Literature DB >> 26819856

Microsatellite markers for Senna spectabilis var. excelsa (Caesalpinioideae, Fabaceae).

M Cristina López-Roberts1, Ariane R Barbosa1, Luciano Paganucci de Queiroz2, Cássio van den Berg2.   

Abstract

PREMISE OF THE STUDY: Senna spectabilis var. excelsa (Fabaceae) is a South and Central American tree of great ecological importance and one of the most common species in several sites of seasonally dry forests. Our goal was to develop microsatellite markers to assess the genetic diversity and structure of this species. METHODS AND
RESULTS: We designed and assessed 53 loci obtained from a microsatellite-enriched library and an intersimple sequence repeat library. Fourteen loci were polymorphic, and they presented a total of 39 alleles in a sample of 61 individuals from six populations. The mean values of observed and expected heterozygosities were 0.355 and 0.479, respectively. Polymorphism information content was 0.390 and the Shannon index was 0.778.
CONCLUSIONS: Polymorphism information content and Shannon index indicate that at least nine of the 14 microsatellite loci developed are moderate to highly informative, and potentially useful for population genetic studies in this species.

Entities:  

Keywords:  Caatinga; Fabaceae; Senna spectabilis; genetic variation; microsatellite library; polymorphic loci

Year:  2016        PMID: 26819856      PMCID: PMC4716775          DOI: 10.3732/apps.1500062

Source DB:  PubMed          Journal:  Appl Plant Sci        ISSN: 2168-0450            Impact factor:   1.936


Senna Mill. is a large, diverse, and widespread genus of Cassiinae (Caesalpinioideae, Fabaceae), with about 350 species. Most species are American, and some species also occur in Africa, Madagascar, Australia, and Asia (Marazzi et al., 2006). Senna spectabilis (DC.) H. S. Irwin & Barneby is a deciduous tree or shrub ranging from southern Mexico to the Caribbean and northern Argentina and including two varieties: S. spectabilis var. spectabilis and S. spectabilis var. excelsa (Schrad.) H. S. Irwin & Barneby (Irwin and Barneby, 1982). This taxon has been introduced to many countries (including the United States, Malaysia, and Africa) as an ornamental street tree, where it is often regarded as an invasive plant (Richardson and Rejmánek, 2011). Senna spectabilis var. excelsa is widespread in the Caatinga Phytogeographical Domain of northeastern Brazil (Queiroz, 2009). Due to its long flowering period (December to April), it is an important source of pollen for “buzzing bees” (Xylocopa, Bombus, and Centris species), which constitute its main pollinators (Manente-Balestieri and Machado, 1999). This tree has been used by local people as a source of fuel wood and timber, as well as fodder for sheep and goats (Santos et al., 2013). Extracts of this plant also have several applications in folk medicine, and recent studies confirm sedative, anticonvulsive, antimalarial, antimicrobial, cytotoxic, and leishmanicidal activities (de Albuquerque Melo et al., 2014). Despite this, there are no studies that assess the levels of genetic diversity in populations of S. spectabilis. The only study in this species assessed the genetic diversity in germplasm collections using RAPD markers (Santos et al., 2013). In the current study, our goal was to develop microsatellite markers to assess the genetic variation and population structure of S. spectabilis var. excelsa, generating useful tools for future studies and management of this species.

METHODS AND RESULTS

A leaf sample from a single individual of S. spectabilis var. excelsa cultivated on the campus of Universidade Estadual de Feira de Santana was collected and deposited in the herbarium of Universidade Estadual de Feira de Santana (HUEFS; H. Huaylla & M. C. L. Roberts 3737, see Appendix 1). Genomic DNA was extracted using the cetyltrimethylammonium bromide (CTAB) 2× protocol (Doyle and Doyle, 1990) adapted for Eppendorf microtubes (Axygen Scientific, Union City, California, USA). Two types of microsatellite libraries were constructed: a microsatellite-enriched library, following the protocol of Billotte et al. (1999), and an intersimple sequence repeat (ISSR) library (Provan and Wilson, 2007). Fragments obtained by both strategies were linked into the pGEM-T Easy Vector System (Promega Corporation, São Paulo, Brazil) and subsequently transformed and cloned into TOP10 competent cells (Invitrogen, Life Technologies, São Paulo, Brazil). The positive clones were amplified by PCR using the T7 (5′-TAATACGACTCACTATAGGG-3′) and SP6 (5′-ATTTAGGTGACACTATAGAA-3′) primers with the following program: premelt of 94°C for 5 min, 35× (denaturation at 94°C for 15 s, annealing at 55°C for 35 s, and extension at 72°C for 90 s), followed by a final extension at 72°C for 7 min. After quantification performed in agarose gel electrophoresis with a 100-bp ladder (Ludwig Biotec, Alvorada, Rio Grande do Sul, Brazil), fragments larger than 500 bp were sequenced using the Big Dye 3.1 Terminator Cycle Sequencing Kit and an ABI 3130XL automated sequencer (Applied Biosystems, São Paulo, Brazil). Identification of simple sequence repeats was performed with the software SSRIT (Simple Sequence Repeat Identification Tool; http://archive.gramene.org/db/markers/ssrtool) and Imperfect Microsatellite Extractor (Mudunuri and Nagarajaram, 2007). Primer design was done using the software Primer3Plus (Untergasser et al., 2007) with the following criteria: product size range 100–300 bp, primer melting temperature (Tm) 50–60°C (with a maximum difference of 2°C), and GC content 40–60%. Genotyping reactions were performed in 10-μL reactions with Top Taq Master Mix (QIAGEN, São Paulo, Brazil), adding 0.15 μM of the forward primer (tailed at the 5′ with the M13 universal sequence: 5′-CACGACGTTGTAAAACGAC-3′), 0.30 μM of the reverse primer, 0.060 μM of the M13-labeled tail (with 6-FAM, VIC, NED, or PET fluorescent dyes; Applied Biosystems) and approximately 5 ng of individual DNA. Optimal annealing temperature for each primer pair was determined using touchdown (60–54°C, 58–48°C) and gradient (from 62–45°C) PCR programs. Amplicons were visualized by agarose gel electrophoresis (1.5%) with a 100-bp ladder. Microsatellite profiles were analyzed with GeneMapper 4.0 (Applied Biosystems). For polymorphism assessment, we sampled 61 individuals from six populations of S. spectabilis var. excelsa (8–21 individuals per population; Appendix 1). Cross-amplification was tested in S. spectabilis var. spectabilis using a foliar sample from one individual deposited at HUEFS (Queiroz L. P. de 13481, see Appendix 1). The estimated number of alleles, observed heterozygosity (Ho), expected heterozygosity (He), Shannon index, and Hardy–Weinberg equilibrium (HWE) deviations were calculated using GenAlEx 6.5 (Peakall and Smouse, 2006). We also performed a linkage disequilibrium test using GENEPOP (Raymond and Rousset, 1995) to check if genotypes at one locus are independent from genotypes at the other loci. The polymorphism information content (PIC) was calculated with the online tools of the Centre for Genomic Research at the University of Liverpool (http://www.genomics.liv.ac.uk/animal/Protocol1.html). We found 146 perfect and imperfect microsatellite loci in 79 fragments of the enriched library, with motifs of four or more repeats. In the ISSR library, we found 54 microsatellites in only 13 sequences. The proportions of perfect and imperfect-motif microsatellites obtained are shown in Appendix S1. From both sets of loci, we designed a total of 53 primer pairs, of which 34 were designed from the enriched library. A total of 35 microsatellite loci were successfully amplified, from which 14 were polymorphic. Variation was observed in both perfect and imperfect motifs, particularly in di- and trinucleotide repeats (Table 1). The linkage disequilibrium test detected significant values for the following pairwise comparisons: SS_5/SS_51 (P = 0.0131) and SS_51/SS_52 (P = 0.0097), which should be used carefully. The allele number per locus ranged from two to five, with a total of 39 alleles identified (Table 2). Ho and He values varied from 0.037 to 0.727 and 0.036 to 0.743, respectively. Significant deviations from expected HWE proportions (P < 0.01) were detected in seven loci. Values of PIC ranged from 0.037 to 0.697 with a mean of 0.390. The Shannon index varied from 0.092 to 1.423 (mean 0.778). Nine loci presented values of PIC > 0.3 and Shannon index > 0.6, indicating that these are moderately to highly informative microsatellites. Successful cross-amplification was observed in the single tested individual of S. spectabilis var. spectabilis (Table 2).
Table 1.

Characterization of 14 polymorphic microsatellite markers developed for Senna spectabilis var. excelsa.

LocusPrimer sequences (5′–3′)Repeat motifAllele size range (bp)aM13 5′ PIG-tailTa (°C)GenBank accession no.
SS_1F: TTCTGAAGCAGACGGAAGGT(AGAGA)4132–142PET58KJ398419
R: CTCACCTTCCAAATTCAAAGC
SS_5F: GTCCTTTTCACCGATTGA(AG)9136–1486-FAM59KJ398420
R: CTCCTGTCAAAACTCACAAA
SS_10F: CACAGCCAAGAGGGAGAAAG(AGA)5187–196VIC58KJ398421
R: CCTTCTCAATGGCCTTCTCTT
SS_14F: GAGTATGGGGAATACGAATC(TC)3C(GT)3305–307NED56KJ398422
R: TGGGAAGTCAGATACCAT
SS_15F: GGTATCTGACTTCCCAAA(ATTT)4244–248PET56KJ398422
R: AGATGTCCGGATTGCTAC
SS_18F: GCGATGCTCAAGTTTCTCTT(ATC)3(TTC)3(TC)6147–149NED56KJ398423
R: CAAACTAAACCAAAGGACGA
SS_24F: GCCTGTGATCTGAAGGTGGA(AG)9115–125NED56KJ398424
R: GGAGCAGTTTAAGCCAGCTTTATT
SS_26F: GCGCCTCACTCATACATTGA(CT)4124–132VIC56KJ398425
R: GGTCCACCTCCGGGTAGTAT
SS_27F: GAACTGGGAAGGCAGAAAAA(TC)4314–316PETTD 60–54KJ398426
R: GATTCTGGGCAGGCTCCTAT
SS_34F: GAACTGGGAAGGCAGAAAAA(AT)4153–157VICTD 60–54KJ398427
R: ACTTTTCCCAACCTCCGTCT
SS_41F: CCAGAACACGACACAAATGG(AGAA)4200–2166-FAM56KJ398428
R: CGTGGACTAGCCTTCCAATC
SS_48F: TTGTCCTTGGTGATCTCTTCTC(GTT)3215–2486-FAM60KJ398429
R: GCACGTCAGTCAATATGCAA
SS_51F: TGGCAGTACCACCGTACAGA(ATA)T(ATA)3n90(TCA)3308–327VIC60KJ398430
R: TCCCAATGGCTCACAGATG
SS_52F: ACTTCTTGATTTGGTGGCTGA(AGT)3118–1276-FAM57KJ398431
R: CCTGCCAACCCAGATAGAAA

Note: Ta = annealing temperature; TD = touchdown program.

Expected product size in base pairs (bp) including 5′ M13 universal sequence.

Table 2.

Population genetic parameters for 14 polymorphic microsatellite loci in Senna spectabilis var. excelsa (n = 61).

LocusAHoHeHWEaISbPICcCross-amplification in S. spectabilis var. spectabilisd
SS_140.3850.3850.994ns0.6720.308Yes
SS_550.3930.6960.000***1.3490.649Yes
SS_1020.2000.4550.012*0.6470.352No
SS_1430.1110.2900.000***0.5570.269Yes
SS_1520.4550.3510.168ns0.5360.289Yes
SS_1820.2000.2950.107ns0.4710.252Yes
SS_2450.7270.7430.805ns1.4230.697Yes
SS_2640.5450.4790.000***0.8790.425Yes
SS_2720.0370.0360.922ns0.0920.037Yes
SS_3430.2730.5490.003**0.9340.490Yes
SS_4140.5000.6960.198ns1.2910.649Yes
SS_4830.0480.5340.000***0.8410.435Yes
SS_5130.4090.4290.916ns0.6870.355Yes
SS_5230.3330.2850.840ns0.5190.256Yes
Mean3.2140.3550.4790.7780.390

Note: A = number of alleles; He = expected heterozygosity; Ho = observed heterozygosity; HWE = probability of deviation from Hardy–Weinberg equilibrium; IS = Shannon index; n = sample size; PIC = polymorphism information content.

Significant deviation from Hardy–Weinberg equilibrium: *P < 0.05, **P < 0.01, ***P < 0.001; ns = not significant.

IS > 0.6 indicates a moderately to highly informative value.

PIC > 0.3 indicates a moderately to highly informative value.

Cross-amplification was tested in a single individual of Senna spectabilis var. spectabilis (Appendix 1).

Characterization of 14 polymorphic microsatellite markers developed for Senna spectabilis var. excelsa. Note: Ta = annealing temperature; TD = touchdown program. Expected product size in base pairs (bp) including 5′ M13 universal sequence. Population genetic parameters for 14 polymorphic microsatellite loci in Senna spectabilis var. excelsa (n = 61). Note: A = number of alleles; He = expected heterozygosity; Ho = observed heterozygosity; HWE = probability of deviation from Hardy–Weinberg equilibrium; IS = Shannon index; n = sample size; PIC = polymorphism information content. Significant deviation from Hardy–Weinberg equilibrium: *P < 0.05, **P < 0.01, ***P < 0.001; ns = not significant. IS > 0.6 indicates a moderately to highly informative value. PIC > 0.3 indicates a moderately to highly informative value. Cross-amplification was tested in a single individual of Senna spectabilis var. spectabilis (Appendix 1).

CONCLUSIONS

We successfully developed and amplified a set of polymorphic microsatellite markers in S. spectabilis var. excelsa, which could prove very useful in population genetic studies. Due to the successful cross-amplification of these microsatellite loci in S. spectabilis var. spectabilis, we expect these markers could also be used to assess genetic variation of germplasm collections and to support plant breeding programs in this species. Senna spectabilis var. excelsa is one of the few tree species from the caatinga for which microsatellites have been developed, and their use should foster the understanding of patterns of diversity in this fragile ecosystem with high levels of endemic biodiversity. Click here for additional data file.
Appendix 1.

Voucher and location information for populations of Senna spectabilis used in this study for microsatellite development, polymorphism testing, and cross-amplification. Voucher specimens are deposited at the herbarium of the Universidade Estadual de Feira de Santana (HUEFS), Feira de Santana, Bahia, Brazil.

SpeciesPopulation no. (n)Collection localityGeographic coordinatesVoucher no.
Senna spectabilis var. excelsa (Schrad.) H. S. Irwin & BarnebyCultivated individualFeira de Santana, Bahia, Brazil12°11′58″S, 38°58′08″WH. Huaylla &  M. C. L. Roberts 3737
Population 1 (21)Morro de Chapeu, Bahia, Brazil11°19′23.7″S, 41°00′51.4″WC. C. Santos 828
Population 2 (8)Xique Xique, Bahia, Brazil10°51′31.9″S, 42°37′09.6″WC. C. Santos 833
Population 3 (8)Dirceu Arcoverde, Piauí, Brazil09°19′53.6″S, 42°26′47.8″WC. C. Santos 860
Population 4 (8)Milagres, Ceará, Brazil7°15′56.7″S, 38°50′45.7″WC. C. Santos 917
Population 5 (8)Pena Forte, Pernambuco, Brazil7°49′08.8″S, 39°05′08.4″WC. C. Santos 920
Population 6 (8)Jeremoabo, Bahia, Brazil9°50′55″S, 38°15′51.2″WC. C. Santos 934
Senna spectabilis (DC.) H. S. Irwin & Barneby var. spectabilis IndividualSalvador de Jujuy, Mendieta,  Jujuy, Argentina24°19′00″S, 64°58′00″WQueiroz, L. P. de 13481

Note: n = sample size.

  6 in total

1.  IMEx: Imperfect Microsatellite Extractor.

Authors:  Suresh B Mudunuri; Hampapathalu A Nagarajaram
Journal:  Bioinformatics       Date:  2007-03-22       Impact factor: 6.937

2.  Determination of the genetic diversity among accessions of Senna spectabilis (canafístula) by using RAPD markers.

Authors:  M F Santos; R B Araújo Neto; M P S B C Nascimento; P S C Lima
Journal:  Genet Mol Res       Date:  2013-12-02

3.  Phylogenetic relationships within Senna (Leguminosae, Cassiinae) based on three chloroplast DNA regions: patterns in the evolution of floral symmetry and extrafloral nectaries.

Authors:  Brigitte Marazzi; Peter K Endress; Luciano Paganucci de Queiroz; Elena Conti
Journal:  Am J Bot       Date:  2006-02       Impact factor: 3.844

4.  Leishmanicidal activity of the crude extract, fractions and major piperidine alkaloids from the flowers of Senna spectabilis.

Authors:  Gabriela Muniz de Albuquerque Melo; Marcela Campelo Rodrigues Silva; Thaís Pereira Guimarães; Kátia Mantovani Pinheiro; Carolina Barbosa Brito da Matta; Aline Cavalcanti de Queiroz; Marcos Pivatto; Vanderlan da Silva Bolzani; Magna Suzana Alexandre-Moreira; Claudio Viegas
Journal:  Phytomedicine       Date:  2013-11-01       Impact factor: 5.340

5.  GenAlEx 6.5: genetic analysis in Excel. Population genetic software for teaching and research--an update.

Authors:  Rod Peakall; Peter E Smouse
Journal:  Bioinformatics       Date:  2012-07-20       Impact factor: 6.937

6.  Primer3Plus, an enhanced web interface to Primer3.

Authors:  Andreas Untergasser; Harm Nijveen; Xiangyu Rao; Ton Bisseling; René Geurts; Jack A M Leunissen
Journal:  Nucleic Acids Res       Date:  2007-05-07       Impact factor: 16.971

  6 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.