| Literature DB >> 26807955 |
Sizhao Lu1, Sathish Kumar Natarajan1, Justin L Mott1, Kusum K Kharbanda2, Duygu Dee Harrison-Findik2.
Abstract
Changes in lipid metabolism and iron content are observed in the livers of patients with fatty liver disease. The expression of hepcidin, an iron-regulatory and acute phase protein synthesized by the liver, is also modulated. The potential interaction of lipid and iron metabolism is largely unknown. We investigated the role of lipid intermediate, ceramide in the regulation of human hepcidin gene, HAMP. Human hepatoma HepG2 cells were treated with cell-permeable ceramide analogs. Ceramide induced significant up-regulation of HAMP mRNA expression in HepG2 cells. The effect of ceramide on HAMP expression was mediated through transcriptional mechanisms because it was completely blocked with actinomycin D treatment. Reporter assays also confirmed the activation of 0.6 kb HAMP promoter by ceramide. HepG2 cells treated with ceramide displayed increased phosphorylation of STAT3, JNK, and NF-κB proteins. However, ceramide induced the binding of STAT3, but not NF-κB or c-Jun, to HAMP promoter, as shown by the chromatin immunoprecipitation assays. The mutation of STAT3 response element within 0.6 kb HAMP promoter region significantly inhibited the stimulatory effect of ceramide on HAMP promoter activity. Similarly, the inhibition of STAT3 with a pan-JAK kinase inhibitor and STAT3 siRNA pool also diminished the induction of both HAMP promoter activity and mRNA expression by ceramide. In conclusion, we have shown a direct role for ceramide in the activation of hepatic HAMP transcription via STAT3. Our findings suggest a crosstalk between lipid and iron metabolism in the liver, which may contribute to the pathogenesis of obesity-related fatty liver disease.Entities:
Mesh:
Substances:
Year: 2016 PMID: 26807955 PMCID: PMC4726556 DOI: 10.1371/journal.pone.0147474
Source DB: PubMed Journal: PLoS One ISSN: 1932-6203 Impact factor: 3.240
The sequence of primers used for ChIP assays.
| Gene | Forward Primer | Reverse Primer |
|---|---|---|
| STAT3 | GAGGGTGACACAACCCTGTT | ACCGAGTGACAGTCGCTTTT |
| NF-κB | TCATTTATGGCCAAAAGTTTGCT | CAAGCATCAGCGTGTGCC |
| c-Jun | TGAGGGTGACACAACCCTGT | CTGCTGGGTCTTGAGCTTGC |