| Literature DB >> 26819856 |
M Cristina López-Roberts1, Ariane R Barbosa1, Luciano Paganucci de Queiroz2, Cássio van den Berg2.
Abstract
PREMISE OF THE STUDY: Senna spectabilis var. excelsa (Fabaceae) is a South and Central American tree of great ecological importance and one of the most common species in several sites of seasonally dry forests. Our goal was to develop microsatellite markers to assess the genetic diversity and structure of this species. METHODS ANDEntities:
Keywords: Caatinga; Fabaceae; Senna spectabilis; genetic variation; microsatellite library; polymorphic loci
Year: 2016 PMID: 26819856 PMCID: PMC4716775 DOI: 10.3732/apps.1500062
Source DB: PubMed Journal: Appl Plant Sci ISSN: 2168-0450 Impact factor: 1.936
Characterization of 14 polymorphic microsatellite markers developed for Senna spectabilis var. excelsa.
| Locus | Primer sequences (5′–3′) | Repeat motif | Allele size range (bp) | M13 5′ PIG-tail | GenBank accession no. | |
| SS_1 | F: TTCTGAAGCAGACGGAAGGT | (AGAGA)4 | 132–142 | PET | 58 | KJ398419 |
| R: CTCACCTTCCAAATTCAAAGC | ||||||
| SS_5 | F: GTCCTTTTCACCGATTGA | (AG)9 | 136–148 | 6-FAM | 59 | KJ398420 |
| R: CTCCTGTCAAAACTCACAAA | ||||||
| SS_10 | F: CACAGCCAAGAGGGAGAAAG | (AGA)5 | 187–196 | VIC | 58 | KJ398421 |
| R: CCTTCTCAATGGCCTTCTCTT | ||||||
| SS_14 | F: GAGTATGGGGAATACGAATC | (TC)3C(GT)3 | 305–307 | NED | 56 | KJ398422 |
| R: TGGGAAGTCAGATACCAT | ||||||
| SS_15 | F: GGTATCTGACTTCCCAAA | (ATTT)4 | 244–248 | PET | 56 | KJ398422 |
| R: AGATGTCCGGATTGCTAC | ||||||
| SS_18 | F: GCGATGCTCAAGTTTCTCTT | (ATC)3(TTC)3(TC)6 | 147–149 | NED | 56 | KJ398423 |
| R: CAAACTAAACCAAAGGACGA | ||||||
| SS_24 | F: GCCTGTGATCTGAAGGTGGA | (AG)9 | 115–125 | NED | 56 | KJ398424 |
| R: GGAGCAGTTTAAGCCAGCTTTATT | ||||||
| SS_26 | F: GCGCCTCACTCATACATTGA | (CT)4 | 124–132 | VIC | 56 | KJ398425 |
| R: GGTCCACCTCCGGGTAGTAT | ||||||
| SS_27 | F: GAACTGGGAAGGCAGAAAAA | (TC)4 | 314–316 | PET | TD 60–54 | KJ398426 |
| R: GATTCTGGGCAGGCTCCTAT | ||||||
| SS_34 | F: GAACTGGGAAGGCAGAAAAA | (AT)4 | 153–157 | VIC | TD 60–54 | KJ398427 |
| R: ACTTTTCCCAACCTCCGTCT | ||||||
| SS_41 | F: CCAGAACACGACACAAATGG | (AGAA)4 | 200–216 | 6-FAM | 56 | KJ398428 |
| R: CGTGGACTAGCCTTCCAATC | ||||||
| SS_48 | F: TTGTCCTTGGTGATCTCTTCTC | (GTT)3 | 215–248 | 6-FAM | 60 | KJ398429 |
| R: GCACGTCAGTCAATATGCAA | ||||||
| SS_51 | F: TGGCAGTACCACCGTACAGA | (ATA)T(ATA)3n90(TCA)3 | 308–327 | VIC | 60 | KJ398430 |
| R: TCCCAATGGCTCACAGATG | ||||||
| SS_52 | F: ACTTCTTGATTTGGTGGCTGA | (AGT)3 | 118–127 | 6-FAM | 57 | KJ398431 |
| R: CCTGCCAACCCAGATAGAAA |
Note: Ta = annealing temperature; TD = touchdown program.
Expected product size in base pairs (bp) including 5′ M13 universal sequence.
Population genetic parameters for 14 polymorphic microsatellite loci in Senna spectabilis var. excelsa (n = 61).
| Locus | HWE | PIC | Cross-amplification in | ||||
| SS_1 | 4 | 0.385 | 0.385 | 0.994ns | 0.672 | 0.308 | Yes |
| SS_5 | 5 | 0.393 | 0.696 | 0.000*** | 1.349 | 0.649 | Yes |
| SS_10 | 2 | 0.200 | 0.455 | 0.012* | 0.647 | 0.352 | No |
| SS_14 | 3 | 0.111 | 0.290 | 0.000*** | 0.557 | 0.269 | Yes |
| SS_15 | 2 | 0.455 | 0.351 | 0.168ns | 0.536 | 0.289 | Yes |
| SS_18 | 2 | 0.200 | 0.295 | 0.107ns | 0.471 | 0.252 | Yes |
| SS_24 | 5 | 0.727 | 0.743 | 0.805ns | 1.423 | 0.697 | Yes |
| SS_26 | 4 | 0.545 | 0.479 | 0.000*** | 0.879 | 0.425 | Yes |
| SS_27 | 2 | 0.037 | 0.036 | 0.922ns | 0.092 | 0.037 | Yes |
| SS_34 | 3 | 0.273 | 0.549 | 0.003** | 0.934 | 0.490 | Yes |
| SS_41 | 4 | 0.500 | 0.696 | 0.198ns | 1.291 | 0.649 | Yes |
| SS_48 | 3 | 0.048 | 0.534 | 0.000*** | 0.841 | 0.435 | Yes |
| SS_51 | 3 | 0.409 | 0.429 | 0.916ns | 0.687 | 0.355 | Yes |
| SS_52 | 3 | 0.333 | 0.285 | 0.840ns | 0.519 | 0.256 | Yes |
| Mean | 3.214 | 0.355 | 0.479 | 0.778 | 0.390 |
Note: A = number of alleles; He = expected heterozygosity; Ho = observed heterozygosity; HWE = probability of deviation from Hardy–Weinberg equilibrium; IS = Shannon index; n = sample size; PIC = polymorphism information content.
Significant deviation from Hardy–Weinberg equilibrium: *P < 0.05, **P < 0.01, ***P < 0.001; ns = not significant.
IS > 0.6 indicates a moderately to highly informative value.
PIC > 0.3 indicates a moderately to highly informative value.
Cross-amplification was tested in a single individual of Senna spectabilis var. spectabilis (Appendix 1).
Voucher and location information for populations of Senna spectabilis used in this study for microsatellite development, polymorphism testing, and cross-amplification. Voucher specimens are deposited at the herbarium of the Universidade Estadual de Feira de Santana (HUEFS), Feira de Santana, Bahia, Brazil.
| Species | Population no. ( | Collection locality | Geographic coordinates | Voucher no. |
| Cultivated individual | Feira de Santana, Bahia, Brazil | 12°11′58″S, 38°58′08″W | ||
| Population 1 (21) | Morro de Chapeu, Bahia, Brazil | 11°19′23.7″S, 41°00′51.4″W | ||
| Population 2 (8) | Xique Xique, Bahia, Brazil | 10°51′31.9″S, 42°37′09.6″W | ||
| Population 3 (8) | Dirceu Arcoverde, Piauí, Brazil | 09°19′53.6″S, 42°26′47.8″W | ||
| Population 4 (8) | Milagres, Ceará, Brazil | 7°15′56.7″S, 38°50′45.7″W | ||
| Population 5 (8) | Pena Forte, Pernambuco, Brazil | 7°49′08.8″S, 39°05′08.4″W | ||
| Population 6 (8) | Jeremoabo, Bahia, Brazil | 9°50′55″S, 38°15′51.2″W | ||
| Individual | Salvador de Jujuy, Mendieta, Jujuy, Argentina | 24°19′00″S, 64°58′00″W |
Note: n = sample size.