talin-1- and kindlin-2-deficient fibroblasts partially spread (bright field imaging, left panels) and form paxillin-positive adhesion sites (immunostaining, right panels). Bars, 10 µm. GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

DOI: http://dx.doi.org/10.7554/eLife.10130.004

Figure 1—figure supplement 2.

Integrin expression profiles of TlnCtr and KindCtr cells.

Cell surface expression of different integrin subunits on TlnCtr and KindCtr cells was measured by flow cytometry and presented as histograms. Fluorescence-activated cell sorting histograms of cells lacking expression of all integrins (pKO) served as negative control and are shown in grey.

DOI: http://dx.doi.org/10.7554/eLife.10130.005

Figure 1—figure supplement 3.

Cell proliferation of TlnKo and KindKo cells.

TlnKo and KindKo cells show a significantly reduced increase in cell numbers, which were determined by cell counting at indicated time points (error bars indicate standard deviation; significances are given for indicated pairs and were calculated by two-way ANOVA). ANOVA, analysis of variance.

DOI: http://dx.doi.org/10.7554/eLife.10130.006

Kindlin and talin are required for integrin-mediated cell adhesion.

() Scheme showing gene loci before and after ablation of the Tln1, -2 and Fermt1, -2 genes. Orange diamonds indicate loxP sites and rectangles exons; untranslated regions are marked grey. () Western blot of TlnKo and KindKo cells. Keratinocyte lysates (Kerat.) served to control kindlin-1 expression. () Bright field images of TlnCtr, KindCtr, TlnKo and KindKo cells. () Quantification of cell adhesion on indicated substrates 30 min after seeding by counting DAPI stained cells; n=3 independent experiments, error bars indicate standard error of the mean; t-test significances are calculated between untreated TlnKo or KindKo cells and the corresponding TlnCtr and KindCtr or Mn2+-treated TlnKo or KindKo cell lines on same substrates; only significant differences are shown. () Quantification of Mn2+-stimulated cell adhesion for indicated times on FN; cells were quantified by absorbance measurement of crystal violet staining; n=3 independent experiments; lines represent sigmoidal curve fit; error bars indicate standard deviation; significances for indicated pairs after 2.5 min were calculated by two-tailed t-test and significances for indicated pairs of the overall kinetics were calculated by two-way RM ANOVA. Bar, 10 µm. COL, collagen; DAPI, 4',6-diamidino-2-phenylindole; FN, fibronectin; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; LN, laminin-111; RM ANOVA, repeated measures analysis of variance; VN, vitronectin. DOI: http://dx.doi.org/10.7554/eLife.10130.003

Talin-1- and kindlin-2-deficient fibroblasts.

() Western blots showing talin-2 expression in floxed talin-1 (T1F) and T1Ko fibroblasts and de novo expression of the Fermt1 gene in kindlin-2-null (K2Ko) fibroblasts. Keratinocytes (Kerat.) expressing high levels of kindlin-1 served as control for the anti-kindlin-1 antibody. GAPDH served as loading control. () Talin-1- and kindlin-2-deficient fibroblasts partially spread (bright field imaging, left panels) and form paxillin-positive adhesion sites (immunostaining, right panels). Bars, 10 µm. GAPDH, glyceraldehyde-3-phosphate dehydrogenase. DOI: http://dx.doi.org/10.7554/eLife.10130.004

Integrin expression profiles of TlnCtr and KindCtr cells.

Cell surface expression of different integrin subunits on TlnCtr and KindCtr cells was measured by flow cytometry and presented as histograms. Fluorescence-activated cell sorting histograms of cells lacking expression of all integrins (pKO) served as negative control and are shown in grey. DOI: http://dx.doi.org/10.7554/eLife.10130.005

Cell proliferation of TlnKo and KindKo cells.

TlnKo and KindKo cells show a significantly reduced increase in cell numbers, which were determined by cell counting at indicated time points (error bars indicate standard deviation; significances are given for indicated pairs and were calculated by two-way ANOVA). ANOVA, analysis of variance. DOI: http://dx.doi.org/10.7554/eLife.10130.006

Cell adhesion of TlnKo and KindKo cells on different FN concentrations.

Cell adhesion was measured 20 min after seeding the indicated cell lines on plastic surfaces coated with the indicated FN concentrations. Cells were PFA fixed and quantified by absorbance measurement of crystal violet staining (n=3 independent experiments; lines represent hyperbolic curve fits; error bars indicate standard deviation; significances for indicated pairs of the overall kinetics were calculated by two-way RM ANOVA). FN, fibronectin, PFA, paraformaldehyde; RM ANOVA, repeated measures analysis of variance. DOI: http://dx.doi.org/10.7554/eLife.10130.007 To define the adhesion defect, we performed plate and wash assays for 30 min on defined substrates and found that neither TlnKo nor KindKo cells adhered to FN, laminin-111 (LN), type I collagen (COL) and vitronectin (VN) (Figure 1D). To test whether the inability of TlnKo and KindKo cells to adhere to ECM proteins is due to an integrin activation defect, we bypassed inside-out activation by treating cells with Mn2+, which binds to the integrin ectodomain and induces unbending and unclasping of integrin heterodimers (Mould et al., 1995). Treatment with Mn2+ induced partial adhesion of TlnKo and KindKo cells to FN, while partial adhesion to LN and VN was only induced in TlnKo cells (Figure 1D). Time course experiments revealed that Mn2+-induced adhesion of TlnKo and KindKo cells to FN was already significantly lower 2.5 min after plating and remained significantly lower compared with control cells (Figure 1E), suggesting that talin and kindlin cooperate to initiate and maintain normal Mn2+-induced adhesion to FN. In line with these findings, dose-response profiles showed that TlnKo and KindKo cells have severe adhesion defects at low (1.25 µg ml–1) as well as high (20 µg ml–1) substrate concentrations (Figure 1—figure supplement 4).
Figure 1—figure supplement 4.

Cell adhesion of TlnKo and KindKo cells on different FN concentrations.

Cell adhesion was measured 20 min after seeding the indicated cell lines on plastic surfaces coated with the indicated FN concentrations. Cells were PFA fixed and quantified by absorbance measurement of crystal violet staining (n=3 independent experiments; lines represent hyperbolic curve fits; error bars indicate standard deviation; significances for indicated pairs of the overall kinetics were calculated by two-way RM ANOVA). FN, fibronectin, PFA, paraformaldehyde; RM ANOVA, repeated measures analysis of variance.

DOI: http://dx.doi.org/10.7554/eLife.10130.007

These findings indicate that talin and kindlin promote integrin-mediated adhesion to FN and proliferation, and that the integrin-activating compound Mn2+ can only partially substitute for the adhesion promoting roles that talin and kindlin accomplish together.

Integrin activation and binding to FN requires talin and kindlin-2

The inability of Mn2+ to fully rescue the adhesion defect of TlnKo and KindKo cells raised the question whether integrin surface levels change after deletion of the Tln1/2 and Fermt1/2 genes. We quantified integrin surface levels by flow cytometry and found that the levels of β1 and β3 were significantly reduced in KindKo and unaffected in TlnKo cells (Figure 2A and Figure 2—figure supplement 1). The levels of α2 and α3 integrin were reduced in both cell lines, α6 was elevated in TlnKo and decreased in KindKo cells, and the α3 levels were significantly more decreased in KindKo than in TlnKo cells (Figure 2A) explaining the absent adhesion of both cell lines to COL and their differential adhesion behaviour on LN (Figure 1D). The β5 levels were similarly up-regulated in KindKo and TlnKo cells, and the α5 and αv integrin levels were slightly reduced but not significantly different between TlnKo and KindKo cells (Figure 2A). The differential adhesion of Mn2+-treated TlnKo and KindKo cells to VN (Figure 1D), despite similar surface levels of αv integrins, points to particularly important role(s) for kindlin-2 in αv integrins-VN adhesion and signaling (Liao et al., 2015). Serendipitously, the reduced expression of β1-associating α2, α3 and α6 subunits in KindKo cells, which impairs adhesion to LN and COL enables α5 to associate with the remaining β1 subunits and leads to comparable α5β1 levels on TlnKo and KindKo cells (Figure 2—figure supplement 2) explaining their similar adhesion to FN (Figure 1D,E and Figure 1—figure supplement 4). Therefore, we performed all further experiments with FN.
Figure 2.

FN binding by TlnKo and KindKo cells.

() Quantification of integrin surface expression levels relative to the TlnCtr and KindCtr cell lines; independent experiments: n=10 for β1; n=4 for β3, α5, αv; n=3 for remaining integrin subunits; error bars indicate standard error of the mean; significances are calculated between TlnKo and KindKo cells indicated by brackets, or between TlnKo or KindKo cells and corresponding control cells indicated by the significances above or below bars. () Box plot representation of adhesion forces generated by cells interacting with surface immobilized FN fragments. Cells were immobilized on ConA-coated AFM cantilevers and pressed onto surfaces coated with the FN-RGD or integrin-binding deficient FN-ΔRGD fragments for varying contact times, either in the absence () or presence of Mn2+ (). Coloured and grey boxplots represent adhesion forces from at least 10–15 independent experiments with single cells; + signs represent mean; the significance between adhesion on FN-RGD versus FN-ΔRGD is given on top of each boxplot and was calculated with a Mann–Whitney U test; brackets indicate two-way RM ANOVA comparisons of the whole adhesion kinetics. () FN staining after plating cells on a FN-coated dish for 24 hr. () Quantification of cell adhesion on FN 30 min after seeding; values are normalized to TlnCtr and KindCtr; n=3 independent experiments; error bars indicate standard error of the mean. Bar, 10 µm. AFM, atomic force microscopy; ConA, Concanavalin A; FN, fibronectin; K2GFP, green fluorescent protein-tagged kindlin-2; RGD, Arg-Gly-Asp; RM ANOVA, repeated measures analysis of variance; THD, talin-1 head domain; Tln1V, Venus-tagged full length talin-1.

DOI: http://dx.doi.org/10.7554/eLife.10130.008

Representative FACS histograms of different integrin subunits expressed on TlnCtr, TlnKo, KindCtr and KindKo cells are shown. FACS histograms of cells lacking expression of all integrins (pKO) served as negative control and are shown in grey. FACS, fluorescence-activated cell sorting.

DOI: http://dx.doi.org/10.7554/eLife.10130.009

Live TlnCtr, KindCtr, TlnKo and KindKo cells were incubated with antibodies against α5 integrin (α5) or with an unrelated isotype control (iso) on ice to immunoprecipitate α5 integrin from their cell surface. Following immunoprecipitation, the proteins were analyzed by western blotting to determine the levels of β1 and α5 integrin.

DOI: http://dx.doi.org/10.7554/eLife.10130.010

() FACS quantification of 9EG7 antibody binding to the indicated cell lines in the presence of 0.3 µM FN (FN) or 5 mM MnCl2 and 0.3 µM FN (FN+Mn2+) (n=3 independent experiments; 9EG7 binding was normalized to total-β1 surface levels and 100% represents the average of TlnCtr and KindCtr under control buffer condition; error bars indicate standard error of the mean; significances are calculated between Ctr and indicated condition). (B) FACS quantification of total β1-antibody and 9EG7-antibody binding to TlnCtr and KindCtr cells and cells reconstituted with Tln1V, K2GFP or THD. 9EG7 binding was normalized to total β1 surface levels and control cell lines were set to 100% (n>3 independent experiments; significances are given for indicated pairs; error bars indicate standard error of the mean). FACS, fluorescence-activated cell sorting; FN, fibronectin; K2GFP, green fluorescent protein-tagged kindlin-2; THD, talin-1 head domain; Tln1V, Venus-tagged full length talin-1.

DOI: http://dx.doi.org/10.7554/eLife.10130.011

Western blot analysis of cell lysates from TlnKo and KindKo cells reconstituted with Tln1V, THD or K2GFP expression plasmids. GAPDH, glyceraldehyde-3-phosphate dehydrogenase; K2GFP, green fluorescent protein-tagged kindlin-2; THD, talin-1 head domain; Tln1V, Venus-tagged full length talin-1.

DOI: http://dx.doi.org/10.7554/eLife.10130.012

Figure 2—figure supplement 1.

Integrin expression profiles of TlnCtr, TlnKo, KindCtr and KindKo cells.

Representative FACS histograms of different integrin subunits expressed on TlnCtr, TlnKo, KindCtr and KindKo cells are shown. FACS histograms of cells lacking expression of all integrins (pKO) served as negative control and are shown in grey. FACS, fluorescence-activated cell sorting.

DOI: http://dx.doi.org/10.7554/eLife.10130.009

Figure 2—figure supplement 2.

TlnKo and KindKo cells display comparable α5β1 integrin cell surface levels.

Live TlnCtr, KindCtr, TlnKo and KindKo cells were incubated with antibodies against α5 integrin (α5) or with an unrelated isotype control (iso) on ice to immunoprecipitate α5 integrin from their cell surface. Following immunoprecipitation, the proteins were analyzed by western blotting to determine the levels of β1 and α5 integrin.

DOI: http://dx.doi.org/10.7554/eLife.10130.010

FN binding by TlnKo and KindKo cells.

() Quantification of integrin surface expression levels relative to the TlnCtr and KindCtr cell lines; independent experiments: n=10 for β1; n=4 for β3, α5, αv; n=3 for remaining integrin subunits; error bars indicate standard error of the mean; significances are calculated between TlnKo and KindKo cells indicated by brackets, or between TlnKo or KindKo cells and corresponding control cells indicated by the significances above or below bars. () Box plot representation of adhesion forces generated by cells interacting with surface immobilized FN fragments. Cells were immobilized on ConA-coated AFM cantilevers and pressed onto surfaces coated with the FN-RGD or integrin-binding deficient FN-ΔRGD fragments for varying contact times, either in the absence () or presence of Mn2+ (). Coloured and grey boxplots represent adhesion forces from at least 10–15 independent experiments with single cells; + signs represent mean; the significance between adhesion on FN-RGD versus FN-ΔRGD is given on top of each boxplot and was calculated with a Mann–Whitney U test; brackets indicate two-way RM ANOVA comparisons of the whole adhesion kinetics. () FN staining after plating cells on a FN-coated dish for 24 hr. () Quantification of cell adhesion on FN 30 min after seeding; values are normalized to TlnCtr and KindCtr; n=3 independent experiments; error bars indicate standard error of the mean. Bar, 10 µm. AFM, atomic force microscopy; ConA, Concanavalin A; FN, fibronectin; K2GFP, green fluorescent protein-tagged kindlin-2; RGD, Arg-Gly-Asp; RM ANOVA, repeated measures analysis of variance; THD, talin-1 head domain; Tln1V, Venus-tagged full length talin-1. DOI: http://dx.doi.org/10.7554/eLife.10130.008

Integrin expression profiles of TlnCtr, TlnKo, KindCtr and KindKo cells.

Representative FACS histograms of different integrin subunits expressed on TlnCtr, TlnKo, KindCtr and KindKo cells are shown. FACS histograms of cells lacking expression of all integrins (pKO) served as negative control and are shown in grey. FACS, fluorescence-activated cell sorting. DOI: http://dx.doi.org/10.7554/eLife.10130.009

TlnKo and KindKo cells display comparable α5β1 integrin cell surface levels.

Live TlnCtr, KindCtr, TlnKo and KindKo cells were incubated with antibodies against α5 integrin (α5) or with an unrelated isotype control (iso) on ice to immunoprecipitate α5 integrin from their cell surface. Following immunoprecipitation, the proteins were analyzed by western blotting to determine the levels of β1 and α5 integrin. DOI: http://dx.doi.org/10.7554/eLife.10130.010

β1 integrin activation in TlnCtr, TlnKo, KindCtr, KindKo cells.

() FACS quantification of 9EG7 antibody binding to the indicated cell lines in the presence of 0.3 µM FN (FN) or 5 mM MnCl2 and 0.3 µM FN (FN+Mn2+) (n=3 independent experiments; 9EG7 binding was normalized to total-β1 surface levels and 100% represents the average of TlnCtr and KindCtr under control buffer condition; error bars indicate standard error of the mean; significances are calculated between Ctr and indicated condition). (B) FACS quantification of total β1-antibody and 9EG7-antibody binding to TlnCtr and KindCtr cells and cells reconstituted with Tln1V, K2GFP or THD. 9EG7 binding was normalized to total β1 surface levels and control cell lines were set to 100% (n>3 independent experiments; significances are given for indicated pairs; error bars indicate standard error of the mean). FACS, fluorescence-activated cell sorting; FN, fibronectin; K2GFP, green fluorescent protein-tagged kindlin-2; THD, talin-1 head domain; Tln1V, Venus-tagged full length talin-1. DOI: http://dx.doi.org/10.7554/eLife.10130.011

Re-expression of talin-1 or kindlin-2 in TlnKo and KindKo cells.

Western blot analysis of cell lysates from TlnKo and KindKo cells reconstituted with Tln1V, THD or K2GFP expression plasmids. GAPDH, glyceraldehyde-3-phosphate dehydrogenase; K2GFP, green fluorescent protein-tagged kindlin-2; THD, talin-1 head domain; Tln1V, Venus-tagged full length talin-1. DOI: http://dx.doi.org/10.7554/eLife.10130.012 Since we excluded different surface levels of FN-binding integrins as a cause for the severely compromised adhesion of TlnKo and KindKo cells to FN, we tested whether talin and kindlin are required to activate FN-binding α5β1 integrins. To directly assess integrin activation, we made use of an antibody against the 9EG7 epitope, which specifically recognizes Mn2+ and/or ligand activated β1 integrins (Bazzoni et al., 1995). The amount of 9EG7 epitope exposure relative to total β1 integrin exposure corresponds to the integrin activation index, which can be measured by flow cytometry using 9EG7 and anti-total β1 integrin antibodies. These measurements revealed that TlnCtr and KindCtr cells bound 9EG7 antibodies, while TlnKo and KindKo cells lacked 9EG7 binding in the absence of Mn2+ (Figure 2—figure supplement 3A). Mn2+ treatment significantly increased 9EG7 binding by TlnCtr and KindCtr cells, which was further elevated in the presence of FN-Arg-Gly-Asp (RGD) ligand known to stabilize the high affinity state of integrins (Figure 2—figure supplement 3A). Mn2+-treated TlnKo and KindKo cells bound significantly less 9EG7 antibodies than control cells, which marginally increased with FN-RGD (Figure 2—figure supplement 3A). Moreover, the normalization of the 9EG7 binding to the total β1 integrin surface levels also indicated a significantly lower influence of Mn2+ and FN-RGD on the integrin activation index of KindKo as compared to TlnKo cells (Figure 2—figure supplement 3A). These findings confirm that both, talin and kindlin are required for β1 integrin activation and to stabilize Mn2+-induced unbending/unclasping of α5β1 integrins.
Figure 2—figure supplement 3.

β1 integrin activation in TlnCtr, TlnKo, KindCtr, KindKo cells.

() FACS quantification of 9EG7 antibody binding to the indicated cell lines in the presence of 0.3 µM FN (FN) or 5 mM MnCl2 and 0.3 µM FN (FN+Mn2+) (n=3 independent experiments; 9EG7 binding was normalized to total-β1 surface levels and 100% represents the average of TlnCtr and KindCtr under control buffer condition; error bars indicate standard error of the mean; significances are calculated between Ctr and indicated condition). (B) FACS quantification of total β1-antibody and 9EG7-antibody binding to TlnCtr and KindCtr cells and cells reconstituted with Tln1V, K2GFP or THD. 9EG7 binding was normalized to total β1 surface levels and control cell lines were set to 100% (n>3 independent experiments; significances are given for indicated pairs; error bars indicate standard error of the mean). FACS, fluorescence-activated cell sorting; FN, fibronectin; K2GFP, green fluorescent protein-tagged kindlin-2; THD, talin-1 head domain; Tln1V, Venus-tagged full length talin-1.

DOI: http://dx.doi.org/10.7554/eLife.10130.011

Our findings so far suggest that talin and kindlin are required to activate FN-binding integrins and maintain Mn2+-induced activation of FN-binding integrins. To further analyze whether ligand-induced stabilisation of high-affinity integrin conformations (also termed ‘ligand-induced integrin activation; Du et al., 1991) can form in the absence of talin or kindlin, we used atomic force microscopy (AFM)-based single cell force spectroscopy (SCFS). We attached control, TlnKo or KindKo cells to Concanavalin A (ConA)-coated cantilevers, allowed the cells to contact surfaces coated with either wild type FN-III7-10 (FN-RGD) or an integrin-binding-deficient FN-III7-10 fragment lacking the RGD binding motif (FN-ΔRGD) for increasing contact times, either in the absence or presence of Mn2+ and then detached them from the substrate by lifting the cantilever (Figure 2B,C). In the absence of Mn2+ TlnCtr and KindCtr cells developed significant adhesion to FN-RGD within 5 s contact time. After a contact time of 20 s around 2 nN force was required to disrupt adhesion to FN-RGD, and after 50 and 120 s, respectively, 3 and 6 nN were required (Figure 2B). TlnKo and KindKo cells failed to develop measurable adhesions to FN-RGD after contact times of 5, 20, 50 and 120 s (Figure 2B). Treatment with Mn2+ induced a slight and similar increase of force required to disrupt adhesion of control, TlnKo and KindKo cells to FN-RGD after 5 s contact time (Figure 2C). However, with increasing contact times, the AFM profiles of TlnKo and KindKo cells differ in the presence of Mn2+. While the adhesion force increased concomitantly with longer contact times in TlnCtr, KindCtr and TlnKo cells, adhesion forces of KindKo cells plateaued after 50 s and showed no further increase towards 120 s contact time. The latter finding suggests that kindlin stabilizes integrin–ligand complexes with time, by inducing integrin clustering and/or by modulating the off-rate of integrin ligand bonds, for example, through associating with the integrin-linked kinase (ILK)-Pinch-Parvin (IPP) complex that links kindlin to the F-actin cytoskeleton (Cluzel et al., 2005; Ye et al., 2013; Montanez et al., 2008; Fukuda et al., 2014). We next tested whether their impaired integrin function affects the assembly of FN into fibrils, which requires association of active α5β1 integrin with the actin cytoskeleton (Pankov et al., 2000), and whether re-expression of talin and kindlin reverts the defects of TlnKo and KindKo cells. While neither TlnKo nor KindKo cells were able to assemble FN fibrils, re-expression of full-length Venus-tagged talin-1 (Tln1V) in TlnKo or GFP-tagged kindlin-2 (K2GFP) in KindKo cells (Figure 2—figure supplement 4) rescued FN fibril assembly and adhesion to FN (Figure 2D,E). Furthermore, neither overexpression of the talin-1 head (THD) nor K2GFP in TlnKo cells, nor Tln1V or THD in KindKo cells rescued adhesion to FN or 9EG7 binding (Figure 2E and Figure 2—figure supplement 3B).
Figure 2—figure supplement 4.

Re-expression of talin-1 or kindlin-2 in TlnKo and KindKo cells.

Western blot analysis of cell lysates from TlnKo and KindKo cells reconstituted with Tln1V, THD or K2GFP expression plasmids. GAPDH, glyceraldehyde-3-phosphate dehydrogenase; K2GFP, green fluorescent protein-tagged kindlin-2; THD, talin-1 head domain; Tln1V, Venus-tagged full length talin-1.

DOI: http://dx.doi.org/10.7554/eLife.10130.012

Altogether, our results demonstrate that both talin and kindlin are required (1) for ligand-induced stabilisation of integrin-ligand complexes, (2) to stabilize Mn2+-activated α5β1 integrins, and (3) to induce integrin-mediated FN fibril formation.

TlnKo cells initiate spreading and assemble β1 integrins at protruding membranes

It has been reported that a significant number of talin-2 small interfering RNA (siRNA)-expressing talin-1–/– fibroblasts adhere to FN and initiate isotropic cells spreading (Zhang et al., 2008). To test whether spreading can also be induced in adherent TlnKo and KindKo cells, we bypassed their adhesion defect with Mn2+, seeded them for 30 min on FN and stained with an antibody against total β1 integrin and the β1 integrin activation epitope-reporting 9EG7 antibody. As expected, TlnCtr or KindCtr cells clustered 9EG7-positive β1 integrins in NAs and focal adhesions (FAs), whose frequency and size increased upon Mn2+ treatment (Figure 3A,B). In contrast, the sporadic and very weakly adherent TlnKo and KindKo cells were small, round and formed small and finely dispersed β1 integrin aggregates over the entire cell (Figure 3A) and lacked 9EG7-positive signals (Figure 3B) in the absence of Mn2+ treatment. Upon Mn2+ treatment 37 ± 1% (n=684, mean ± standard deviation of three independent experiments) of the TlnKo cells showed isotropic membrane protrusions (circumferential lamellipodia) with small, dot-like aggregates of β1 integrin, kindlin-2, paxillin and ILK at the membrane periphery (Figure 3A and Figure 3—figure supplement 1), which eventually detached from the substrate leading to the collapse of the protruded membrane (Video 1). Furthermore, 9EG7-positive β1 integrins accumulated along the lamellipodial edge and beneath the nucleus of TlnKo cells (Figure 3B). The remaining cells were spheroid, with half of them showing short, finger-like protrusions, which were motile due to their poor anchorage to the substrate. In the case of KindKo cells, we analysed 652 cells in three independent experiments and found that only 7 ± 1% (mean ± standard deviation) of the cells established lamellipodia, which formed around the entire circumference in 2 ± 0.4% (mean ± standard deviation) of the cells. Around 93 ± 1% of the KindKo cells were spheroid (mean ± standard deviation) and frequently had finger-like, motile protrusions with small dot-like signals containing β1 integrin and talin but rarely paxillin or ILK (Figure 3A and Figure 3—figure supplement 1). Importantly, re-expression of Tln1V in TlnKo cells or K2GFP in KindKo cells normalized FA formation and spreading on FN (Figure 3—figure supplement 2). These findings indicate that kindlin-2 expressing TlnKo cells can initiate the formation of large lamellipodia and assemble β1 integrins in lamellipodial edges.
Figure 3.

Integrin distribution in TlnKo and KindKo cells.

() Confocal images of the ventral side of adherent cells stained for β1 integrin and F-actin in the absence or presence of Mn2+ stimulation. Notice the increase in the spreading area (w/o Mn2+: 1696 ± 360 µm2, Mn2+: 2676 ± 466 µm2) and in the average size (w/o Mn2+: 0.64 ± 0.1 µm2, Mn2+: 0.89 ± 0.1 µm2) and number (w/o Mn2+: 105 ± 38, Mn2+: 246 ± 8) of focal adhesions in KindCtr cells after Mn2+ stimulation and the increase of spreading area in the TlnKo (w/o Mn2+: 77 ± 1 µm2, Mn2+: 572 ± 37 µm2) and KindKo cells (w/o Mn2+: 76 ± 27 µm2, Mn2+: 152 ± 8 µm2) (n=3, mean ± standard deviation). () Confocal images from the ventral side of adherent cells stained for the 9EG7 epitope in the absence or presence of Mn2+ stimulation. () TIRF-dSTORM images of β1 integrin (grey scale image) obtained from immunostaining of non-permeabilized cells overlaid with anti-paxillin staining following permeabilization (red, normal resolution). Boxed areas are displayed in a five-fold magnification. () Images show heat map representations of dSTORM localizations per µm2 and sec, indicative for integrin clustering defined by local integrin densities. The colour range indicates localizations s–1 µm–2 with low values shown in dark red colours and high densities from yellow to white colours. Bars, 10 µm (A,B); 5 µm (C,D); 500 nm (for the magnification in C,D). TIRF, total internal reflection fluourescence; dSTORM, direct stochastic optical reconstruction microscopy.

DOI: http://dx.doi.org/10.7554/eLife.10130.014

Confocal images of the ventral plasma membrane of adherent, Mn2+-treated KindCtr, TlnKo and KindKo cells stained for ILK, paxillin, talin, and kindlin-2 (green), always together with phalloidin to visualize F-actin (red). For TlnKo and KindKo, three-fold magnifications of indicated areas are shown. For kindlin-2 staining, acetone-methanol fixation was used. Bar, 10 µm. FAs, focal adhesions; ILK, integrin-linked kinase.

DOI: http://dx.doi.org/10.7554/eLife.10130.015

Confocal images of KindKo and TlnKo cells reconstituted with K2GFP or Tln1V expression plasmids, respectively. Bar, 10 µm. FA, focal adhesion; K2GFP, green fluorescent protein-tagged kindlin-2; Tln1V, Venus-tagged full length talin-1.

DOI: http://dx.doi.org/10.7554/eLife.10130.016

dSTORM image and density map of β1 integrins in non-spread, spheroid-shaped TlnKo cells shows aggregation of integrin in the cell body and finger-like protrusions. Bars, 5 µm and 500 nm (for high magnification). dSTORM, direct stochastic optical reconstruction microscopy.

DOI: http://dx.doi.org/10.7554/eLife.10130.017

Figure 3—figure supplement 1.

Localization of FAs proteins in Mn2+-treated KindCtr, TlnKo and KindKo cells.

Confocal images of the ventral plasma membrane of adherent, Mn2+-treated KindCtr, TlnKo and KindKo cells stained for ILK, paxillin, talin, and kindlin-2 (green), always together with phalloidin to visualize F-actin (red). For TlnKo and KindKo, three-fold magnifications of indicated areas are shown. For kindlin-2 staining, acetone-methanol fixation was used. Bar, 10 µm. FAs, focal adhesions; ILK, integrin-linked kinase.

DOI: http://dx.doi.org/10.7554/eLife.10130.015

Video 1.

Spreading KindCtr, TlnKo and KindKo cells on FN.

Assembled time lapse movies of KindCtr, TlnKo and KindKo cells. Cell spreading was recorded 5 min after seeding on FN. KindCtr cells were already well spread and only a minor size increase was observed over the following minutes. The TlnKo cells formed a circumferential lamellipodium that rapidly collapsed and subsequently the cells formed finger-like protrusions of varying size and failed to reestablish a fully formed circular lamellipodium. The KindKo cells failed to form a lamellipodium and formed finger-like protrusions that were not always adherent. Bar, 10 µm. FN, fibronectin.

DOI: http://dx.doi.org/10.7554/eLife.10130.013

Figure 3—figure supplement 2.

Rescue of FA formation and spreading after expression of Tln1V in TlnKo cells or K2GFP in KindKo cells.

Confocal images of KindKo and TlnKo cells reconstituted with K2GFP or Tln1V expression plasmids, respectively. Bar, 10 µm. FA, focal adhesion; K2GFP, green fluorescent protein-tagged kindlin-2; Tln1V, Venus-tagged full length talin-1.

DOI: http://dx.doi.org/10.7554/eLife.10130.016

Spreading KindCtr, TlnKo and KindKo cells on FN.

Assembled time lapse movies of KindCtr, TlnKo and KindKo cells. Cell spreading was recorded 5 min after seeding on FN. KindCtr cells were already well spread and only a minor size increase was observed over the following minutes. The TlnKo cells formed a circumferential lamellipodium that rapidly collapsed and subsequently the cells formed finger-like protrusions of varying size and failed to reestablish a fully formed circular lamellipodium. The KindKo cells failed to form a lamellipodium and formed finger-like protrusions that were not always adherent. Bar, 10 µm. FN, fibronectin. DOI: http://dx.doi.org/10.7554/eLife.10130.013

Integrin distribution in TlnKo and KindKo cells.

() Confocal images of the ventral side of adherent cells stained for β1 integrin and F-actin in the absence or presence of Mn2+ stimulation. Notice the increase in the spreading area (w/o Mn2+: 1696 ± 360 µm2, Mn2+: 2676 ± 466 µm2) and in the average size (w/o Mn2+: 0.64 ± 0.1 µm2, Mn2+: 0.89 ± 0.1 µm2) and number (w/o Mn2+: 105 ± 38, Mn2+: 246 ± 8) of focal adhesions in KindCtr cells after Mn2+ stimulation and the increase of spreading area in the TlnKo (w/o Mn2+: 77 ± 1 µm2, Mn2+: 572 ± 37 µm2) and KindKo cells (w/o Mn2+: 76 ± 27 µm2, Mn2+: 152 ± 8 µm2) (n=3, mean ± standard deviation). () Confocal images from the ventral side of adherent cells stained for the 9EG7 epitope in the absence or presence of Mn2+ stimulation. () TIRF-dSTORM images of β1 integrin (grey scale image) obtained from immunostaining of non-permeabilized cells overlaid with anti-paxillin staining following permeabilization (red, normal resolution). Boxed areas are displayed in a five-fold magnification. () Images show heat map representations of dSTORM localizations per µm2 and sec, indicative for integrin clustering defined by local integrin densities. The colour range indicates localizations s–1 µm–2 with low values shown in dark red colours and high densities from yellow to white colours. Bars, 10 µm (A,B); 5 µm (C,D); 500 nm (for the magnification in C,D). TIRF, total internal reflection fluourescence; dSTORM, direct stochastic optical reconstruction microscopy. DOI: http://dx.doi.org/10.7554/eLife.10130.014

Localization of FAs proteins in Mn2+-treated KindCtr, TlnKo and KindKo cells.

Confocal images of the ventral plasma membrane of adherent, Mn2+-treated KindCtr, TlnKo and KindKo cells stained for ILK, paxillin, talin, and kindlin-2 (green), always together with phalloidin to visualize F-actin (red). For TlnKo and KindKo, three-fold magnifications of indicated areas are shown. For kindlin-2 staining, acetone-methanol fixation was used. Bar, 10 µm. FAs, focal adhesions; ILK, integrin-linked kinase. DOI: http://dx.doi.org/10.7554/eLife.10130.015

Rescue of FA formation and spreading after expression of Tln1V in TlnKo cells or K2GFP in KindKo cells.

Confocal images of KindKo and TlnKo cells reconstituted with K2GFP or Tln1V expression plasmids, respectively. Bar, 10 µm. FA, focal adhesion; K2GFP, green fluorescent protein-tagged kindlin-2; Tln1V, Venus-tagged full length talin-1. DOI: http://dx.doi.org/10.7554/eLife.10130.016

Distribution of β1 integrins in spheroid-shaped TlnKo cells.

dSTORM image and density map of β1 integrins in non-spread, spheroid-shaped TlnKo cells shows aggregation of integrin in the cell body and finger-like protrusions. Bars, 5 µm and 500 nm (for high magnification). dSTORM, direct stochastic optical reconstruction microscopy. DOI: http://dx.doi.org/10.7554/eLife.10130.017 To further characterize the distribution of β1 integrins in the lamellipodial edges of TlnKo cells, we visualized them by combining direct stochastic optical reconstruction microscopy (dSTORM) and total internal reflection fluorescence microscopy (TIRFM). Mn2+-treated and non-permeablized cells were seeded on FN, stained with anti-total β1 integrin antibodies, and then permeabilized, immunostained for paxillin and imaged with normal resolution TIRFM and dSTORM (Figure 3C). Each localization detected by dSTORM was plotted as a Gaussian distribution around its centre with an average spatial accuracy of ~20 nm (resolution limit of dSTORM imaging). Since two or more localizations from single or multiple dyes in close proximity cannot be distinguished, the number of localizations does not directly reflect integrin numbers. However, all antibody molecules display the same average behaviour with respect to the number of localizations per second in all areas of the cell. This allowed to average the number of localizations per second and µm2 and to plot them in a heat map representation (Figure 3D), which directly reflects the density of stained β1 integrin molecules and thus the degree of integrin clustering. The β1 integrin staining of TlnCtr and KindCtr cells revealed small round structures of ~50 nm diameter indicating clusters of integrins larger than the resolution limit (Figure 3C; high magnification; see arrowheads). Furthermore, high numbers of localizations were enriched in paxillin-positive FAs and in NAs at the lamellipodial edge (Figure 3C; see arrowheads). In these areas, we observed a high average density of 60–120 localizations s–1 µm–2, while outside of the adhesion sites ~0–20 localizations s–1 µm–2 were detected, indicating a high degree of β1 integrin clustering within and a low degree of clustering outside of adhesion sites (Figure 3D). TlnKo cells with circumferential lamellipodia showed a high density of blinking with up to 100 localizations s–1 µm–2 at lamellipodial edges (Figure 3C,D; see arrowheads), which appeared less compact than in control cells. KindKo cells showed >120 localizations s–1 µm–2 in the periphery and finger-like membrane protrusions (Figure 3C,D; see arrowheads), which were also observed in TlnKo cells that adopted a spheroid rather than an isotropic spread shape (Figure 3—figure supplement 3). The exclusive presence of these large and entangled β1 integrin aggregates on TlnKo and KindKo cells with small, spheroid shapes and protrusions suggests that they were induced by spatial constraints rather than specific signaling.
Figure 3—figure supplement 3.

Distribution of β1 integrins in spheroid-shaped TlnKo cells.

dSTORM image and density map of β1 integrins in non-spread, spheroid-shaped TlnKo cells shows aggregation of integrin in the cell body and finger-like protrusions. Bars, 5 µm and 500 nm (for high magnification). dSTORM, direct stochastic optical reconstruction microscopy.

DOI: http://dx.doi.org/10.7554/eLife.10130.017

These findings demonstrate that, in contrast to KindKo cells, Mn2+-treated kindlin-2-expressing TlnKo cells induce circumferential membrane protrusions with β1 integrins at the protrusive edges.

Kindlin-2 binds and recruits paxillin to NAs

Our data so far indicate that the expression of kindlin-2 enables initial, isotropic spreading and the accumulation of integrins in lamellipodia of Mn2+-treated TlnKo cells. To identify binding partner(s) of kindlin-2 that transduce this function to downstream effectors, we performed yeast-two-hybrid assays with kindlin-2 as bait using a human complementary DNA (cDNA) library containing all possible open reading frames and a human keratinocyte-derived cDNA library. Among the 124 cDNAs identified from both screenings, 17 coded for leupaxin and 11 for Hic-5. Immunoprecipitation of overexpressed green fluorescent protein (GFP)-tagged paxillin family members, paxillin, Hic-5 and leupaxin in HEK-293 cells with an anti-GFP antibody efficiently co-precipitated FLAG-tagged kindlin-2 (K2flag) (Figure 4A). Conversely, overexpressed GFP-tagged kindlin family members (kindlin-1, kindlin-2, kindlin-3) co-precipitated Cherry-paxillin (Figure 4—figure supplement 1). Since fibroblasts express high levels of paxillin (Figure 4—figure supplement 2), we performed all further interaction analysis with paxillin. Immunoprecipitations of GFP-tagged paxillin or kindlin-2 truncation mutants (Figure 4—figure supplement 3A) revealed that the interaction between kindlin-2 and paxillin was dramatically reduced in the absence of the Lin-11, Isl-1 and Mec-3 (LIM)1-4, LIM2-4 or LIM3-4 domains of paxillin (Figure 4B), or the pleckstrin homology (PH) domain (K2ΔPHGFP; lacking amino acids 380-477) or the N-terminus of kindlin-2 including the F0, F1, and the N-terminal part of the F2 domains (K2NTGFP; terminating at the end of F1; spanning amino acids 1-229) (Figure 4C). As expected, the interaction between kindlin-2 and ILK (Montanez et al., 2008), which is mediated via a recently identified sequence in the linker domain between the end of the N-terminal F2 and the beginning of the PH domain (amino acids 353–357) (Fukuda et al., 2014; Huet-Calderwood et al., 2014), was abolished by the K2NTGFP truncation but unaffected by the deletion of the PH domain (K2ΔPHGFP) or the deletion of the N-terminal F0 and F1 domains (K2CTGFP, spanning amino acids 244-680) (Figure 4C). Importantly, immunoprecipitation of KindCtr lysates with antibodies against paxillin co-precipitated kindlin-2 (Figure 4D), confirming interactions between the endogenous proteins. Pull down experiments with recombinant full-length paxillin or paxillin-LIM3 domain and recombinant kindlin-2 demonstrated that binding to LIM3 and full-length paxillin is direct, Zn2+-dependent and abrogated with ethylenediaminetetraacetic acid (EDTA) (Figure 4E and Figure 4—figure supplement 3B). KindKo cells were transduced with K2GFP or K2ΔPHGFP expression constructs, seeded on FN for different times and stained for β1 integrin, paxillin and F-actin. The experiments revealed that the expression of K2GFP in KindKo cells rescued spreading and induced robust paxillin recruitment to β1 integrin-positive NAs (Figure 4F,G). In contrast, expression of K2ΔPHGFP failed to recruit paxillin to β1 integrin-positive adhesion sites at the rim of membrane protrusions (Figure 4F,G) and induce normal cell spreading (Figure 4—figure supplement 4A) despite proper, although weaker, localisation to β1 integrin-positive adhesion sites (Figure 4—figure supplement 4B,C). Interestingly, mature FAs in K2ΔPHGFP-expressing cells were prominent after 30 min and contained significant amounts of paxillin, indicating that paxillin is recruited to mature FAs in a kindlin-2-independent manner (Figure 4F).
Figure 4.

Kindlin binds and recruits paxillin to NAs.

() GFP-IP of lysates from HEK 293T cells overexpressing GFP-tagged paxillin, Hic5 and leupaxin constructs (Pxn, paxillin; Hic5; Lpx, leupaxin) and K2flag reveal interaction of kindlin-2 with all three paxillin family members. () GFP-IP of lysates from HEK 293T cells overexpressing GFP-tagged paxillin truncation mutants and K2flag identifies the paxillin LIM3 domain as kindlin-2-binding domain. () GFP-IP of lysates from HEK 293T cells overexpressing GFP-tagged kindlin-2 truncation/deletion mutants and Cherry-tagged paxillin (PxnCH) identifies the kindlin-2 PH domain as paxillin binding domain. () Co-IP of endogenous paxillin and kindlin-2 from KindCtr cells. () Purified His-tagged paxillin-LIM3 domain pulls down recombinant kindlin-2 in a Zn2+-dependent manner. () K2GFP and K2ΔPHGFP expressing KindKo cells seeded on FN for the indicated times and stained for paxillin and β1 integrin. () Fluorescence intensity line scans from K2GFP- (n=11 cells) and K2ΔPHGFP- (n=17 cells) expressing KindKo cells cultured on FN for 10 min and stained for paxillin and β1 integrin; error bars indicate standard error of the mean. Bar, 10 µm. EDTA, ethylenediaminetetraacetic acid; FN, fibronection; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; GFP, green fluorescent protein; ILK, integrin-linked kinase; IP, immunoprecipitation; K2GFP, green fluorescent protein-tagged kindlin-2; LIM, Lin-11, Isl-1 and Mec-3; NAs, nascent adhesions; PH, pleckstrin homology.

DOI: http://dx.doi.org/10.7554/eLife.10130.018

GFP-IP of lysates from HEK293T cells expressing GFP, K1GFP, K2GFP and K3GFP followed by western blotting for Cherry-tagged paxillin (PxnCH) and GFP. GFP, green fluorescent protein; IP, immunoprecipitation; K1GFP, green fluorescent protein-tagged kindlin-1; K2GFP, green fluorescent protein-tagged kindlin-2; K3GFP, green fluorescent protein-tagged kindlin-3.

DOI: http://dx.doi.org/10.7554/eLife.10130.019

qPCR of paxillin (Pxn), Hic5, and leupaxin (Lpxn) from cDNAs generated from wild type fibroblasts (Fibrobl.), keratinocytes (Kerat.), RAW 264.7 macrophages (RAW) and T cells (TC). Results are normalized to the isoform with highest expression in the respective cell types (n=3 independent repeats; error bars show standard error of the mean). cDNA, complementary DNA; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; qPCR, quantitative polychromase chain reaction.

DOI: http://dx.doi.org/10.7554/eLife.10130.020

() Domain organization of kindlin-2 (F0,1,3: FERM domains 0,1,3; F2a,F2b: N-terminal (F2a) and C-terminal (F2b) halves of FERM domain 2 connected by a PH domain and small linkers on each side of the PH domain), and paxillin (L1-4: LIM domains 1-4; grey stripes represent LD-rich motifs). The ILK interaction site in kindlin-2 (N-terminal linker region located before the PH domain) and the FA-targeting region of paxillin (LIM3 domain) are indicated in red; the black lines show the length of the truncation mutants. () Full-length paxillin pulls down recombinant kindlin-2 in a Zn2+-dependent manner. FERM, Four-point-one, ezrin, radixin, moesin; ILK, integrin-linked kinase; LD, leucine-aspartate repeat; LIM, Lin-11, Isl-1 and Mec-3; PH, pleckstrin homology.

DOI: http://dx.doi.org/10.7554/eLife.10130.021

() Boxplots show the distribution of spreading areas for K2GFP and K2ΔPHGFP seeded on FN for the indicated times (n> 65 cells per time point). Significances for indicated pairs were calculated by a Mann–Whitney U test. () Confocal images of K2GFP- and K2ΔPHGFP-expressing KindKo cells seeded on FN for 10 min and stained for total β1 integrin and paxillin. () Confocal images of K2GFP- and K2ΔPHGFP-expressing KindKo cells seeded on FN for 10 min and stained for 9EG7. Bars, 10 µm. GFP, green fluorescent protein; FN, fibronectin; K2GFP, green fluorescent protein-tagged kindlin-2.

DOI: http://dx.doi.org/10.7554/eLife.10130.022

Figure 4—figure supplement 1.

Kindlin-1, -2 and -3 interact with paxillin.

GFP-IP of lysates from HEK293T cells expressing GFP, K1GFP, K2GFP and K3GFP followed by western blotting for Cherry-tagged paxillin (PxnCH) and GFP. GFP, green fluorescent protein; IP, immunoprecipitation; K1GFP, green fluorescent protein-tagged kindlin-1; K2GFP, green fluorescent protein-tagged kindlin-2; K3GFP, green fluorescent protein-tagged kindlin-3.

DOI: http://dx.doi.org/10.7554/eLife.10130.019

Figure 4—figure supplement 2.

Expression of paxillin family members in different cell lines.

qPCR of paxillin (Pxn), Hic5, and leupaxin (Lpxn) from cDNAs generated from wild type fibroblasts (Fibrobl.), keratinocytes (Kerat.), RAW 264.7 macrophages (RAW) and T cells (TC). Results are normalized to the isoform with highest expression in the respective cell types (n=3 independent repeats; error bars show standard error of the mean). cDNA, complementary DNA; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; qPCR, quantitative polychromase chain reaction.

DOI: http://dx.doi.org/10.7554/eLife.10130.020

Figure 4—figure supplement 3.

Direct interaction between paxillin and kindlin-2.

() Domain organization of kindlin-2 (F0,1,3: FERM domains 0,1,3; F2a,F2b: N-terminal (F2a) and C-terminal (F2b) halves of FERM domain 2 connected by a PH domain and small linkers on each side of the PH domain), and paxillin (L1-4: LIM domains 1-4; grey stripes represent LD-rich motifs). The ILK interaction site in kindlin-2 (N-terminal linker region located before the PH domain) and the FA-targeting region of paxillin (LIM3 domain) are indicated in red; the black lines show the length of the truncation mutants. () Full-length paxillin pulls down recombinant kindlin-2 in a Zn2+-dependent manner. FERM, Four-point-one, ezrin, radixin, moesin; ILK, integrin-linked kinase; LD, leucine-aspartate repeat; LIM, Lin-11, Isl-1 and Mec-3; PH, pleckstrin homology.

DOI: http://dx.doi.org/10.7554/eLife.10130.021

Figure 4—figure supplement 4.

K2ΔPHGFP fails to recruit paxillin to β1 integrin-positive adhesions in KindKo cells.

() Boxplots show the distribution of spreading areas for K2GFP and K2ΔPHGFP seeded on FN for the indicated times (n> 65 cells per time point). Significances for indicated pairs were calculated by a Mann–Whitney U test. () Confocal images of K2GFP- and K2ΔPHGFP-expressing KindKo cells seeded on FN for 10 min and stained for total β1 integrin and paxillin. () Confocal images of K2GFP- and K2ΔPHGFP-expressing KindKo cells seeded on FN for 10 min and stained for 9EG7. Bars, 10 µm. GFP, green fluorescent protein; FN, fibronectin; K2GFP, green fluorescent protein-tagged kindlin-2.

DOI: http://dx.doi.org/10.7554/eLife.10130.022

Kindlin binds and recruits paxillin to NAs.

() GFP-IP of lysates from HEK 293T cells overexpressing GFP-tagged paxillin, Hic5 and leupaxin constructs (Pxn, paxillin; Hic5; Lpx, leupaxin) and K2flag reveal interaction of kindlin-2 with all three paxillin family members. () GFP-IP of lysates from HEK 293T cells overexpressing GFP-tagged paxillin truncation mutants and K2flag identifies the paxillin LIM3 domain as kindlin-2-binding domain. () GFP-IP of lysates from HEK 293T cells overexpressing GFP-tagged kindlin-2 truncation/deletion mutants and Cherry-tagged paxillin (PxnCH) identifies the kindlin-2 PH domain as paxillin binding domain. () Co-IP of endogenous paxillin and kindlin-2 from KindCtr cells. () Purified His-tagged paxillin-LIM3 domain pulls down recombinant kindlin-2 in a Zn2+-dependent manner. () K2GFP and K2ΔPHGFP expressing KindKo cells seeded on FN for the indicated times and stained for paxillin and β1 integrin. () Fluorescence intensity line scans from K2GFP- (n=11 cells) and K2ΔPHGFP- (n=17 cells) expressing KindKo cells cultured on FN for 10 min and stained for paxillin and β1 integrin; error bars indicate standard error of the mean. Bar, 10 µm. EDTA, ethylenediaminetetraacetic acid; FN, fibronection; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; GFP, green fluorescent protein; ILK, integrin-linked kinase; IP, immunoprecipitation; K2GFP, green fluorescent protein-tagged kindlin-2; LIM, Lin-11, Isl-1 and Mec-3; NAs, nascent adhesions; PH, pleckstrin homology. DOI: http://dx.doi.org/10.7554/eLife.10130.018

Kindlin-1, -2 and -3 interact with paxillin.

GFP-IP of lysates from HEK293T cells expressing GFP, K1GFP, K2GFP and K3GFP followed by western blotting for Cherry-tagged paxillin (PxnCH) and GFP. GFP, green fluorescent protein; IP, immunoprecipitation; K1GFP, green fluorescent protein-tagged kindlin-1; K2GFP, green fluorescent protein-tagged kindlin-2; K3GFP, green fluorescent protein-tagged kindlin-3. DOI: http://dx.doi.org/10.7554/eLife.10130.019

Expression of paxillin family members in different cell lines.

qPCR of paxillin (Pxn), Hic5, and leupaxin (Lpxn) from cDNAs generated from wild type fibroblasts (Fibrobl.), keratinocytes (Kerat.), RAW 264.7 macrophages (RAW) and T cells (TC). Results are normalized to the isoform with highest expression in the respective cell types (n=3 independent repeats; error bars show standard error of the mean). cDNA, complementary DNA; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; qPCR, quantitative polychromase chain reaction. DOI: http://dx.doi.org/10.7554/eLife.10130.020

Direct interaction between paxillin and kindlin-2.

() Domain organization of kindlin-2 (F0,1,3: FERM domains 0,1,3; F2a,F2b: N-terminal (F2a) and C-terminal (F2b) halves of FERM domain 2 connected by a PH domain and small linkers on each side of the PH domain), and paxillin (L1-4: LIM domains 1-4; grey stripes represent LD-rich motifs). The ILK interaction site in kindlin-2 (N-terminal linker region located before the PH domain) and the FA-targeting region of paxillin (LIM3 domain) are indicated in red; the black lines show the length of the truncation mutants. () Full-length paxillin pulls down recombinant kindlin-2 in a Zn2+-dependent manner. FERM, Four-point-one, ezrin, radixin, moesin; ILK, integrin-linked kinase; LD, leucine-aspartate repeat; LIM, Lin-11, Isl-1 and Mec-3; PH, pleckstrin homology. DOI: http://dx.doi.org/10.7554/eLife.10130.021

K2ΔPHGFP fails to recruit paxillin to β1 integrin-positive adhesions in KindKo cells.

() Boxplots show the distribution of spreading areas for K2GFP and K2ΔPHGFP seeded on FN for the indicated times (n> 65 cells per time point). Significances for indicated pairs were calculated by a Mann–Whitney U test. () Confocal images of K2GFP- and K2ΔPHGFP-expressing KindKo cells seeded on FN for 10 min and stained for total β1 integrin and paxillin. () Confocal images of K2GFP- and K2ΔPHGFP-expressing KindKo cells seeded on FN for 10 min and stained for 9EG7. Bars, 10 µm. GFP, green fluorescent protein; FN, fibronectin; K2GFP, green fluorescent protein-tagged kindlin-2. DOI: http://dx.doi.org/10.7554/eLife.10130.022 These findings indicate that the PH domain of kindlin-2 directly binds the LIM3 domain of paxillin and recruits paxillin into NAs but not into mature FAs.

The kindlin-2/paxillin complex promotes FAK-mediated cell spreading

Our findings revealed that kindlin-2 is required to recruit paxillin to NAs. Paxillin in turn, was shown to bind, cluster and activate FAK in NAs, which leads to the recruitment of p130Cas, Crk and Dock followed by the activation of Rac1 and the induction of cell spreading, and, in concert with growth factor signals, to the activation of Akt-1 followed by the induction of cell proliferation and survival (Schlaepfer et al., 2004; Bouchard et al., 2007; Zhang et al., 2014; Brami-Cherrier et al., 2014). We therefore hypothesized that the recruitment of paxillin and FAK by kindlin-2 triggers the isotropic spreading and expansion of TlnKo cells. To test this hypothesis, we seeded our cell lines on FN or poly-L-lysine (PLL) in the presence or absence of epidermal growth factor (EGF) and Mn2+. We found that EGF induced similar phosphorylation of tyrosine-992 (Y992) of the epidermal growth factor receptor (pY992-EGFR) in control, TlnKo and KindKo cells. The phosphorylation of tyrosine-397 of FAK (pY379-FAK) in KindCtr cells was strongly induced after the adhesion of control cells on FN and was not further elevated after the addition of EGF and Mn2+ (Figure 5A and Figure 5—figure supplement 1). TlnKo cells also increased pY397-FAK as well as pY31-Pxn and pY118-Pxn levels upon adhesion to FN, however, significantly less compared to control cells (Figure 5A and Figure 5—figure supplement 1A-C). Furthermore, EGF and Mn2+ treatments further increased pY397-FAK levels in TlnKo cells and localized pY397-FAK to peripheral NA-like adhesions (Figure 5A,B and Figure 5—figure supplement 1A-C). In sharp contrast, KindKo cells seeded on FN or treated with EGF and Mn2+ failed to induce pY397-FAK, pY31-Pxn, pY118-Pxn (Figure 5A and Figure 5—figure supplement 1A-C) and localize pY397-FAK to peripheral membrane regions (Figure 5B). Importantly, re-expression of Talin1-Venus in TlnKo and Kindlin2-GFP and KindKo cells fully rescued these signaling defects (Figure 5—figure supplement 1B,C). Furthermore, stable expression of K2GFP in KindKo cells rescued pY397-FAK and pS473-Akt levels (Figure 5C) and co-precipitated paxillin and FAK with K2GFP (Figure 5—figure supplement 2). In contrast, stable expression of K2ΔPHGFP in KindKo cells failed to co-precipitate paxillin and FAK (Figure 5—figure supplement 2) and induce pY397-FAK and pS473-Akt (Figure 5C).
Figure 5.

The kindlin/paxillin complex induces FAK signaling and cell spreading.

() FAK and EGFR activation after seeding serum-starved KindCtr, TlnKo and KindKo cells on PLL or FN and treating them with or without EGF and Mn2+. () Immunofluorescence staining of activated (Tyr-397 phosphorylated) FAK and F-actin in cells seeded on FN and treated with Mn2+ for 30 min (FAKGFP indicates exogenous expression of FAKGFP fusion protein). () FAK and Akt activation in KindKo cells stably transduced with K2GFP or K2ΔPHGFP either seeded on FN or kept in suspension. GFP indicates similar expression of transduced GFP-tagged constructs. GAPDH levels served to control loading. () Levels of phosphorylated signaling mediators downstream of FAK in Mn2+-treated, serum-starved or EGF-treated KindCtr, TlnKo and KindKo cells. GAPDH levels served to control loading. () Quantification of lamellipodia formation of FN-seeded TlnKo and KindKo cells treated with Mn2+ and either DMSO or the FAK inhibitor PF-228 (n=3 independent repeats; >100 cells/condition; error bars indicate standard error of the mean; significances are given in comparison to the DMSO control). () FAK activity in TlnKo and KindKo cells stably transduced with FAKGFP (n=3 independent experiments). () Quantification of lamellipodia formation in TlnKo and KindKo cells stably transduced with FAKGFP (n=3 independent experiments; significances are given in comparison to untreated control; error bars indicate standard error of the mean). Bar, 10 µm. DMSO, dimethyl sulfoxide; EGF, epidermal growth factor; EGFR, epidermal growth factor receptor; FAK, focal adhesion kinase; FAKGFP, green fluorescent protein-tagged FAK; FN, fibronectin; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; GFP, green fluorescent protein; PLL, poly-L-lysine.

DOI: http://dx.doi.org/10.7554/eLife.10130.023

() Densitometric quantification of western blot signals of lysates from untreated, EGF- and Mn2+-treated KindCtr, TlnKo and KindKo cells seeded either on FN or PLL and probed with anti-Tyr-397 phosphorylated FAK (pY397-FAK) antibodies (n=3 independent repeats; significances are calculated with respect to PLL adherent cells; error bars indicate standard error of the mean). () Western blotting of indicated signaling proteins in untreated, EGF- and Mn2+-treated TlnCtr, TlnKo and TlnKo cells re-expressing Venus-tagged talin-1 (TlnKo+T1V) (), and KindCtr, KindKo and KindKo cells re-expressing GFP-tagged kindlin-2 (KindKo+K2GFP) () seeded either on FN or PLL. EGF, epidermal growth factor; FAK, focal adhesion kinase; K2GFP, green fluorescent protein-tagged kindlin-2; FN, fibronectin; GFP, green fluorescent protein; PLL, poly-L-lysine; T1V, Venus-tagged full length talin-1.

DOI: http://dx.doi.org/10.7554/eLife.10130.024

GFP-IP in lysates of K2GFP-, K2ΔPHGFP- or GFP-reconstituted KindKo cells overexpressing Myc-tagged FAK (FAK-Myc) and Cherry-tagged paxillin (PxnCH). K2GFP but not K2ΔPHGFP forms a ternary complex with paxillin and FAK. FAK, focal adhesion kinase; GFP, green fluorescent protein; IP, immunoprecipitation; K2GFP, green fluorescent protein-tagged kindlin-2.

DOI: http://dx.doi.org/10.7554/eLife.10130.025

() Western blotting of indicated signaling proteins in untreated (first three lanes), EGF- and Mn2+-treated TlnCtr, TlnKo and TlnKo cells re-expressing Venus-tagged talin-1 (TlnKo+T1V) (), and KindCtr, KindKo and KindKo cells re-expressing GFP-tagged kindlin-2 (KindKo+K2GFP) () seeded on FN. EGF, epidermal growth factor; FN, fibronectin; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; GFP, green fluorescent protein; K2GFP, green fluorescent protein-tagged kindlin-2; T1V, Venus-tagged full length talin-1.

DOI: http://dx.doi.org/10.7554/eLife.10130.026

() Cell spreading area of TlnKo () and KindKo cells () seeded on PLL, FN or on FN after FAKGFP overexpression measured by image quantification (n=3; independent repeats are pooled; >100 cells/condition and repeat; resulting areas are shown as binning histograms; significances are calculated between non-transfected cells and FAKGFP expressing cells plated on FN). FAK, focal adhesion kinase; FAKGFP, green fluorescent protein-tagged FAK; FN, fibronectin; GFP, green fluorescent protein; PLL, poly-L-lysine.

DOI: http://dx.doi.org/10.7554/eLife.10130.027

Figure 5—figure supplement 1.

FAK phosphorylation in TlnCtr, TlnKo, TlnKo+T1V, KindCtr, KindKo and KindKo+K2GFP cells.

() Densitometric quantification of western blot signals of lysates from untreated, EGF- and Mn2+-treated KindCtr, TlnKo and KindKo cells seeded either on FN or PLL and probed with anti-Tyr-397 phosphorylated FAK (pY397-FAK) antibodies (n=3 independent repeats; significances are calculated with respect to PLL adherent cells; error bars indicate standard error of the mean). () Western blotting of indicated signaling proteins in untreated, EGF- and Mn2+-treated TlnCtr, TlnKo and TlnKo cells re-expressing Venus-tagged talin-1 (TlnKo+T1V) (), and KindCtr, KindKo and KindKo cells re-expressing GFP-tagged kindlin-2 (KindKo+K2GFP) () seeded either on FN or PLL. EGF, epidermal growth factor; FAK, focal adhesion kinase; K2GFP, green fluorescent protein-tagged kindlin-2; FN, fibronectin; GFP, green fluorescent protein; PLL, poly-L-lysine; T1V, Venus-tagged full length talin-1.

DOI: http://dx.doi.org/10.7554/eLife.10130.024

Figure 5—figure supplement 2.

Kindlin-2 forms a ternary complex with paxillin and FAK.

GFP-IP in lysates of K2GFP-, K2ΔPHGFP- or GFP-reconstituted KindKo cells overexpressing Myc-tagged FAK (FAK-Myc) and Cherry-tagged paxillin (PxnCH). K2GFP but not K2ΔPHGFP forms a ternary complex with paxillin and FAK. FAK, focal adhesion kinase; GFP, green fluorescent protein; IP, immunoprecipitation; K2GFP, green fluorescent protein-tagged kindlin-2.

DOI: http://dx.doi.org/10.7554/eLife.10130.025

The kindlin/paxillin complex induces FAK signaling and cell spreading.

() FAK and EGFR activation after seeding serum-starved KindCtr, TlnKo and KindKo cells on PLL or FN and treating them with or without EGF and Mn2+. () Immunofluorescence staining of activated (Tyr-397 phosphorylated) FAK and F-actin in cells seeded on FN and treated with Mn2+ for 30 min (FAKGFP indicates exogenous expression of FAKGFP fusion protein). () FAK and Akt activation in KindKo cells stably transduced with K2GFP or K2ΔPHGFP either seeded on FN or kept in suspension. GFP indicates similar expression of transduced GFP-tagged constructs. GAPDH levels served to control loading. () Levels of phosphorylated signaling mediators downstream of FAK in Mn2+-treated, serum-starved or EGF-treated KindCtr, TlnKo and KindKo cells. GAPDH levels served to control loading. () Quantification of lamellipodia formation of FN-seeded TlnKo and KindKo cells treated with Mn2+ and either DMSO or the FAK inhibitor PF-228 (n=3 independent repeats; >100 cells/condition; error bars indicate standard error of the mean; significances are given in comparison to the DMSO control). () FAK activity in TlnKo and KindKo cells stably transduced with FAKGFP (n=3 independent experiments). () Quantification of lamellipodia formation in TlnKo and KindKo cells stably transduced with FAKGFP (n=3 independent experiments; significances are given in comparison to untreated control; error bars indicate standard error of the mean). Bar, 10 µm. DMSO, dimethyl sulfoxide; EGF, epidermal growth factor; EGFR, epidermal growth factor receptor; FAK, focal adhesion kinase; FAKGFP, green fluorescent protein-tagged FAK; FN, fibronectin; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; GFP, green fluorescent protein; PLL, poly-L-lysine. DOI: http://dx.doi.org/10.7554/eLife.10130.023

FAK phosphorylation in TlnCtr, TlnKo, TlnKo+T1V, KindCtr, KindKo and KindKo+K2GFP cells.

() Densitometric quantification of western blot signals of lysates from untreated, EGF- and Mn2+-treated KindCtr, TlnKo and KindKo cells seeded either on FN or PLL and probed with anti-Tyr-397 phosphorylated FAK (pY397-FAK) antibodies (n=3 independent repeats; significances are calculated with respect to PLL adherent cells; error bars indicate standard error of the mean). () Western blotting of indicated signaling proteins in untreated, EGF- and Mn2+-treated TlnCtr, TlnKo and TlnKo cells re-expressing Venus-tagged talin-1 (TlnKo+T1V) (), and KindCtr, KindKo and KindKo cells re-expressing GFP-tagged kindlin-2 (KindKo+K2GFP) () seeded either on FN or PLL. EGF, epidermal growth factor; FAK, focal adhesion kinase; K2GFP, green fluorescent protein-tagged kindlin-2; FN, fibronectin; GFP, green fluorescent protein; PLL, poly-L-lysine; T1V, Venus-tagged full length talin-1. DOI: http://dx.doi.org/10.7554/eLife.10130.024

Kindlin-2 forms a ternary complex with paxillin and FAK.

GFP-IP in lysates of K2GFP-, K2ΔPHGFP- or GFP-reconstituted KindKo cells overexpressing Myc-tagged FAK (FAK-Myc) and Cherry-tagged paxillin (PxnCH). K2GFP but not K2ΔPHGFP forms a ternary complex with paxillin and FAK. FAK, focal adhesion kinase; GFP, green fluorescent protein; IP, immunoprecipitation; K2GFP, green fluorescent protein-tagged kindlin-2. DOI: http://dx.doi.org/10.7554/eLife.10130.025

Activity of signaling mediators downstream of FAK in TlnCtr, TlnKo, TlnKo+T1V, KindCtr, KindKo and KindKo+K2GFP cells.

() Western blotting of indicated signaling proteins in untreated (first three lanes), EGF- and Mn2+-treated TlnCtr, TlnKo and TlnKo cells re-expressing Venus-tagged talin-1 (TlnKo+T1V) (), and KindCtr, KindKo and KindKo cells re-expressing GFP-tagged kindlin-2 (KindKo+K2GFP) () seeded on FN. EGF, epidermal growth factor; FN, fibronectin; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; GFP, green fluorescent protein; K2GFP, green fluorescent protein-tagged kindlin-2; T1V, Venus-tagged full length talin-1. DOI: http://dx.doi.org/10.7554/eLife.10130.026

Cell spreading of FAK overexpressing TlnKo and KindKo cells.

() Cell spreading area of TlnKo () and KindKo cells () seeded on PLL, FN or on FN after FAKGFP overexpression measured by image quantification (n=3; independent repeats are pooled; >100 cells/condition and repeat; resulting areas are shown as binning histograms; significances are calculated between non-transfected cells and FAKGFP expressing cells plated on FN). FAK, focal adhesion kinase; FAKGFP, green fluorescent protein-tagged FAK; FN, fibronectin; GFP, green fluorescent protein; PLL, poly-L-lysine. DOI: http://dx.doi.org/10.7554/eLife.10130.027 In line with previous reports showing that the paxillin/FAK complex can trigger the activation of p130Cas (Zhang et al., 2014) and, in cooperation with EGFR signaling, the activation of Akt (Sulzmaier et al., 2014, Deakin et al., 2012), we observed Y410-p130Cas, pT308-Akt, S473-Akt and pT202/pY204 Erk1/2 phosphorylation after Mn2+ and/or EGF treatment of FN-seeded control and rescued cells, and to a slightly lesser extent TlnKo cells (Figure 5D, Figure 5— figure supplement 3A,B). In contrast, FN-seeded KindKo cells failed to activate p130Cas and showed reduced Akt and Erk1/2 phosphorylation in response to EGF (Figure 5D, Figure 5—figure supplement 3A,B).
Figure 5—figure supplement 3.

Activity of signaling mediators downstream of FAK in TlnCtr, TlnKo, TlnKo+T1V, KindCtr, KindKo and KindKo+K2GFP cells.

() Western blotting of indicated signaling proteins in untreated (first three lanes), EGF- and Mn2+-treated TlnCtr, TlnKo and TlnKo cells re-expressing Venus-tagged talin-1 (TlnKo+T1V) (), and KindCtr, KindKo and KindKo cells re-expressing GFP-tagged kindlin-2 (KindKo+K2GFP) () seeded on FN. EGF, epidermal growth factor; FN, fibronectin; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; GFP, green fluorescent protein; K2GFP, green fluorescent protein-tagged kindlin-2; T1V, Venus-tagged full length talin-1.

DOI: http://dx.doi.org/10.7554/eLife.10130.026

Finally, we tested whether the impaired activity of FAK contributed to the spreading defect of KindKo cells by chemically inhibiting FAK activity in TlnKo cells or by overexpressing FAK in KindKo cells (Figure 5E–G). The experiments revealed that inhibiting FAK reduced lamellipodia formation of TlnKo cells to an extent that was similar to untreated KindKo cells (Figure 5E). Conversely, overexpression of FAKGFP in KindKo cells resulted in high active FAK, increased lamellipodial formation and increased cell spreading in TlnKo and KindKo cells (Figure 5F,G and Figure 5—figure supplement 4A,B).
Figure 5—figure supplement 4.

Cell spreading of FAK overexpressing TlnKo and KindKo cells.

() Cell spreading area of TlnKo () and KindKo cells () seeded on PLL, FN or on FN after FAKGFP overexpression measured by image quantification (n=3; independent repeats are pooled; >100 cells/condition and repeat; resulting areas are shown as binning histograms; significances are calculated between non-transfected cells and FAKGFP expressing cells plated on FN). FAK, focal adhesion kinase; FAKGFP, green fluorescent protein-tagged FAK; FN, fibronectin; GFP, green fluorescent protein; PLL, poly-L-lysine.

DOI: http://dx.doi.org/10.7554/eLife.10130.027

Altogether, these findings show that the kindlin-2/paxillin complex in NAs recruits and activates FAK to induce cell spreading and increase the strength of Akt signaling.

Discussion

While the functions of talin and kindlin for integrin activation, adhesion and integrin-dependent signaling in hematopoietic cells are firmly established, their roles for these processes in non-hematopoietic cells are less clear. To clarify this issue, we established mouse fibroblast cell lines that lacked either talin-1/2 (TlnKo) or kindlin-1/2 (KindKo) and tested whether they were able to activate integrins and mediate substrate adhesion and signaling. In line with previous reports (Bottcher et al., 2012; Margadant et al., 2012), the deletion of Tln1/2 or Fermt1/2 genes changed the surface levels of laminin- and collagen-binding integrins. Since surface levels of α5 and αv integrins remained unchanged between TlnKo and KindKo cells, we were able to establish the specific roles of talin and kindlin for the function of FN-binding integrins under identical conditions. A major finding of our study demonstrates that integrin affinity regulation (activation) is essential for fibroblast adhesion and depends on both talin and kindlin-2 (Figure 6A,D). The unambiguity of this finding was unexpected in light of several reports showing that integrin activation and integrin-mediated adhesion still occurs in talin-depleted cells, or is inhibited when kindlin-2 is overexpressed (Harburger et al., 2009; Wang et al., 2011; Lawson et al., 2012). The previous studies that addressed the functional properties of talin used siRNA-mediated protein depletion, a combination of gene ablation and siRNA technology, or approaches to interfere with talin recruitment to NAs either by ablating the talin upstream protein FAK or by expressing an integrin that harbors a mutation in the talin binding site. Since the majority of approaches deplete rather than eliminate proteins from cells and adhesion sites, the respective cells were most likely recruiting sufficient residual protein to adhesion sites to allow integrin activation, cell adhesion and spreading, and the assembly of adhesion- and signaling-competent NAs. It is possible that not all integrin molecules have to be occupied by talin and therefore low levels of talin suffice, particularly in NAs that were shown by fluorescence correlation spectroscopy to contain only half the number of talin relative to α5β1 integrin and kindlin-2 molecules (Bachir et al., 2014). However, when the entire pool of talin is lost or decreased below certain thresholds (Margadant et al., 2012) integrins remain inactivate and consequently adhesion sites do not form. With respect to kindlin, it was reported that overexpressed kindlin-2 in CHO cells inhibits rather than promotes talin head domain-induced α5β1 integrin activation (Harburger et al., 2009). An integrin inhibiting effect of kindlin-2 is inconsistent with our study, which identified a crucial role for kindlin in integrin activation, as well as with other studies also demonstrating that kindlin-2 promotes integrin functions (Montanez et al., 2008). It could well be that the reported inhibition of α5β1 by kindlin-2 represents an artifact that arose from protein overexpression.
Figure 6.

Model for the roles of talin and kindlin during inside-out and outside-in signaling of α5β1 integrin.

Integrin subunits are modelled according to Zhu et al. (2008), with the α5 subunit in green and the β1 subunit in blue showing the bent and clasped low affinity and the extended and unclasped high affinity conformations; the 9EG7 epitope is marked as red dot at the β1 leg and the FN ligand as beige dimers. () α5β1 integrin fails to shift from a bent to an extended/unclasped, high affinity state in the absence of talin-1/2 or kindlin-1/2; the bent/clasped conformation brings the EGF-2 domain of the β subunit in close contact with the calf domain of the α5 subunit and prevents exposure of the 9EG7 epitope. () In the absence of talin (TlnKo) and presence of Mn2+, kindlin-2 allows adhesion by stabilizing the high affinity conformation of a low number of integrins and the direct binding of paxillin, leading to nucleation of integrins, recruitment of FAK, FAK-dependent signaling and lamellipodia formation. () In the absence of kindlins (KindKo), talin stabilizes the high affinity conformation of a low number of integrins but does not enable paxillin recruitment and lamellipodia formation. () In normal fibroblasts, binding of kindlin and talin to the β1 tail is associated with the stabilisation of the unclasped α5β1 heterodimer and 9EG7 epitope exposure. () Kindlin recruits paxillin and FAK through the kindlin-PH domain and ILK/Pinch/Parvin (IPP; not shown) in a talin-independent manner and induces cell spreading, proliferation and survival. () The high affinity conformation of α5β1 integrin is stabilized by linkage of the β1 tail to the actin cytoskeleton through talin (and potentially the IPP complex; not shown). The arrow length indicates integrin conformations existing at equilibrium. EGF, epidermal growth factor; FAK, focal adhesion kinase; FN, fibronectin; ILK, integrin-linked kinase; IPP, integrin-linked kinase-Pinch-Parvin; SFK, src family kinases.

DOI: http://dx.doi.org/10.7554/eLife.10130.028

Model for the roles of talin and kindlin during inside-out and outside-in signaling of α5β1 integrin.

Integrin subunits are modelled according to Zhu et al. (2008), with the α5 subunit in green and the β1 subunit in blue showing the bent and clasped low affinity and the extended and unclasped high affinity conformations; the 9EG7 epitope is marked as red dot at the β1 leg and the FN ligand as beige dimers. () α5β1 integrin fails to shift from a bent to an extended/unclasped, high affinity state in the absence of talin-1/2 or kindlin-1/2; the bent/clasped conformation brings the EGF-2 domain of the β subunit in close contact with the calf domain of the α5 subunit and prevents exposure of the 9EG7 epitope. () In the absence of talin (TlnKo) and presence of Mn2+, kindlin-2 allows adhesion by stabilizing the high affinity conformation of a low number of integrins and the direct binding of paxillin, leading to nucleation of integrins, recruitment of FAK, FAK-dependent signaling and lamellipodia formation. () In the absence of kindlins (KindKo), talin stabilizes the high affinity conformation of a low number of integrins but does not enable paxillin recruitment and lamellipodia formation. () In normal fibroblasts, binding of kindlin and talin to the β1 tail is associated with the stabilisation of the unclasped α5β1 heterodimer and 9EG7 epitope exposure. () Kindlin recruits paxillin and FAK through the kindlin-PH domain and ILK/Pinch/Parvin (IPP; not shown) in a talin-independent manner and induces cell spreading, proliferation and survival. () The high affinity conformation of α5β1 integrin is stabilized by linkage of the β1 tail to the actin cytoskeleton through talin (and potentially the IPP complex; not shown). The arrow length indicates integrin conformations existing at equilibrium. EGF, epidermal growth factor; FAK, focal adhesion kinase; FN, fibronectin; ILK, integrin-linked kinase; IPP, integrin-linked kinase-Pinch-Parvin; SFK, src family kinases. DOI: http://dx.doi.org/10.7554/eLife.10130.028 Integrin activation can be induced with Mn2+, whose binding to the ectodomain of β subunits directly shifts integrins into the high affinity state without the requirement for inside-out signals (Mould et al., 1995). We observed that Mn2+-treated TlnKo and KindKo cells expressed the activation-dependent epitope 9EG7 and adhered to FN, albeit at significantly lower levels and efficiencies than the normal parental or rescued cells (Figure 6B,C). This observation strongly indicates that talin and kindlin also cooperate to maintain the extended and unclasped conformation of active integrins. Although it is not known how talin and kindlin keep integrins in an active state, it is possible that they stabilize this conformation by linking the unclasped β integrin cytoplasmic domain to the plasma membrane and/or to cortical actin, which may firmly hold separated integrin α/β subunits apart from each other. The expression of mutant talins and kindlins in our cells should allow us to examine these possibilities in future. Finally, our study also revealed that Mn2+-treated TlnKo cells began to form large, circumferential lamellipodia that eventually detached from FN, leading to the collapse of the protruded membrane. This initial isotropic spreading was significantly less frequent in KindKo cells, and has also been observed in talin-2-depleted talin-1–/– cells on FN, although these cells did not require Mn2+ for inducing spreading, which is likely due to the presence of residual talin-2 that escaped siRNA-mediated depletion (Zhang et al., 2008; Zhang et al., 2014). These findings strongly suggest that integrin binding to FN enables kindlin-2 in TlnKo cells to cluster β1 integrins (as shown for αIIbβ3 by kindlin-3 in Ye et al., 2013) and to trigger a signaling process that initiates spreading. To find a mechanistic explanation for the kindlin-2-mediated cell spreading, we used the yeast-two-hybrid technology to identify paxillin as a novel and direct binding partner of kindlin-2. The interaction of the two proteins occurs through the LIM3 domain of paxillin, which was previously identified as integrin adhesion-targeting site (Brown et al., 1996), and the PH domain of kindlin-2. It is not unusual that PH domains fulfill dual roles by binding phospholipids and proteins, either simultaneously or consecutively (Scheffzek and Welti, 2012). The expression of a PH domain-deficient kindlin-2 in KindKo cells rescues adhesion to FN and FA maturation, however, significantly impairs spreading and plasma membrane protrusions. This finding together with the observations that paxillin-null fibroblasts and embryonic stem cells have defects in spreading, adhesion site remodeling and formation of lamellipodia (Hagel et al., 2002, Wade et al., 2002) indicates that the kindlin-2/paxillin complex induces the elusive signaling process, leading to initial spreading of TlnKo and talin-depleted cells (Zhang et al., 2008). Indeed, the kindlin-2/paxillin complex in NAs recruits FAK (Deramaudt et al., 2014, Thwaites et al., 2014; Choi et al., 2011), which cooperates with growth factor receptors (such as EGFR) to induce signaling pathways that activate Erk and Akt to promote proliferation and survival, as well as Arp2/3 and Rac1 to induce actin polymerization and membrane protrusions (Figure 6B,E). Kindlin-2 also recruits ILK, which binds in the vicinity of the kindlin-2 PH domain and links integrins to actin and additional signaling pathways (Figure 6E). The short-lived nature of the initial spreading of TlnKo and talin-depleted (Zhang et al., 2008) cells shows that talin concludes the integrin-mediated adhesion process in NAs (Figure 6F) and induces the maturation of FAs. The formation of paxillin-positive FAs in cells expressing the PH domain-deficient kindlin-2 suggests that the recruitment of paxillin to FAs occurs either in a kindlin-independent manner or through a modification of kindlin in a second binding motif.

Materials and methods

Mouse strains and cell lines and cell culture

The floxed kindlin-1 (Fermt1), floxed talin-1 (Tln1) and the constitutive talin-2-null (Tln2) mouse strains have been described (Rognoni et al., 2014; Nieswandt et al., 2007; Conti et al., 2009). The floxed kindlin-2 (Fermt2) mouse strain generated via recombinant recombination in embryonic stem cells (Fassler and Meyer, 1995) carries loxP sites flanking exon 15, which contains the stop codon and the polyadenylation signal of the murine Fermt2 gene. Homologous recombination and germ line transmission were verified by Southern blots, and the frt-flanked neo cassette was removed with a transgenic mouse strain carrying a deleter-flipase gene. Floxed talin-1 and talin-2-null mice, and floxed kindlin-1 and kindlin-2 mice were intercrossed to generate Tln1 and Fermt1mice. The cell lines used in this study are mouse fibroblasts derived from the kidneys of 21 d old mice, immortalized by retrovirally transducing the SV40 large T antigen, cloned (TlnCtr and KindCtr) and finally infected with an adenovirus to transduce the Cre recombinase resulting in talin-null (TlnKo) and kindlin-null (KindKo) cells. The parental cell lines were authenticated based on morphological criteria and the surface experession of specific integrins. All cells were cultured under standard cell culture conditions using Dulbecco's modified Eagle's medium (DMEM) supplemented with 8% fetal calf serum (FCS) and Penicillin/Streptomycin but not subjected to mycoplasma contamination testing.

Flow cytometry

Flow cytometry was carried out with a FACSCantoTMII cytometer (BD Biosciences, Franklin Lakes, NJ, USA) equipped with FACS DiVa software (BD Biosciences) using standard procedures. Data analysis was carried out with the FlowJo program (version 9.4.10). Fibroblasts were incubated with primary antibodies diluted in FACS-Tris buffered saline (FACS-TBS; 30 mM Tris, pH 7.4, 180 mM NaCl, 3.5 mM KCl, supplemented with 1 mM CaCl2, 1 mM MgCl2, 3% BSA, 0,02% NaN3) for 1 hr on ice, washed twice with cold FACS-TBS and finally incubated with the secondary antibody for 45 min on ice.

Real-time polymerase chain reaction

Total RNA was extracted with the RNeasy Mini extraction kit (Qiagen, Germany) from cultured cells, cDNAs were prepared with an iScript cDNA Synthesis Kit (BioRad, Germany) and real-time polymerase chain reaction (PCR) was performed with an iCycler (BioRad). Each sample was measured in triplicate and values were normalized to Gapdh. Primer sequences for Lpxn and Pxn were from PrimerBank (Spandidos et al., 2010) (Lpxn: 26080416a1; aPxn: 114326500c2; bPxn: 22902122a1), GAPDH primers were described before (Rognoni et al., 2014) and Hic5 primers were newly designed (Hic5-fwd: 5’-ttcctttgcagcggttgttcc-3’; Hic5-rev: 5’-ggttacagaagccacatcgtggg-3’).

Antibodies and inhibitors

The following antibodies or molecular probes were used at indicated concentrations for western blot (WB), immunofluorescence (IF) or flow cytometry (FACS): kindlin-1 (home made), (Ussar et al., 2008) WB: 1:5000, IF: 1:1000; kindlin-2 (MAB2617 from Millipore, Germany) WB: 1:1000, IF: 1:500; talin (8D4 from Sigma, Germany) WB: 1:1000; talin (sc-7534 from Santa Cruz, Germany) IF: 1:500; talin-1 (ab57758 from Abcam, UK) WB: 1:2000; talin-2 (ab105458 from Abcam) WB: 1:2000; GAPDH (6C5 from Calbiochem, Billerica, MA, USA) WB: 1:10,000; Paxillin (610051 from BD Transduction Laboratories, Franklin Lakes, NJ, USA) WB: 1:1000, IF: 1:400; integrin β1-488 (102211 from Biolegend, San Diego, CA, USA) IF: 1:400, FACS: 1:200; integrin β1 (MAB1997 from Chemicon, Billerica, MA, USA) FACS: 1:400; integrin β1-647 (102213 from Biolegend) IF: 1:200; integrin β1 (home-made), (Azimifar et al., 2012) IF: 1:400; integrin β3-biotin (553345 from PharMingen, Franklin Lakes, NJ, USA) FACS: 1:200; integrin β3 (M031-0 from Emfret, Germany) IF: 1:200; integrin α2-FITC (554999 from BD Biosciences) FACS: 1:100; integrin α3 (AF2787 from R&D, Germany) FACS: 1:200; integrin α5-biotin (557446 from Pharmingen) FACS: 1:200, IP 1µg; integrin α5 (4705 from Cell Signaling, Germany) WB: 1:1000; integrin α6-FITC (555735 from Pharmingen) FACS 1:100; integrin αv-biotin (551380 from Pharmingen) FACS: 1:200; β1-integrin 9EG7 (550531 from BD Biosciences, San Diego, CA, USA) IF: 1:200; FACS: 1:200; fibronectin (AB2033 from Millipore) IF: 1:500; IgG2a rat isotype control (13-4321 from eBioscience, Germany) FACS: 1:200; IP 1µg; Tritc-Phalloidin (P1951 from Sigma) IF: 1:400; Flag-tag-HRP (8592 from Sigma) WB: 1:10,000; GFP (A11122 from Invitrogen, Germany) WB: 1:2000; Cherry (PM005 from MBL, Woburn, MA, USA) WB:1:1000; Myc (05-724 from Millipore) WB 1:2000; FAK (06-543 from Upstate, Billerica, MA, USA) WB: 1:1000; FAK (3285 from Cell Signaling) WB (1:1000); phospho-Y397 FAK (3283 from Cell Signaling) WB: 1:1000; phospho-Y397 FAK (44624G from Biosource, Waltham, MA, USA) WB: 1:1000, IF: 1:400; ILK (611803 from Transduction Labs) WB: 1:5000; IF: 1:500; phospho-Y992 EGFR (2235 from Cell Signaling) WB: 1:2000; phospho-Y31 Paxillin (44720G from Invitrogen) WB: 1:1000; phospho-Y118 Paxillin (44722G from Invitrogen) WB: 1:1000; p130Cas (P27820 Transduction Labs) WB: 1:1000; phospho-Y410 p130 Cas (4011S from Cell Signaling) WB: 1:1000; Akt (9272 from Cell Signaling) WB: 1:1000; phospho-S473 Akt (4060 from Cell Signaling) WB: 1:1000; phosho-T308 Akt (9275 from Cell Signaling) WB: 1:1000; Erk1/2 (9102 from Cell Signaling) WB: 1:1000; Erk1/2 phosphorylated T202 Y204 (4376 Cell Signaling) WB: 1:1000. The following secondary antibodies were used: goat anti-rabbit Alexa 488 (A11008), goat anti-mouse Alexa 488 (A11029), goat anti-rat Alexa 488 (A11006), goat anti-mouse Alexa 546 (A11003), donkey anti-mouse Alexa 647 (A31571), goat anti-rabbit Alexa 647 (A21244), (all from Invitrogen) FACS: 1:500, IF: 1:500; streptavidin-Cy5 (016170084) FACS: 1:400; goat anti-rat horseradish peroxidase (HRP) (712035150) (both from Dianova, Germany) WB: 1:10,000, donkey anti-rabbit Cy3 (711-165-152) (from Jackson ImmunoResearch, West Grove, PA, USA) IF: 1:500, goat anti-mouse HRP (172-1011) and goat anti-rabbit HRP (172-1019) (both from BioRad) WB: 1:10,000. The FAK inhibitor PF-228 (PZ0117 from Sigma) was dissolved in dimethyl sulfoxide at 10 mM and used at 1:2000.

Expression and purification of recombinant proteins

The recombinant expression of kindlin-2, full-length paxillin (paxillin-FL) and paxillin-LIM3 in Escherichia coli Rosetta cells (Merck Millipore) was induced with 1 mM or 0.2 mM IPTG, respectively, at 18°C for 22 hr. After cell lysis and clarification of the supernatant, kindlin-2 was purified by Ni-NTA affinity chromatography (Qiagen). Eluate fractions containing kindlin-2 were pooled, cleaved with SenP2 protease and purified by size-exclusion chromatography (Superdex 200 26/600, GE Healthcare, UK) yielding unmodified murine kindlin-2. The paxillin constructs were purified by Ni-NTA affinity chromatography (Qiagen), and subsequent size-exclusion chromatography (SEC650, BioRad) to obtain N-terminally tagged His10-SUMO3-paxillin-FL and His10-SUMO3-paxillin-LIM3 domain, respectively.

Immunostaining

For immunostaining, cells were cultured on plastic ibidi-µ-slides (80826 from Ibidi, Germany) coated with 20 µg ml–1 FN (Calbiochem). Cells were routinely fixed with 4% paraformaldehyde (PFA) (w/v) in phosphate buffered saline (PBS; 180 mM NaCl, 3.5 mM KCl, 10 mM Na2HPO4, 1.8 mM K2H2PO4) for 10 min at room temperature (RT) or with –20°C cold acetone–methanol when indicated. If necessary, cells were solubilized with staining buffer (PBS supplemented with 0.1% Triton X-100 (v/v) and 3% BSA (w/v)) or with –20°C cold methanol for kindlin-2 staining. Background signals were blocked by incubating cells for 1 hr at RT in staining buffer. Subsequently, they were incubated in the dark with primary and secondary antibodies diluted in staining buffer. Fluorescent images were aquired with a LSM 780 confocal microscope (Zeiss, Germany) equiped with a 100×/NA 1.46 oil objective and with a DMIRE2-SP5 confocal microscope (Leica, Germany) equiped with a 40×/NA 1.25 or 63×/NA 1.4 oil objective using Leica Confocal software (version 2.5 build 1227). Brightfield images were aquired with an Axioskop (Carl Zeiss) 40×/NA 0.75 objective and DC500 camera with IM50 software (Leica). Z-stack projection and contrast adjustments ImageJ (v1.47) were used for further image analysis. Super-resolution imaging was carried out by direct stochastic optical reconstruction microscopy (dSTORM) (van de Linde et al., 2011), which is based on precise emitter localization. To induce reversible switching of the Alexa 647 label and reduce photobleaching, imaging was performed in imaging solution (50% Vectashield (v/v) (H-1000; Vector Laboratories, Burlingame, CA, USA), 50% TBS (v/v), pH=8.0) supplemented with 50 mM β-mercaptoethylamine (Sigma-Aldrich; M9768). dSTORM was implemented on a custom built total internal reflection fluourescence (TIRF) system (Visitron Systems, Germany) based on a Zeiss Axiovert 200M with fiber-coupled lasers. Sample were excited with a 640 nm laser in a TIRF mode using a Zeiss α Plan-Fluar 100×/NA 1.45 oil objective. The emitted light was detected in the spectral range 660–710 nm through a Semrock FF02-685/40-25 bandpass filter (Semrock Inc., Rochester, NY, USA). Images were recorded with a Photometrics Evolve Delta emCCD camera (Photometrics, Huntington Beach, CA, USA), with its EM gain set to 250. Additional magnification by a factor of 1.6 resulted in a pixel size of 100 nm. For each final image, a total of 20,000 frames with an exposure time of 14 ms were recorded. A standard TIRF imaging of the same sample in the green channel (anti-paxillin) was achieved by illumination with a 488 nm laser and detection in the spectral range 500–550 nm through a Chroma Et 525/50 bandpass filter (Chroma Technology Corporation, Bellows Falls, VT, USA). Simultaneous dual-colour imaging of both the green and the red channel was realized with a Hamamatsu W-View Gemini image splitter (Hamamatsu Photonics, Bridgewater, NJ, USA) mounted between the microscope and the camera. Image analysis was carried out with the ImageJ plugin ThunderSTORM (Ovesny et al., 2014) and standard tools of ImageJ. Heat maps of density of blink events were created using the 2D-Frequency Count/Binning module of OriginPro 9.1 (OriginLab Corporation, Northampton, MA, USA).

AFM-based single-cell force spectroscopy

Tipless, 200 µm long V-shaped cantilevers (spring constants of 0.06 N m–1; NP-O, Bruker, Billerica, MA, USA) were prepared for cell attachment as described (Friedrichs et al., 2010). Briefly, plasma cleaned cantilevers were incubated in 2 mg ml–1 ConA (Sigma) in PBS at 4°C overnight. Polydimethylsiloxan (PDMS) masks were overlaid on glass bottoms of Petri dishes (35 mm FluoroDish, World Precision Instruments, Sarasota, FL, USA) to allow different coatings of the glass surface (Te Riet et al., 2014). PDMS-framed glass surfaces were incubated overnight with 50 µg ml–1 FN-RGD and 50 µg ml–1 FN-∆RGD in PBS at 4°C. Overnight serum-starved fibroblasts (TlnCtr, KindCtr, TlnKo, KindKo) grown on FN-coated (Calbiochem) 24 well plates (Thermo Scientific, Denmark) to confluency of ~ 80% were washed with PBS and detached with 0.25% (w/v) trypsin/EDTA (Sigma). Detached cells were suspended in single-cell force spectroscopy (SCFS) medium (DMEM supplemented with 20 mM HEPES) containing 1% (v/v) FCS, pelleted and further resuspended in serum-free SCFS medium. Detached cells were left suspended in SCFS media to recover from detachment for ~1 hr (Schubert et al., 2014). For the activation or chelation assay, the detached cells were incubated in SCFS media supplemented with 0.5 mM Mn2+ or 5 mM EDTA, respectively, for ~1 hr and SCFS was performed in the presence of the indicated supplement. SCFS was performed using an AFM (NanoWizard II, JPK Instruments, Germany) equipped with a CellHesion module (JPK Instruments) mounted on an inverted optical microscope (Zeiss Axiovert 200M). Measurements were performed at 37°C, controlled by a PetriDish Heater (JPK Instruments). Cantilevers were calibrated using the equipartition theorem (Hutter and Bechhoefer, 1993). To attach a single cell to the cantilever, cell suspensions were pipetted to the region containing the FN-∆RGD coating. The ConA functionalized cantilever was lowered onto a single cell with a velocity of 10 µm s−1 until reaching a contact force of 5 nN. After 5 s contact, the cantilever was retracted from the Petri dish by 50 µm and the cantilever-bound cell was left for incubation for >10 min. For adhesion experiments, the cantilever-bound cell was brought into contact with the FN-∆RGD coated support at a contact force of ~2 nN for 5, 20, 50 and 120 s and then retracted while measuring the cantilever deflection and the distance travelled. Subsequently, the cell adhesion to the FN-RGD coated support was characterized as described. In case cantilever attached cells showed morphological changes (e.g. spreading) they were discarded. The approach and retract velocity of the cantilever was 5 µm s–1. The deflection of the cantilever was recorded as force-distance curves. Adhesion forces were extracted from retraction force-distance curves using the AFM data processing software (JPK Instruments).

Immunoprecipitations and recombinant protein pulldown

GFP-IPs were performed using µ-MACS anti-GFP magnetic beads (130-091-288 from Miltenyi, Germany). To pulldown recombinant kindlin-2 35 µg of purified His10-LIM3 or 10 µg of purified His10-paxillin-FL were incubated with 100 µl of 50% Ni-NTA-Agarose slurry (Qiagen) in pulldown buffer (20 mM Tris, pH 7.5, 200 mM NaCl, 1 mM TCEP, 0.05% Tween20) for 1 hr at 4°C. After a first wash with 20 column volumes (CV) of pulldown buffer supplemented with 1 mM ZnCl2 and a second wash with 20 CV of pulldown buffer, 14 µg of purified kindlin-2 were added to 100 µl of Ni-NTA-agarose slurry and incubated for 30 min at 4°C. Subsequently, the Ni-NTA beads were washed three times with 20 CV of pulldown buffer supplemented with 25 mM imidazole and either 1 mM ZnCl2 or 1 mM EDTA. The beads were eluted with 50 µl pulldown buffer supplemented with 500 mM imidazole and analysed on a 12% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). For immunoprecipitation of kindlin-2 or paxillin, control fibroblasts were lysed in lysis buffer (50 mM Tris, pH 8.0, 150 mM NaCl, 1% Triton X-100, 0.05% sodium deoxycholate, 10 mM EDTA). Lysates were incubated with kindlin-2 or paxillin antibodies for 2 hr at 4°C while rotating. Isotype-matched IgG was used as a negative control. After this, lysates were incubated with 50 µl protein A/G Plus Agarose (Santa Cruz) for 2 hr at 4°C. Following repeated washes with lysis buffer, proteins were eluted from the beads using Laemmli buffer and analyzed by western blotting. For the immunoprecipitation of α5 integrin from the cell surface of live cells, α5 integrins were labeled with a biotinylated anti-α5 integrin antibody (PharMingen #557446) or an isotype control (eBioscience # 13-4321) for 1 hr on ice. After two washes in ice-cold PBS to remove unbound antibody, cells were lysed in IP buffer (50 mM Tris, pH 7.5, 150 mM NaCl, 1% Triton X-100, 0.1% sodium deoxycholate, 1mM EDTA, and protease inhibitors) and cleared by centrifugation. α5 integrin immuno-complexes were pulled-down by incubation with streptavidin-sepharose (GE Healthcare) overnight at 4°C with gentle agitation. After several washes with lysis buffer, proteins were subjected to SDS-PAGE and western blot analysis with antibodies against α5 and β1 integrin.

Spreading and adhesion assays

Cells were grown to 70% confluency and then detached using trypsin/EDTA. Suspended cells were serum starved for 1 hr in adhesion assay medium (10 mM HEPES, pH 7.4; 137 mM NaCl; 1 mM MgCl2; 1 mM CaCl2; 2.7 mM KCl; 4.5 g L–1 glucose; 3% BSA (w/v)) before 40,000 cells per well were plated out in the same medium supplemented with 8% FCS, and 5 mM Mn2+ if indicated. Plastic ibidi-µ-slides (Ibidi; 80826) were coated with 10 µg ml–1 FN (Calbiochem) for adhesion or 20 µg ml–1 FN for spreading assays, 10 µg ml–1 LN (11243217001 from Roche, Germany), 10 µg ml–1 COL (5005B from Advanced Bio Matrix, Carlsbad, CA, USA), 10 µg ml–1 VN (07180 from StemCell, Canada) or 0.1% PLL (w/v) (Sigma; P4707) diluted in PBS. Seeded cells were centrifuged at 600 rpm in a Beckman centrifuge for 30 min at 37°C before they were fixed with 4% PFA (w/v) in PBS and stained with Phalloidin-TRITC and DAPI. For cell adhesion assays, nuclear staining of the whole well was imaged using a 2.5x objective and cell numbers were counted using ITCN plugin for imageJ (Byun et al., 2006). For cell spreading assays, 12 confocal images of different regions of Phalloidin and DAPI stained cells were aquired using a Leica confocal microscope, cell spreading was quantified using imageJ. For time dependent and ligand concentration dependent adhesion on FN, 40,000 cells were plated on 96-well plates, vigorously washed after the indicated timepoints with PBS and fixed with 4% PFA. Cell attachment was meassured by crystal violet staining (0.1% in 20% methanol) of cells in a absorbance plate reader at the wavelength of 570 nm.

Live cell imaging

A hole of 15 mm diameter was drilled into the bottom of a 35 mm falcon tissue culture dish (353001, Becton Dickinson) and a coverslip (Ø 25 mm, Menzel-Gläser, Germany), rinsed with ethanol, was glued to the dish with silicon glue (Elastosil E43, Wacker, Germany). After coating coverslips with 20 µg ml–1 FN (Calbiochem) overnight at 4°C, cells were plated and imaged in an inverted transmission light microscope (Zeiss Axiovert 200 M, Carl Zeiss) equipped with a climate chamber. Phase contrast images were taken with a ProEM 1024 EMCCD camera (Princeton Instruments, Acton, MA, USA) through a Zeiss Plan Neofluar 100x objective (NA 1.3, Ph3). Frames were acquired at 30 sec or 1 min intervals and converted to time lapse movies using ImageJ.

Constructs and transfections

K2ΔPHGFP was cloned by PCR using the K2GFP cDNA (Ussar et al., 2006) as template and the Kind2fwd (5’-ctcgaggaggtatggctctggacgggataag -3’, Kind2PHrev 5’-tggtcttgcctttaatatagtcagcaagtt -3’), Kind2PHfwd (5’-ctatattaaaggcaagaccatggcagacag -3’) and Kind2rev (5’- tctagatcacacccaaccactggtga-3’) primers. The two fragments containing homologous regions (indicated with bold letters in the primer sequences) were fused by another round of amplification using the most 5’ and 3’ primers (Kind2fwd and Kind2rev). The resulting PCR product was cloned into the K2GFP vector. The N- and C-terminal truncation constructs of kindlin-2 were cloned by PCR using K2GFP as template. The primer sequences were: Kind2-NT-fwd 5’-ctgtacaagtccggactc-3’, Kind2-NT-rev 5’-gcggccgcctattttgctttatcaagaagagc-3’, Kind2-CT-fwd 5’-ctcgagctatggataaagcaaaaaccaaccaag-3’, Kind2-CT-rev 5’-gttatctagagcggccgc-3’. Stable expression of K2ΔPHGFP and FAKGFP- or Myc-FAK (a gift from Dr. Ambra Pozzi; Vanderbilt University, Nashville, USA) cDNAs was achieved with the sleeping beauty transposase system (Bottcher et al., 2012). Kindlin-1-GFP and Kindlin-3-GFP constructs have been described (Ussar et al., 2008; Moser et al., 2008). For stable expression of murine talin-1 and THD (amino acids1-443), the corresponding cDNAs were N-terminally tagged with Venus and cloned into the retroviral pLPCX vector. The constructs for GFP-tagged paxillin-LIM truncation mutants were generated by PCR from GFP- and Cherry-tagged α-paxillin (Moik et al., 2013) and cloned into the retroviral pLPCX vector. The primer sequences were: stop codon in bold: ΔLIM1-4fwd 5’- caccgttgccaaatgagggtctgtggagcc -'3, ΔLIM1-4rev 5’- ggctccacagaccctcatttggcaacggtg -'3, ΔLIM2-4fwd 5’- cagcctcttctccccatgacgctgctactactg -'3, ΔLIM2-4rev 5’- cagtagtagcagcgtcatggggagaagaggctg -'3, ΔLIM3-4fwd 5’- aagattacttcgacatgtttgcttgacccaagtgcggc -'3, ΔLIM3-4rev 5’- gccgcacttgggtcaagcaaacatgtcgaagtaatctt -'3, ΔLIM4fwd 5’- ggcgcggctcgtgactgtgctccgg -'3, ΔLIM4rev 5’- ccggagcacagtcacgagccgcgcc -'3). The cDNA of murine Hic5 was amplified from a cDNA derived from murine vascular smooth muscle cells, cloned into pCR2.1-TOPO (Invitrogen) and subcloned into pEGFP-C1 vector. Murine leupaxin cDNA (cloneID: 5065405 from Thermo Scientific, Germany) was PCR-amplified (Lpxn-fwd: 5’- ctcgagcaatggaagagctggatgccttattg -3’; Lpxn-rev 5’- gaattcctactgtgaaaagagcttagtgaagc -3’) and subcloned into the pEGFP-C1 vector. To express recombinant murine kindlin-2 and paxillin-LIM3 (A473-S533) cDNAs were fused with N-terminal tandem tags consisting of 10x-Histidine followed by a SUMO3-tag and cloned into pCoofy17. The primer sequences for amplifying the paxillin-LIM3 domain were: LIM3fwd 5’-aaccggtggagctcccaagtgc-3’ and LIM3rev 5’-ttctcgagttacgagccgcgcc-3’. The plasmid carrying FNIII7-10 cDNA has been described previously (Takahashi et al., 2007). For Y2H analysis, the kindlin-2 cDNA was PCR amplified using the primers K2-Bamfw: 5’-gggatcccactgggcctaatggctctggacgggataagg-3’ and K2-Salrev: 5’-gtgtcgacgtcacacccaaccactggtgagtttg-3’ and cloned into the pGBKT7 plasmid to obtain a kindlin-2 version that was N-terminally fused with the Gal4-DNA binding domain. Screening of this construct against a human full ORF library was conducted by the Y2H protein interaction screening service of the German Cancer Research Center in Heidelberg, Germany.

Statistical analysis

Experiments were routinely repeated at least three times and the repeat number was increased according to the effect size or sample variation. Unless stated differently, all statistical significances (*P<0.05; **P<0.01; ***P<0.001; n.s., not significant) were determined by two-tailed unpaired t-test. In the boxplots, the middle line represents the median, the box ends represent the 25th and 75th percentiles and the whisker ends show the 5th and 95th percentiles. Statistical analysis were performed with Prism (GraphPad, La Jolla, CA, USA). eLife posts the editorial decision letter and author response on a selection of the published articles (subject to the approval of the authors). An edited version of the letter sent to the authors after peer review is shown, indicating the substantive concerns or comments; minor concerns are not usually shown. Reviewers have the opportunity to discuss the decision before the letter is sent (see review process). Similarly, the author response typically shows only responses to the major concerns raised by the reviewers. Thank you for submitting your work entitled "Kindlin-2 cooperates with talin to activate integrins and induces cell spreading by directly binding paxillin" for peer review at eLife. Your submission has been favorably evaluated by Vivek Malhotra (Senior editor) and three reviewers. The reviewers have discussed the reviews with one another and the Senior editor has drafted this decision to help you prepare a revised submission. Summary: The authors provide evidence in support of the hypothesis that talins and kindlins have a role in the activation of fibronectin-binding integrins in mesenchymal cells. They also identify a potential novel mechanism through which fibronectin-binding integrins can activate FAK and promote spreading and proliferative and survival signalling via formation of lamellipodia. These findings are highly significant, however, the authors need to show that kindlin regulates integrin's affinity for its ligands and identify the signalling pathways regulated by kindlin and their functional significance. The specific major (essential) revisions and minor issues of the reviewers follow. Essential revisions: 1) The results in Figure 2E are really interesting but, rather than measuring adhesion to fibronectin, the authors should measure the binding of the soluble cell binding domain of fibronectin and of Mab 9EG7 to suspended cells +/- Mn2+. Expression of Rap1-V12 from an inducible promoter can be used to "physiologically" activate integrins. 2) The proposed proliferative defect shown in Figure 1—figure supplement 3A is just a modest delay in entry in S phase. If the cells were just plated, it may be a consequence of the delayed spreading. Growth curves over 1 week would be necessary to strengthen the contention that kindlins promote cell proliferation. In addition, the proposed survival defect shown in Figure 1—figure supplement 3B is non-existent as the talin and the kindlin KO cells survive very well (only 0.5 to 1% of them undergo apoptosis). Importantly, the immunoblotting experiments in Figure 5 are superficial. They need to be extended to include cells not treated with Mn2+ as well as talin KO cells reconstituted with talin. In addition, the phosphorylation of paxillin, Akt at residue T408 (the required PDK1 site), p70-S6K, S6, 4E-BP1, Raf, MEK and ERK has not been studied. Finally, that FAK kinase activity necessarily plays a role in signaling downstream of kindlins is not convincing as PF-228 is used at 5 μM (25x dose required to inhibit FAK 397 in most cells). 3) The contention that loss of talins or kindlins changes the repertoire of fibronectin-binding integrins in a similar fashion (Figure 2A) is not convincing. The data seem to suggest that there is a switch from α-v β-3 to α-v β-5 and that the decreased expression of α-3 and α-6 allows equal expression of α-5 in kindlin-null cells, but the changes may be more complex as the authors have not examined the expression of α-v β-1. The most definitive way to address the issue is to purify fibronectin-binding integrins from surface-labeled cells by affinity chromatography on Fn-CBD in the presence of Mn2+ and subject the eluted proteins to IP with anti-α-v, α-5, β-1, β-3, and β-5. 4) The sections describing effects of talin and kindlin on integrin "activation" are quite confusing, although it is clear that talin and kindlin are important for adhesion to Fn. Mn2+ activation clearly does partially rescue the adhesion defect of both talin and kindlin deficient cells, but the AFM profiles for talin and kindlin deficient cells look completely different in the presence of Mn2+. This should be emphasized in the text. Is it assumed that only the first 5s AFM time point assesses "activation" and later timepoints assesses "integrin clustering"? It is difficult to see from the AFM figures that Mn2+ induced "stronger integrin-ligand bonds" than non-treated cells (Figure 2C), as the controls (non-Mn2+ treated cells) are shown in Figure 2B. If the authors assume the same degree of integrin activation in talin and kindlin KO cells in the presence of Mn2+, this should be examined directly. To assess activation, effects on 9EG7-binding in talin and kindlin deficient cells vs controls in the absence and presence of Mn2+, should be quantified, for example by flow cytometry. In addition, soluble binding assays should be performed (as the authors have done previously in Montanez et al, 2008). The authors have attempted to assess clustering of the integrins in talin KO and kindlin KO cells in Figure 3. It is clearly difficult to assess specific vs spatially-driven clustering in cells with such different morphology, and therefore difficult to draw conclusions about the role of kindlin in integrin clustering in these cells. In the Results section, the authors state that "the integrin-activating compound Mn2+ can only partially substitute for the adhesion promoting roles that talin and kindlin accomplish together", however, it is stated that "we circumvented their integrin activation defect with Mn2+". If there is a severe activation/adhesion defect in the presence of Mn2+ (especially for Kindlin-KO cells), this clearly also has implications for outside-in signaling profiles the cells. 5) It is unclear from the results that the integrin/paxillin complex promotes cell proliferation, as stated in the subheading “The kindlin-2/paxillin complex promotes FAK-mediated cell spreading and proliferation”; this has not directly been assessed here. Also, the statement about a connection between the reduced Akt signaling and proliferation "which provides an explanation for their reduced proliferation…" is too strong, as this hypothesis has not been tested here. Kindlin deletion has also been shown to affect other signaling pathways such as TGF-β signaling and proliferation, etc. Do cells which express kindlin that cannot bind paxillin display reduced Akt activation and proliferation? Does expression of active FAK influence Akt activation or proliferation? Does the cell survival defect of kindlin and talin KO cells unspecifically affect their adhesion and signaling profiles? 6) As kindlin clearly has other effects in cells than those dependent on integrins, it would be important to assess whether cells where the integrin-kindlin interaction has been abolished show the same phenotype as KO cells. E.g., what is the adhesion and signaling phenotype of TT/AA-β1-integrin fibroblasts (where kindlin cannot bind the integrin), do they have similar defects in spreading, FAK activation, signaling and proliferation as kindlin knockout cells? What about cells expressing mutant kindlin that cannot bind integrin? 7) Integrin-mediated adhesion depends on the level of integrin expression. Since integrins are heterodimers, we didn't find measurements of individual integrin subunits reassuring that levels of the relevant integrin for these studies, α5β1 (or αvβ3 for that matter), were comparable among the various cells. Flow cytometry using complex-specific antibodies would address this concern. 8) Since the KO cells express αvβ3, as well as α5β1, the inability of Mn2+ have any effect on cell adhesion to vitronectin is puzzling. 9) Considering the variability in the AFM measurements, it appears that in Figures 2B and C, in contrast to KindKo cells, the TlnKo cells do develop measureable adhesions to FN and that Mn2+ increases the strength of the adhesions of nearly control levels. Similarly, Mn2+ increased the adhesion of the KindKo cells, although less so than the control cells. Since there is evidence that the interaction of integrins with ligands is a multi-step process with adhesion strength increasing as the time of contact between integrin and ligand increases, the interpretation of the these experiments, i.e., the kindlin stabilizes integrin ligand complexes with time by inducing or maintaining integrin clusters is not necessarily the only conclusion. 10) Figure 3C: If we have interpreted the distribution of dots correctly, these data suggest that talin and kindlin are not necessarily required to form integrin clusters. 11) If the control fibroblasts are maintained in suspension, are kindlin and talin constitutively associated with β1 tail? Do the cells constitutively bind 93G7? What is the distribution of integrin in the suspended cells? [Editors' note: further revisions were requested prior to acceptance, as described below.] Thank you for resubmitting your work entitled "Kindlin-2 cooperates with talin to activate integrins and induces cell spreading by directly binding paxillin" for further consideration at eLife. Your revised article has been favorably evaluated by Vivek Malhotra (Senior editor) and three reviewers. The manuscript has been improved but there are some remaining issues that need to be addressed before acceptance, as outlined below: Specifically, the loading controls for Erk, Akt and Cas in kindlin control and KO cells show very variable levels of expression of these proteins in the different cells. Please provide a new gel to address this minor issue. Essential revisions: 1) The results in Figure 2E are really interesting but, rather than measuring adhesion to fibronectin, the authors should measure the binding of the soluble cell binding domain of fibronectin and of Mab 9EG7 to suspended cells +/- Mn2+. Expression of Rap1-V12 from an inducible promoter can be used to "physiologically" activate integrins. We measured the binding of the soluble cell-binding domain of fibronectin (FN) and of Mab 9EG7 to suspended cells +/- Mn2+ by FACS. The new data analyzing 9EG7 binding to the TlnCtr, KindCtr, TlnKo and KindKo cells and the rescue cells is included as new Figure 2—figure supplement 3A,B. These data confirm that talin and kindlin are required to activate β1 integrin and to stabilize Mn2+-induced unbending/unclasping of α5β1 integrins. We also measured binding of labeled soluble cell binding domain of FN and observed weak binding of soluble FN to suspension cells that is increased upon Mn2+ treatment. Although we can quantify these differences, the shifts in the FACS histograms are very small and almost overlapping with background binding (Author response image 1). We believe that this renders the analysis unreliable as small shifts lead to a dramatic relative increase, which may not reflect the reality. For this reason we decided against including this data into the revised manuscript.
Author response image 1.

FN binding by TlnKo and KindKo cells.

Left: Quantification of binding of soluble, fluorescently labelled FN-RGD relative to the FN-RGE peptides; the FN-RGD/FN-RGE ratio of pKO cells under control conditions was set to 1 and subtracted from all other results. Binding was measured in the presence of 1 mM MgCl2 (Ctr) or 5 mM MnCl2 (Mn2+) (independent experiments: n=10 for Kind and Tln cell lines, n=3 for pKO; error bars indicate SEM; significances from ratio paired two tailed t-test are given for pairs connected with brackets). Right: Individual FACS histograms of the indicated cell lines used for quantification of fluorescently labelled FN-RGD binding.

DOI: http://dx.doi.org/10.7554/eLife.10130.029

Left: Quantification of binding of soluble, fluorescently labelled FN-RGD relative to the FN-RGE peptides; the FN-RGD/FN-RGE ratio of pKO cells under control conditions was set to 1 and subtracted from all other results. Binding was measured in the presence of 1 mM MgCl2 (Ctr) or 5 mM MnCl2 (Mn2+) (independent experiments: n=10 for Kind and Tln cell lines, n=3 for pKO; error bars indicate SEM; significances from ratio paired two tailed t-test are given for pairs connected with brackets). Right: Individual FACS histograms of the indicated cell lines used for quantification of fluorescently labelled FN-RGD binding. DOI: http://dx.doi.org/10.7554/eLife.10130.029 We did not test the ability of Rap1-V12 to “physiologically” activate integrins due to time constraints and because Rap1-V12 was mainly used to activate integrins on hematopoietic cells. 2) The proposed proliferative defect shown in Figure 1—figure supplement 3A is just a modest delay in entry in S phase. If the cells were just plated, it may be a consequence of the delayed spreading. Growth curves over 1 week would be necessary to strengthen the contention that kindlins promote cell proliferation. In addition, the proposed survival defect shown in Figure 1—figure supplement 3B is non-existent as the talin and the kindlin KO cells survive very well (only 0.5 to 1% of them undergo apoptosis). Importantly, the immunoblotting experiments in Figure 5 are superficial. They need to be extended to include cells not treated with Mn2+ as well as talin KO cells reconstituted with talin. In addition, the phosphorylation of paxillin, Akt at residue T408 (the required PDK1 site), p70-S6K, S6, 4E-BP1, Raf, MEK and ERK has not been studied. Finally, that FAK kinase activity necessarily plays a role in signaling downstream of kindlins is not convincing as PF-228 is used at 5 μM (25x dose required to inhibit FAK 397 in most cells). The two aims of this paper were (1) to investigate whether talin and kindlin are as essential for integrin-mediated adhesion of fibroblasts as for integrin-mediated adhesion of hematopoietic cells (neutrophils, T cells, platelets, hematopoietic stem and progenitor cells, etc.), and (2) to determine what kind of major signaling outputs can be delivered by talin or kindlin. We found that (1) talin and kindlin are essential to induce integrin-mediated adhesion of fibroblasts to FN, and that (2) kindlin can induce isotropic spreading by recruiting paxillin. The beauty of the latter finding was that it solved a conundrum and showed for the first time a mechanism explaining how paxillin (which was discovered in the early nineties) can be recruited to integrin adhesion sites. We also noted a slight proliferation defect in cells lacking kindlin expression. Although this is in agreement with a reduced FAK activation triggered by paxillin-mediated recruitment of FAK to integrin adhesion sites, we never aimed at deeply investigating this finding, mainly because our cells were immortalized and therefore not suitable for such studies. The same is true for the survival. We therefore removed the cell survival data from the manuscript and toned down our findings on cell proliferation in the text. In parallel we performed a number of experiments suggested by the reviewers: a) We replaced the BrdU proliferation assay with growth curves over 5 days that show the reduced proliferation of KindKo cells compared to TalinKo and the control cells (Figure 1—figure supplement 3). b) We repeated the immunoblots in Figure 5 including both rescue cell lines and different conditions (FN, FN+EGF, FN+EGF+Mn2+) and probed with antibodies against different signalling components including Y410-p130Cas, pT308-Akt, S473-Akt, pT202/pY204 Erk1/2, pY31-Pxn, pY118-Pxn (Figure 5 and Figure 5—figure supplement 3). c) Regarding the FAK kinase activity, we repeated the assay using increasing concentrations of FAK inhibitor starting from 0.3 µM, which show a dose-dependent decrease in the percentage of lamellipodia in TlnKo cells (Figure 5E). 3) The contention that loss of talins or kindlins changes the repertoire of fibronectin-binding integrins in a similar fashion (Figure 2A) is not convincing. The data seem to suggest that there is a switch from α-v β-3 to α-v β-5 and that the decreased expression of α-3 and α-6 allows equal expression of α-5 in kindlin-null cells, but the changes may be more complex as the authors have not examined the expression of α-v β-1. The most definitive way to address the issue is to purify fibronectin-binding integrins from surface-labeled cells by affinity chromatography on Fn-CBD in the presence of Mn2+ and subject the eluted proteins to IP with anti-α-v, α-5, β-1, β-3, and β-5. The reviewers are correct; we indeed observe a switch from αvβ3 to αvβ5 in the kindlin and talin knockout cell lines. Our whole studies rely on similar expression of α5 integrins. Our initial FACS analyses show this and we now also determined the levels of α5β1 integrin by selective immunoprecipitation of α5 integrins from the cell surface of live cells of the talin and kindlin control and knockout cell lines followed by western blot analysis with antibodies against α5 and β1 integrins. These experiments show comparable levels of α5β1 integrin presented on the cell surface of TalinCtr, KindCtr, TalinKo and KindKo cell lines. This data is included in the revised manuscript as Figure 2—figure supplement 2. In addition, we examined the expression of αvβ1 in our cell lines by αv immunoprecipitation followed by β1 western blotting and found either barely or no detectable β1 subunits. Altogether this indicates that the major FN-binding integrins on our cell lines are indeed α5β1 and αvβ5 integrins. 4) The sections describing effects of talin and kindlin on integrin "activation" are quite confusing, although it is clear that talin and kindlin are important for adhesion to Fn. Mn2+ activation clearly does partially rescue the adhesion defect of both talin and kindlin deficient cells, but the AFM profiles for talin and kindlin deficient cells look completely different in the presence of Mn2+. This should be emphasized in the text. Is it assumed that only the first 5s AFM time point assesses "activation" and later timepoints assesses "integrin clustering"? It is difficult to see from the AFM figures that Mn2+ induced "stronger integrin-ligand bonds" than non-treated cells (Figure 2C), as the controls (non-Mn2+ treated cells) are shown in Figure 2B. If the authors assume the same degree of integrin activation in talin and kindlin KO cells in the presence of Mn2+, this should be examined directly. To assess activation, effects on 9EG7-binding in talin and kindlin deficient cells vs controls in the absence and presence of Mn2+, should be quantified, for example by flow cytometry. In addition, soluble binding assays should be performed (as the authors have done previously in Montanez et al, 2008). The authors have attempted to assess clustering of the integrins in talin KO and kindlin KO cells in Figure 3. It is clearly difficult to assess specific vs spatially-driven clustering in cells with such different morphology, and therefore difficult to draw conclusions about the role of kindlin in integrin clustering in these cells. In the Results section, the authors state that "the integrin-activating compound Mn2+ can only partially substitute for the adhesion promoting roles that talin and kindlin accomplish together", however, it is stated that "we circumvented their integrin activation defect with Mn2+". If there is a severe activation/adhesion defect in the presence of Mn2+ (especially for Kindlin-KO cells), this clearly also has implications for outside-in signaling profiles the cells. The reviewers’ comments that the sections describing the effects of talin and kindlin on integrin ‘activation’ are confusing, although it is clear that talin and kindlin are important to establish cell adhesion to fibronectin. We apologize for the confusion and revised our text to describe these effects more clearly. The reviewers also mentioned that the AFM-based SCFS results show different adhesion profiles for talin and kindlin deficient cells in the presence of Mn2+. We agree that this is the case and now in our revision specifically report that the adhesion strength restored upon Mn2+ administration differs in both TlnKo and KindKo cells. In our opinion, this result suggests that both talin and kindlin play different roles in integrin mediated adhesion wherein only the role of talin can be accomplished partially upon Mn2+ administration and not the role of kindlin. The reviewers further question whether “it is assumed that only the first 5s AFM time point assesses "activation" and later time points assesses "integrin clustering". Yes, the first 5s AFM time point assesses very early adhesion events (i.e. "activation") established by integrins binding to FN. At later time points (>5s) cell adhesion is considerably strengthens and therefore may reflect the clustering of integrins. Such time dependency of cells establishing adhesion to ECM proteins has been frequently reported in SCFS experiments. The early binding events at short contact times between cell and substrate (within few seconds) are dominated by the binding of single integrins (or CAMs). At extended time ranges (above a few tens of seconds) the integrins (or CAMs) cluster thereby strengthening cell adhesion to the substrate (Taubenberger et al., Mol Biol Cell. 2007; Friedrichs et al., JBC 2008). Thus from insight provided previously we can safely assume that the cell adhesion increasing with higher contact times is due to integrin clustering. The reviewers also comment that “it is difficult to see from the AFM figures that Mn2+ induced "stronger integrin-ligand bonds" than non-treated cells (Figure 2C), as the controls (non-Mn2+ treated cells) are shown in Figure 2B”. We agree, but used this representation, as we wanted to lay emphasis on differences in adhesion strengths among these cells with and without Mn2+. As suggested by the reviewers we assessed integrin activation by analyzing the binding of Mab 9EG7 to wild-type and mutant fibroblasts in the presence and absence of Mn2+ by FACS. This data shows that talin as well as kindlin are required for activating β1 integrin and stabilizing Mn2+-induced unbending/unclasping of α5β1 integrins (Figure 2—figure supplement 3A,B). We also determined the binding of soluble FN. Although we observed weak binding of soluble FN to suspension cells that is increased upon Mn2+ treatment we decided against including it into the revised manuscript because a detailed analysis of the FACS histograms revealed only minor shifts compared to background binding that renders the analysis unreliable (see also comment 1) (c) We rephrased the sentence “we circumvented their integrin activation defect with Mn2+”. We wanted to say that the complete loss of integrin functions in the absence of either talin or kindlin required a trick that bypasses their role in integrin activation. Although Mn2+ is doing this, the effect of Mn2+ on mutant cells is significantly less pronounced than compared to wild-type cells indicating that the maintenance of Mn2+-induced integrin activation is also dependent on talin and kindlin. Hence, the two proteins are required to activate integrins (which we now show with binding of Mab 9EG7) and to maintain the “Mn2+-induced activation state”. 5) It is unclear from the results that the integrin/paxillin complex promotes cell proliferation, as stated in the subheading “The kindlin-2/paxillin complex promotes FAK-mediated cell spreading and proliferation”; this has not directly been assessed here. Also, the statement about a connection between the reduced Akt signaling and proliferation "which provides an explanation for their reduced proliferation…" is too strong, as this hypothesis has not been tested here. Kindlin deletion has also been shown to affect other signaling pathways such as TGF-β signaling and proliferation, etc. Do cells which express kindlin that cannot bind paxillin display reduced Akt activation and proliferation? Does expression of active FAK influence Akt activation or proliferation? Does the cell survival defect of kindlin and talin KO cells unspecifically affect their adhesion and signaling profiles? As stated above (see point 2) we were not aiming at analyzing the role of kindlin and talin for proliferation and survival in depth. Our studies show an involvement of the two proteins but the changes between them are small, probably because our cells are immortalized with the large T antigen. We thank the reviewers for their comment and as a result we removed the part on survival and toned down the results of proliferation and stuck to our major aims: (1) do integrins work without talin or kindlin in non-hematopoietic cells? and (2) which major signaling outputs are triggered by FN-adherent cells that express either talin or kindlin (paxillin recruitment leading to membrane protrusion)? As suggested by the reviewers, we still analyzed Akt activation in cells expressing Kindlin-2ΔPH, which shows impaired paxillin binding. Indeed we found that KindKo cells re-expressing Kindlin2-GFP but not Kindlin-2ΔPH induce FAK and Akt phosphorylation when seeded on FN (Figure 5C). 6) As kindlin clearly has other effects in cells than those dependent on integrins, it would be important to assess whether cells where the integrin-kindlin interaction has been abolished show the same phenotype as KO cells. E.g., what is the adhesion and signaling phenotype of TT/AA-β1-integrin fibroblasts (where kindlin cannot bind the integrin), do they have similar defects in spreading, FAK activation, signaling and proliferation as kindlin knockout cells? What about cells expressing mutant kindlin that cannot bind integrin? The TT/AA mutation in the β1 integrin tail reduces but does not abolish kindlin-2 binding (Fitzpatrick et al., JBC 2014). Furthermore, cells expressing TT/AAβ1 integrins express several other integrins, which are not mutated and therefore bind kindlin. Similarly, mutant forms of kindlins reduce the binding affinities for integrins but do not abolish binding. This, however, would be important to evaluate the experiments with such mutants especially in light of a recent paper from our lab showing that minimal amounts of kindlin-3 are sufficient for basal cellular functions (Klapproth et al., Blood 2015). So, it is difficult to perform conclusive experiments with such cells (which are available in the lab) as this cells system is not ‘clean’ enough. 7) Integrin-mediated adhesion depends on the level of integrin expression. Since integrins are heterodimers, we didn't find measurements of individual integrin subunits reassuring that levels of the relevant integrin for these studies, α5β1 (or αvβ3 for that matter), were comparable among the various cells. Flow cytometry using complex-specific antibodies would address this concern. We are not aware of complex-specific antibodies for mouse α5β1 integrins. In order to address the reviewers’ concern we determined the levels of α5β1 integrin by selective immunoprecipitation of α5 integrins from the cell surface of live TlnCtr, KindCtr, TlnKo and KindKo cells followed by western blot analysis with antibodies against α5 and β1 integrins. These experiments confirm the comparable levels of α5β1 integrin presented on the cell surface of TalinCtr, KindlinCtr, TalinKo and KindlinKo cell lines. This data is included in the revised manuscript as Figure 2—figure supplement 2. If at all, the KindlinKo cells have even slightly more α5β1 integrin on their cell surface compared to TalinKo cells indicating that the cell adhesion and spreading defects of KindlinKo cells on fibronectin are clearly not due to reduced α5β1 integrin levels. 8) Since the KO cells express αvβ3, as well as α5β1, the inability of Mn2+ have any effect on cell adhesion to vitronectin is puzzling. We thank the reviewers for this comment. We carefully analyzed our vitronectin and realized by SDS-PAGE that our vitronectin batch was faulty as we observed protein running at the wrong molecular weight. We repeated the adhesion assay with different vitronectin batches form different companies and can now show adhesion of Mn2+-treated TlnKo but not KindKo cells to VN. The new adhesion assay is shown in Figure 1D. The differential adhesion of Mn2+-treated TlnKo and KindKo cells to VN (Figure 1D) despite similar surface levels of αv integrin points to particularly important role(s) for Kindlin-2 in αv integrins-VN adhesion and signalling (Liao et al., 2015). 9) Considering the variability in the AFM measurements, it appears that in Figures 2B and C, in contrast to KindKo cells, the TlnKo cells do develop measureable adhesions to FN and that Mn2+ increases the strength of the adhesions of nearly control levels. Similarly, Mn2+ increased the adhesion of the KindKo cells, although less so than the control cells. Since there is evidence that the interaction of integrins with ligands is a multi-step process with adhesion strength increasing as the time of contact between integrin and ligand increases, the interpretation of the these experiments, i.e., the kindlin stabilizes integrin ligand complexes with time by inducing or maintaining integrin clusters is not necessarily the only conclusion. Indeed, our experiments measure that TlnKo and KindKo cells in the presence of Mn2+ restore the time-dependent adhesion strengthening. Whereas the adhesion of TlnKo cells is fully restored in the presence of Mn2+, that of KindKo cells is restored by about only 50% (Figure 2B,C). Thus, we conclude that both talin and kindly play distinguishable roles in establishing integrin adhesion and adhesion strengthening. We thank the reviewers for this comment, which encouraged us to discuss the role of kindlin in establishing and strengthening integrin-mediated cell adhesion to FN in more detail. It is possible that kindlin is not only inducing integrin clustering but also modulating the off-rate of integrin-ligand bonds. This role could be mediated through ILK-Pinch-Parvin (IPP) binding, which may link kindlin to the F-actin cytoskeleton. We changed the text accordingly to provide this alternative conclusion. 10) Figure 3C: If we have interpreted the distribution of dots correctly, these data suggest that talin and kindlin are not necessarily required to form integrin clusters. As mentioned in the manuscript, a fraction of kindlin- and almost all talin-deficient cells fail to undergo isotropic spreading. These cells are small, rounded, have small finger-like protrusions and display similar distributions and aggregations of integrin localizations on their surface. It could well be that neither talin nor kindlin is required for clustering. However, these small, non-spread cells may cluster their integrins simply because of a lack of space on the cell surface. We changed the text to make this point clearer. 11) If the control fibroblasts are maintained in suspension, are kindlin and talin constitutively associated with β1 tail? Do the cells constitutively bind 93G7? What is the distribution of integrin in the suspended cells? a) Since the affinity of talin or kindling to integrin tails is very low, it is difficult or almost impossible to determine the association of talin or kindlin to integrins by regular immunoprecipitation in cell lysates. We therefore performed β1 integrin immunoprecipitation experiments after DSP crosslinking of adherent and suspension cells and used β1 YY/AA expressing cells that carry point mutations in the talin and kindlin binding sites as control. We frequently detect reduced co-IPed kindlin-2 and talin which would argue against a constitutively association with β1 integrin tail. However, the results varied depending on the DSP crosslinking time and would require more time and alternative assays to fully address this issue. As the conclusions in our manuscript do not depend on the question if kindlin-2 and talin are constitutively associated with β1 integrin we did not include this data into the revised manuscript.

Talin and kindlin binding to the β1 integrin cytoplasmic domain.

KindCtr or cells expressing a talin and kindlin-binding deficient β1 integrin (β1 YY/AA) were either kept in suspension (susp.) for 3h or seeded on FN-coated dishes (adh.) before incubation for 15 min with 0.5 mM DSP crosslinker at RT. β1 integrin complexes were immunoprecipitated and analyzed by western blotting for presence of talin and kindlin-2. DOI: http://dx.doi.org/10.7554/eLife.10130.030 b) Immunofluorescence staining for β1 integrin in the presence and absences of Mn2+, of suspended TlnCtr and KindCtr cells revealed aggregates of β1 integrins in F-actin-positive membrane spikes, which were indistinguishable from TlnKo or KindKo cells. We cannot distinguish between specific vs spatially-driven aggregation although the small cell shapes suggest that they were induced by spatial constraints rather than specific signalling.

Distribution of β1 integrin in the suspended cells.

Immunofluorescence staining for β1 integrin in the presence and absences of Mn2+ of suspended TlnCtr and KindCtr cells. Cells were co-stained with phalloidin to visualize F-actin. DOI: http://dx.doi.org/10.7554/eLife.10130.031 [Editors' note: further revisions were requested prior to acceptance, as described below.] Specifically, the loading controls for Erk, Akt and Cas in kindlin control and KO cells show very variable levels of expression of these proteins in the different cells. Please provide a new gel to address this minor issue. We have redone the western blots shown in Figure 5—figure supplement 3(b). The variable levels of the control loadings were due to the repeated stripping and re-probing of the membranes. When this is avoided the controls look perfectly fine, as shown in the revised figure. Furthermore, we complemented our western blots showing data from cells that were not treated with Mn2+ and/or EGF with a “– – –” above each lane.
  70 in total

1.  Quantifying cellular adhesion to extracellular matrix components by single-cell force spectroscopy.

Authors:  Jens Friedrichs; Jonne Helenius; Daniel J Muller
Journal:  Nat Protoc       Date:  2010-07-01       Impact factor: 13.491

Review 2.  The tail of integrins, talin, and kindlins.

Authors:  Markus Moser; Kyle R Legate; Roy Zent; Reinhard Fässler
Journal:  Science       Date:  2009-05-15       Impact factor: 47.728

3.  Mechanically activated integrin switch controls alpha5beta1 function.

Authors:  Julie C Friedland; Mark H Lee; David Boettiger
Journal:  Science       Date:  2009-01-30       Impact factor: 47.728

4.  Mutations in the paxillin-binding site of integrin-linked kinase (ILK) destabilize the pseudokinase domain and cause embryonic lethality in mice.

Authors:  Daniel Moik; Anika Böttcher; Tatiana Makhina; Carsten Grashoff; Nada Bulus; Roy Zent; Reinhard Fässler
Journal:  J Biol Chem       Date:  2013-05-08       Impact factor: 5.157

5.  Forcing switch from short- to intermediate- and long-lived states of the alphaA domain generates LFA-1/ICAM-1 catch bonds.

Authors:  Wei Chen; Jizhong Lou; Cheng Zhu
Journal:  J Biol Chem       Date:  2010-09-06       Impact factor: 5.157

6.  Metal ion and ligand binding of integrin α5β1.

Authors:  Wei Xia; Timothy A Springer
Journal:  Proc Natl Acad Sci U S A       Date:  2014-12-04       Impact factor: 11.205

7.  Induction of membrane circular dorsal ruffles requires co-signalling of integrin-ILK-complex and EGF receptor.

Authors:  S Babak Azimifar; Ralph T Böttcher; Sara Zanivan; Carsten Grashoff; Marcus Krüger; Kyle R Legate; Matthias Mann; Reinhard Fässler
Journal:  J Cell Sci       Date:  2012-01-15       Impact factor: 5.285

8.  Focal adhesions are sites of integrin extension.

Authors:  Janet A Askari; Christopher J Tynan; Stephen E D Webb; Marisa L Martin-Fernandez; Christoph Ballestrem; Martin J Humphries
Journal:  J Cell Biol       Date:  2010-03-15       Impact factor: 10.539

9.  Molecular basis of kindlin-2 binding to integrin-linked kinase pseudokinase for regulating cell adhesion.

Authors:  Koichi Fukuda; Kamila Bledzka; Jun Yang; H Dhanuja Perera; Edward F Plow; Jun Qin
Journal:  J Biol Chem       Date:  2014-08-25       Impact factor: 5.157

10.  Fak/Src signaling in human intestinal epithelial cell survival and anoikis: differentiation state-specific uncoupling with the PI3-K/Akt-1 and MEK/Erk pathways.

Authors:  Véronique Bouchard; Marie-Josée Demers; Sonya Thibodeau; Vincent Laquerre; Naoya Fujita; Takashi Tsuruo; Jean-François Beaulieu; Rémy Gauthier; Anne Vézina; Lisabeth Villeneuve; Pierre H Vachon
Journal:  J Cell Physiol       Date:  2007-09       Impact factor: 6.384

View more
  115 in total

1.  Kindlin3 regulates biophysical properties and mechanics of membrane to cortex attachment.

Authors:  Tejasvi Dudiki; Gautam Mahajan; Huan Liu; Irina Zhevlakova; Chase Bertagnolli; Daniel W Nascimento; Chandrasekhar R Kothapalli; Tatiana V Byzova
Journal:  Cell Mol Life Sci       Date:  2021-03-30       Impact factor: 9.261

2.  The focal adhesion protein kindlin-2 controls mitotic spindle assembly by inhibiting histone deacetylase 6 and maintaining α-tubulin acetylation.

Authors:  Hui-Foon Tan; Suet-Mien Tan
Journal:  J Biol Chem       Date:  2020-03-13       Impact factor: 5.157

Review 3.  Integrin signaling: linking mechanical stimulation to skeletal muscle hypertrophy.

Authors:  Marni D Boppart; Ziad S Mahmassani
Journal:  Am J Physiol Cell Physiol       Date:  2019-07-17       Impact factor: 4.249

4.  Structure basis of the FERM domain of kindlin-3 in supporting integrin αIIbβ3 activation in platelets.

Authors:  Jiaojiao Sun; Desheng Xiao; Yuan Ni; Tianlong Zhang; Zhongyuan Cao; Zhou Xu; Huong Nguyen; Jun Zhang; Gilbert C White; Jianping Ding; Yan-Qing Ma; Zhen Xu
Journal:  Blood Adv       Date:  2020-07-14

5.  Structural basis of kindlin-mediated integrin recognition and activation.

Authors:  Huadong Li; Yi Deng; Kang Sun; Haibin Yang; Jie Liu; Meiling Wang; Zhang Zhang; Jirong Lin; Chuanyue Wu; Zhiyi Wei; Cong Yu
Journal:  Proc Natl Acad Sci U S A       Date:  2017-07-24       Impact factor: 11.205

6.  Integrin-Kindlin3 requirements for microglial motility in vivo are distinct from those for macrophages.

Authors:  Julia Meller; Zhihong Chen; Tejasvi Dudiki; Rebecca M Cull; Rakhilya Murtazina; Saswat K Bal; Elzbieta Pluskota; Samantha Stefl; Edward F Plow; Bruce D Trapp; Tatiana V Byzova
Journal:  JCI Insight       Date:  2017-06-02

7.  Paxillin genes and actomyosin contractility regulate myotome morphogenesis in zebrafish.

Authors:  Andrew E Jacob; Jeffrey D Amack; Christopher E Turner
Journal:  Dev Biol       Date:  2017-03-15       Impact factor: 3.582

8.  Optogenetic interrogation of integrin αVβ3 function in endothelial cells.

Authors:  Zhongji Liao; Ana Kasirer-Friede; Sanford J Shattil
Journal:  J Cell Sci       Date:  2017-09-01       Impact factor: 5.285

9.  Macrophage Migration and Phagocytosis Are Controlled by Kindlin-3's Link to the Cytoskeleton.

Authors:  Huan Liu; Liang Zhu; Tejasvi Dudiki; Benjamin Gabanic; Logan Good; Eugene A Podrez; Olga A Cherepanova; Jun Qin; Tatiana V Byzova
Journal:  J Immunol       Date:  2020-02-24       Impact factor: 5.422

10.  Low density lipoprotein receptor-related protein 1 couples β1 integrin activation to degradation.

Authors:  Lukasz Wujak; Ralph T Böttcher; Oleg Pak; Helena Frey; Elie El Agha; Ying Chen; Sigrid Schmitt; Saverio Bellusci; Liliana Schaefer; Norbert Weissmann; Reinhard Fässler; Malgorzata Wygrecka
Journal:  Cell Mol Life Sci       Date:  2017-11-07       Impact factor: 9.261

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.