| Literature DB >> 26821019 |
Xiaodan Liu1,2, Jiagang Tu3,4, Junfa Yuan5,6, Xueqin Liu7,8, Lijuan Zhao9,10, Farman Ullah Dawar11,12, Muhammad Nasir Khan Khattak13, Abeer M Hegazy14,15, Nan Chen16,17, Vikram N Vakharia18, Li Lin19,20.
Abstract
MicroRNAs (miRNAs) play important roles in mediating multiple biological processes in eukaryotes and are being increasingly studied to evaluate their roles associated with cellular changes following viral infection. Snakehead fish Vesiculovirus (SHVV) has caused mass mortality in snakehead fish during the past few years. To identify specific miRNAs involved in SHVV infection, we performed microRNA deep sequencing on a snakehead fish cell line (SSN-1) with or without SHVV infection. A total of 205 known miRNAs were identified when they were aligned with the known zebrafish miRNAs, and nine novel miRNAs were identified using MiRDeep2 software. Eighteen and 143 of the 205 known miRNAs were differentially expressed at three and 24 h post-infection (poi), respectively. From the differentially-expressed miRNAs, five were randomly selected to validate their expression profiles using quantitative reverse transcription polymerase chain reaction (qRT-PCR), and their expression profiles were consistent with the microRNA sequencing results. In addition, the target gene prediction of the SHVV genome was performed for the differentially-expressed host miRNAs, and a total of 10 and 58 differentially-expressed miRNAs were predicted to bind to the SHVV genome at three and 24 h poi, respectively. The effects of three selected miRNAs (miR-130-5p, miR-214 and miR-216b) on SHVV multiplication were evaluated using their mimics and inhibitors via qRT-PCR and Western blotting. The results showed that all three miRNAs were able to inhibit the multiplication of SHVV; whereas the mechanisms underlying the SHVV multiplication inhibited by the specific miRNAs need to be further characterized in the future.Entities:
Keywords: SSN-1 cell; deep sequencing; miRNA; snakehead fish Vesiculovirus
Mesh:
Substances:
Year: 2016 PMID: 26821019 PMCID: PMC4783888 DOI: 10.3390/ijms17020154
Source DB: PubMed Journal: Int J Mol Sci ISSN: 1422-0067 Impact factor: 5.923
Figure 1Length distribution of small RNAs derived from SSN-1 cells with or without snakehead fish Vesiculovirus (SHVV) infection. The small RNAs from the indicated four samples with lengths between 17 and 30 nt are analyzed.
Figure 2Identification of miRNAs compared to zebrafish miRNAs. miRNAs from the four samples were compared to the known zebrafish miRNAs in miRBase 20.0. A total of 205 known miRNAs were clustered including 182 miRNAs from sample SSN-1 cells (3 h), 180 miRNAs from sample SSN-1 cells infected with SHVV (3 h), 180 miRNAs from sample SSN-1 cells (24 h) and 152 miRNAs from sample SSN-1 cells infected with SHVV (24 h). The Venn diagram shows the distribution of miRNAs of the four samples. The overlapping section represents the number of co-expressed miRNAs.
Summary of the predicted novel miRNAs.
| Sequence (5′→3′) | Mature Reads | Fold Change (Log2 I24/C24) * | ||
|---|---|---|---|---|
| 1 | UCCAUCAGUCACGUGACCUAC | 26 | −2.15182 | 2.03 × 10−16 |
| 2 | UCGGGUCGCUAAUGACGUCACC | 30 | −3.57979 | 4.64 × 10−21 |
| 3 | ACCAGGUGCUGUAAGCUU | 67 | <1 | – |
| 4 | CUUUUAAUCUGAGGGUCCA | 12 | <1 | – |
| 5 | AUGACUCGAACCCGAGGACUCG | 13 | 1.57979 | 0.019847 |
| 6 | AUCCGGCUCGAAGGACCAA | 157 | −4.36217 | 0 |
| 7 | AAACACUGCCAGCUGCCACA | 5 | −3.67933 | 0.00165 |
| 8 | GGGGCCUGAGUCCUUCUG | 17 | 13.75742 | 0 |
| 9 | ACCCCACUCCUGGUACCA | 51 | −4.59089 | 8.16 × 10−197 |
* I24: SSN-1 cell infected with SHVV (24 h); C24: SSN-1 cells (24 h).
Figure 3Validation of nine novel miRNAs by RT-PCR. M: marker; Lanes 1–9: the RT-PCR products of the nine novel miRNAs.
Figure 4Expression analysis of five selected miRNAs by qRT-PCR. Five differentially-expressed miRNAs were randomly selected to quantify their expression profiles using qRT-PCR. Non-infected SSN-1 cells were used as the control. * and ** respectively indicate statistically-significant differences between infected and non-infected samples (* p < 0.05; ** p < 0.01).
Summary of targeted virus gene prediction of the differentially-expressed miRNAs when the sample SSN-1 cells infected with SHVV (24 h) were compared to SSN-1 cells (24 h).
| Name | Sequence (5′→3′) | Target | Fold Change (Log2 I24/C24) * |
|---|---|---|---|
| miR-23a-3-5p | GGAUUCCUGGCAGAGUGAUUU | N, L | −7.92953 |
| miR-199-5p | CCCAGUGUUCAGACUACCUGUUC | N, L | −3.96545 |
| miR-338 | UCCAGCAUCAGUGAUUUUGUUG | N, L | −4.16476 |
| miR-145-3p | GGAUUCCUGGAAAUACUGUUCU | N, L | −6.05784 |
| miR-100-3p | CAAGCUUGUAUCUAUAGGUAUC | N, G | −3.61793 |
| miR-216b | UAAUCUCUGCAGGCAACUGUGA | N, G, L | −6.73689 |
| miR-130c-5p | GCCCUUUUUCUGUUGUACUACU | N, G, L | −4.79246 |
| miR-214 | ACAGCAGGCACAGACAGGCAG | N, P | −4.27387 |
| miR-731 | AAUGACACGUUUUCUCCCGGAUCG | N | −3.18425 |
| miR-29b | UAGCACCAUUUGAAAUCAGUGU | P | −3.20471 |
| miR-29a | UAGCACCAUUUGAAAUCGGUUA | P | −3.25812 |
| miR-135c | UAUGGCUUUCUAUUCCUAUGUG | M | −1.6469 |
| miR-145-5p | GUCCAGUUUUCCCAGGAAUCCC | G | −7.017 |
| miR-92b-3p | UAUUGCACUCGUCCCGGCCUCC | G | −4.75081 |
| miR-153b-3p | UUGCAUAGUCACAAAAAUGAGC | G, L | −2.41897 |
| miR-7147 | UGUACCAUGCUGGUAGCCAGU | G | −4.7948 |
| miR-92a-3p | UAUUGCACUUGUCCCGGCCUGU | G | −3.97976 |
| miR-184 | UGGACGGAGAACUGAUAAGGGC | G | −2.16476 |
| miR-301c-3p | CAGUGCAAUAGUAUUGUCAUAG | G | −2.45693 |
| miR-363-3p | AAUUGCACGGUAUCCAUCUGUA | G | −3.26429 |
| miR-454b | UAGUGCAAUAUUGCUUAUAGGG | G | −2.98676 |
| miR-301a | CAGUGCAAUAGUAUUGUCAAAG | G | −2.1425 |
| miR-130a | CAGUGCAAUGUUAAAAGGGCAU | G | −3.11229 |
| miR-23a-5p | GAAUUCCUGGCAGAGUGAUUU | G, L | −6.09946 |
| miR-153a-3p | UUGCAUAGUCACAAAAGUGAUC | G, L | −2.95278 |
| miR-25-3p | CAUUGCACUUGUCUCGGUCUGA | G | −2.31239 |
| miR-730 | UCCUCAUUGUGCAUGCUGUGUGU | G | −4.60532 |
| miR-204-5p | UUCCCUUUGUCAUCCUAUGCCU | G, L | −3.14817 |
| miR-301b-3p | CAGUGCAAUAGUAUUGUCAUUG | G | −4.92954 |
| miR-724 | UUAAAGGGAAUUUGCGACUGUU | L | −2.63081 |
| miR-181c-5p | CACAUUCAUUGCUGUCGGUGGG | L | −1.84696 |
| miR-125a | UCCCUGAGACCCUUAACCUGUG | L | −3.16476 |
| miR-183-5p | UAUGGCACUGGUAGAAUUCACUG | L | −1.57979 |
| miR-199-3p | UACAGUAGUCUGCACAUUGGUU | L | −2.97786 |
| miR-26a-2-3p | CCUAUUCAUGAUUACUUGCACU | L | −3.8599 |
| miR-140-3p | UACCACAGGGUAGAACCACGGAC | L | −3.03951 |
| miR-146a | UGAGAACUGAAUUCCAUAGAUGG | L | −1.98658 |
| miR-150 | UCUCCCAAUCCUUGUACCAGUG | L | −2.63751 |
| miR-221-3p | AGCUACAUUGUCUGCUGGGUUUC | L | −2.48955 |
| miR-34a | UGGCAGUGUCUUAGCUGGUUGU | L | −2.5756 |
| miR-101b | UACAGUACUAUGAUAACUGAAG | L | −2.73747 |
| miR-9-5p | UCUUUGGUUAUCUAGCUGUAUGA | L | −1.54182 |
| miR-181b-5p | AACAUUCAUUGCUGUCGGUGGG | L | −1.75554 |
| miR-107a-3p | AGCAGCAUUGUACAGGGCUAUCA | L | −2.81985 |
| miR-101a | UACAGUACUGUGAUAACUGAAG | L | −3.05599 |
| miR-181c-3p | CUCGCCGGACAAUGAAUGAGAA | L | −5.01275 |
| miR-103 | AGCAGCAUUGUACAGGGCUAUGA | L | −2.61915 |
| miR-146b | UGAGAACUGAAUUCCAAGGGUG | L | −3.91539 |
| miR-138-5p | AGCUGGUGUUGUGAAUCAGGCC | L | −4.94236 |
| miR-429a | UAAUACUGUCUGGUAAUGCCGU | L | −2.44487 |
| miR-153b-5p | GUCAUUUUUGUGGUUUGCAGCU | L | −3.67933 |
| miR-125c-5p | UCCCUGAGACCCUAACUCGUGA | L | −5.07926 |
| miR-181a-5p | AACAUUCAACGCUGUCGGUGAGU | L | −1.97076 |
| miR-199-3-3p | ACAGUAGUCCGCACAUUGGUU | L | −3.81683 |
| miR-125b-5p | UCCCUGAGACCCUAACUUGUGA | L | −3.43276 |
| miR-26a-5p | UUCAAGUAAUCCAGGAUAGGCU | L | −3.35436 |
| miR-722 | UUUUUUGCAGAAACGUUUCAGAUU | L | −6.25146 |
| miR-222a-3p | AGCUACAUCUGGCUACUGGGUCUC | L | −3.55456 |
* I24: SSN-1 cells infected with SHVV (24 h); C24: SSN-1 cells (24 h); N: nucleoprotein; P: phosphoprotein; M: matrix protein; G: glycoprotein; L: RNA-dependent RNA polymerase protein (large protein).
Figure 5Effects of three differentially-expressed miRNAs on SHVV multiplication. (A) Quantification of mRNA level of N and P genes of SHVV via qRT-PCR. The mimics or inhibitors of three selected miRNAs, as well as the mimic control or the inhibitor control were transfected into SSN-1 cells followed by SHVV infection. * and ** respectively indicate statistically-significant differences between infected and non-infected samples (* p < 0.05; ** p < 0.01); (B) Detection of protein level of N and P genes of SHVV via Western blotting. β-actin was used as the internal control protein. The integrated optical densities of the protein bands were measured using Image-Pro Plus 6.0. The value of the N and P protein bands are normalized to β-actin. The value of the N and P protein bands of the control were set as 100, while the values of the N and P protein bands of the three miRNAs were compared to that of the control.