Chao Liu1, Qianming Du2, Xu Zhang3, Zhichao Tang4, Hui Ji2, Yunman Li1. 1. State Key Laboratory of Natural Medicines, Department of Physiology, China Pharmaceutical University Nanjing, China. 2. State Key Laboratory of Natural Medicines, Department of Pharmacology, China Pharmaceutical University Nanjing, China. 3. Department of Combine Traditional Chinese and Western Medicine, College of Clinical Medicine, Chengdu University of TCM Chengdu, China. 4. State Key Laboratory of Natural Medicines, Department of Pharmacochemistry, China Pharmaceutical University Nanjing, China.
Abstract
There are numerous evidences suggesting that inhibition of apoptosis of neurons play a critical role in preventing the damage and even death of neurons after brain ischemia/reperfusion, which shows therapeutic potential for clinical treatment of brain injury induced by stroke. In this study, we aimed to investigate the neuroprotective effect of Clematichinenoside (AR) and its underlying mechanisms. MCAO mode was performed in rats and OGD/R model in primary cortical neurons to investigate the neuroprotective effect of AR. The rate of apoptotic cells was measured using TUNEL assay in cerebral cortex and flow cytometric assay in cortical neurons. Apoptosis-related proteins such as bcl-2, bcl-xl, and bax and the phosphorylation of ERK1/2, cPKC, p90RSK, and CREB in ischemic penumbra were assayed by western blot. Furthermore, we made a thorough inquiry about how these proteins play roles in the anti-apoptotic mechanism using targets-associated inhibitors step by step. The results revealed that AR could activate both ERK1/2 and cPKC which resulted in p90RSK phosphorylation and translocation into the nucleus. Moreover, CREB, a downstream target of p90RSK, was phosphorylated and then bound to cAMP-regulated enhancer (CRE) to activate apoptosis-related genes, and finally ameliorate ischemic stroke through preventing neuron death. In conclusion, these data strongly suggest that AR could be used as an effective neuroprotective agent to protect against ischemic stroke after cerebral I/R injury through regulating both ERK1/2 and cPKC mediated p90RSK/CREB apoptotic pathways.
There are numerous evidences suggesting that inhibition of apoptosis of neurons play a critical role in preventing the damage and even death of neurons after brain ischemia/reperfusion, which shows therapeutic potential for clinical treatment of brain injury induced by stroke. In this study, we aimed to investigate the neuroprotective effect of Clematichinenoside (AR) and its underlying mechanisms. MCAO mode was performed in rats and OGD/R model in primary cortical neurons to investigate the neuroprotective effect of AR. The rate of apoptotic cells was measured using TUNEL assay in cerebral cortex and flow cytometric assay in cortical neurons. Apoptosis-related proteins such as bcl-2, bcl-xl, and bax and the phosphorylation of ERK1/2, cPKC, p90RSK, and CREB in ischemic penumbra were assayed by western blot. Furthermore, we made a thorough inquiry about how these proteins play roles in the anti-apoptotic mechanism using targets-associated inhibitors step by step. The results revealed that AR could activate both ERK1/2 and cPKC which resulted in p90RSK phosphorylation and translocation into the nucleus. Moreover, CREB, a downstream target of p90RSK, was phosphorylated and then bound to cAMP-regulated enhancer (CRE) to activate apoptosis-related genes, and finally ameliorate ischemic stroke through preventing neuron death. In conclusion, these data strongly suggest that AR could be used as an effective neuroprotective agent to protect against ischemic stroke after cerebral I/R injury through regulating both ERK1/2 and cPKC mediated p90RSK/CREB apoptotic pathways.
Ischemic stroke which accounts for 85% of all stroke cases is associated with high morbidity and mortality worldwide (Lu et al., 2012; Zhao et al., 2013). After cerebral ischemia and reperfusion (I/R) injury, the cerebral microcirculatory damage, and apoptotic death of neurons have been found to play a vital role in causing subsequent disability and mortality (Wang et al., 2014). Therefore, agents that can prevent neuron death are believed to have therapeutic potentials toward brain I/R.ERK1/2 is an important subfamily of mitogen-activated protein kinases that control a broad range of cellular activities including cell survival and apoptosis, and it also plays a critical role in triggering neuroprotective action toward neurodegeneration diseases and stroke (Yoo et al., 2008; Zhang et al., 2014; Wei et al., 2015). Further evidences provided that the regulation of ERK1/2 was dependent on the activity of classical or conventional PKC (cPKC) via the modulation of the kinase Raf (Cheng et al., 2001). In addition, cPKC belongs to the PKCs which can be categorized into conventional, novel and atypical PKC (cPKC, nPKC, and aPKC) and has been implicated in cell proliferation, differentiation, apoptosis, tumor promotion, and neuronal activity (Ikenoue et al., 2008). In the present study, we used ERK1/2 specific inhibitor PD98095 (Zanotto-Filho et al., 2008) and cPKC broad band inhibitor GF109203X (Aaltonen et al., 2007) to detect whether the neuroprotective effect of AR was related to cPKC and ERK1/2 activation and how ERK1/2 and cPKC play roles in the process. Based on our results, we demonstrated for the first time that the protective effects of AR on OGD/R-induced apoptosis was not dependent on the classical pathway cPKC/Raf/ERK1/2, but on both cPKC and ERK1/2 pathways.Previous study revealed that p90RSK, activated by ERK1/2 in response to growth factors, was involved in regulation of apoptotic cell death (Kim et al., 2008) and considered as a new therapeutic approach for preventing brain injury (Koh, 2015). Furthermore, Itoh et al. (2005) supported a new mechanism that p90RSK, but not ERK1/2 activation, was increased in PKC over-expressed mice. We inferred that cPKC and ERK1/2 could regulate the common target-p90RSK respectively, and finally showed stronger efficacy and downstream regulation than either of them in our experiments. Additionally, CREB, a downstream target of p90RSK, was activated by phosphorylation and then subsequently regulated the expression of genes such as bcl-2, bcl-xl, and bax in cellular physiological events including cell cycle regulation, apoptosis etc (Hardingham et al., 2002; Kajimura et al., 2014). Here, we used BI-D1870 as p90RSK specific inhibitor (Sapkota et al., 2007) and KG-501 (Bell et al., 2013) as CREB specific inhibitor to evaluate the action of p90RSK and CREB in the apoptotic mechanism.Plant-derived natural products play a crucial role in the field of drug discovery. Clematischinensis Osbeck (Ranunculaceae; in Chinese “Wei-Ling-Xian”), a common traditional Chinese medicine, was used for treating patients who suffered from myocardial infarction or ischemic stroke (Kuang et al., 2005). Clematichinenoside (AR), a triterpenesaponin isolated from the root of Clematischinensis Osbeck, is a commonly used herb with a long clinical practice history in Asia (Liu et al., 2009). Previous studies exhibited that AR had some pharmacological benefits, such as attenuating early-stage atherosclerosis by inhibiting the expression of ICAM-1 and VCAM-1(Yan et al., 2015), attenuating myocardial infarction by increasing SOD activity, inhibiting excessive production of inducible nitric oxide synthase, and decreasing endothelial nitric oxide synthase (Zhang et al., 2013). However, up to now, its effect on ischemic stroke remains largely unknown. According to our pre-experiment, we found that AR could prevent OGD/R-induced apoptosis in primary cortical neurons. Hence, on the basis of this background, the present study was designed: (1) to investigate the possible neuroprotective effect of AR against ischemic stroke after cerebral I/R injury in a ratMCAO model, (2) to determine the molecular mechanism of anti-apoptotic effect of AR by performing OGD/R model on rat cortical neurons, and (3) to provide further information for future development of novel neuroprotective agents.Herein, we have not only determined the neuroprotective effect of AR on ischemic stroke, but also made a strong effort to reveal the underlying mechanism. Our results showed that AR protected against ischemic stroke after cerebral I/R injury through up-regulating the phosphorylation of ERK1/2 and cPKC, which mediated the enhanced p90RSK and CREB phosphorylation. To further explore the mechanism, we demonstrated that p90RSK could markedly transfer from cytoplasm to nucleus after phosphorylation, and then promote CREB phosphorylation and phospho-CREB binding to CRE, which resulted in the alteration of bcl-2, bcl-xl, and bax expressions in cortical neurons.
Materials and methods
Chemicals and reagents
Clematichinenoside (95.3% purity) was provided by China Pharmaceutical University. PD98095, GF109203X, BI-D1870, and KG-501 were purchased from Shang Hai Haoran Biological Technology CO., LTD (Shanghai, China) Dulbecco's modified Eagle's medium (DMEM, high glucose) and newborn calf serum were products of Gibco. Anti-ERK1/2, Anti-phospho-ERK1/2, anti-PKCα, anti-PKCβI/βII, anti-PKCγ, anti-phospho-PKCα, anti-phospho-PKCβI/βII, anti-phospho-PKCγ, anti-p90RSK, anti-phospho-p90RSK, anti-CREB, anti-phospho-CREB, anti-bcl-2, anti-bcl-xl, and anti-bax were purchased from Santa Cruz Biotechnology, Inc. Primers for PCR were obtained from Shanghai Sangon Biotech Co., Ltd. RT-PCR kit was bought from Dalian Takara Biotechnology Co., Ltd.
Animal
Male Sprague-Dawley rats (220–250 g) were purchased from Comparative Medicine Centre of Yangzhou University (Yangzhou, China). Rats were kept under standard housing conditions with a 12 h light/12 h dark cycle at 18–22°C with free access to food and water during the whole experiment procedure. The animal study was performed strictly in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals.
Induction of ischemia/reperfusion model and AR treatment
MCAO and reperfusion were served as ischemia/ reperfusion (I/R) injury (Lv et al., 2011) and MCAO was induced as described previously (Longa et al., 1989). Briefly, after anesthesia, the right common carotid artery (CCA), external carotid artery (ECA), and internal carotid artery (ICA) were exposed through a short incision. CCA and ECA were ligated and ICA was temporarily clamped by using artery clamp. A nylon monofilament was inserted into the ICA via the ECA to block MCA. In the sham group, rats received all the surgical procedures except the filament inserted. Apart from sham group, all other groups were experienced MACO surgery, and 24 h reperfusion was initiated by withdrawing the filament after 2 h occlusion of MCA. After reperfusion, rats were administrated intraperitoneally with AR (8, 16, or 32 mg/kg) or isopyknic physiological saline (vehicle) for 3 days, once per day.
Measurement of cerebral infarction rate and cerebral edema
At 72 h after reperfusion, animals were terminally anesthetized and sacrificed by decapitation. The brains (n = 8) were immediately removed and stored at −20°C for 40 min, and then cut into five consecutive coronal slices with 2 mm thickness after removal of cerebellum. Brain slices were placed into 2% TTC saline solution then incubated in a thermostatic water bath at 37°C for 30 min. Slices treated with 4% paraformaldehyde were refrigerated at 4°C for 24 h in dark. After TTC staining, the colored area and the non-colored area of the slices were respectively measured by a blinded observer with Image J software, and the area of ischemic brain injury was calculated and expressed as infarct area percentage (%). To determine cerebral edema, brains (n = 8) were quickly removed and weighed (wet weight). Before weighed again (dry weight), brains were dehydrated in 105°C for 24 h. Cerebral edema (%) = (1–dry weight/ wet weight) × 100%.
Evaluation of neurologic deficits
At 72 h after reperfusion, the neurologic behavior assessment was carried out by an investigator who was unaware of animal grouping according to previous methods (Longa et al., 1989). The neurologic findings were scored using a 5-point scale: 0, no neurologic deficit; 1, fail to extend forepaw fully; 2, counterclockwise circling; 3, failure to the left or no autonomous motor activity; and 4, fail to walk spontaneously and response to external noxious stimulus.
Tissue preparations
After rats were sacrificed, brain tissues were immediately removed to 10% paraformaldehyde and embedded with paraffin, and then rapidly frozen at −20°C until use for immunohistochemical analysis and TUNEL staining.
Immunohistochemistry and TUNEL staining
After rats were sacrificed, left cortical samples (n = 8) were harvested under anesthesia and fixed in 10% neutral buffered formalin, embedded in paraffin and sliced with a cryostat into sections of 10-μm thickness for subsequent immunohistochemistry and TUNEL staining. To perform immunohistochemistry, sections were blocked by 8% normal goat serum and then incubated with rat anti-bcl-2 antibody (1:200), anti-bcl-xl antibody (1:200), or anti-bax antibody (1:200) for 24 h at 4°C. After being washed with PBS for three times, sections were incubated with Alexa 488-conjugated secondary antibodies for 30 min at 37°C.TUNEL staining was performed according to previous methods (Lee et al., 2014). Briefly, sections (n = 8) were stained using terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling (TUNEL) reagents in situ Apoptosis Detection Kit (Chemicon International, Inc., USA). Images were obtained by fluorescence microscope (IX-71, Olympus, Tokyo, Japan) with a digital camera (Olympus) and analyzed using Image pro plus software (Media Cybernetics, Silver Spring, MD). The number of TUNEL–positive cells was counted from three random 1 × 1 mm2 areas.
The experiment was performed according to the previously described method with a few modifications (Huang et al., 2015). The primary cultures of cortical neurons were harvested from E15-18 embryos of pregnant Spraguee-Dawley rats. Then neurons were digested in 1000 mL cysteine (0.25%), stopped by adding 200 mL fetal bovine serum (FBS) and gently resuspended in MEM medium containing 10% (v/v) FBS, and dissociated properly. After filtration, the cortical tissues were centrifuged at 1000 rpm for 5 min, and then resuspended in MEM + 10% (v/v) FBS. After the supernatant was discarded, cortical neuron cells were plated at 1 × 106 g/ml onto 24 or 6 well culture plates pre-coated with cell adhesion solution (0.5%; Applygen Technologies Inc, Beijing, China). The culture plates were stored in a 5% CO2 humidified incubator for 6 h at 37°C (Thermo, Waltham, MA, USA). Then, the culture media was replaced by Neurobasal Media supplemented with 2% B27 (v/v). Neurons were routinely cultured and maintained for 7–8 days for using in the following experiments.The OGD/R model was carried out to mimic I/R injury in vivo according to previously established method (Fan et al., 2014) with a few modifications. After 7–8 days in culture, the cortical neurons were refreshed with glucose-free DMEM medium and placed in an anaerobic chamber fully flushed with 80% N2 and 20% CO2 (pH 6.8) to mimic the acidic environment of ischemic brain in vivo at 37°C for 2 h. Subsequent reoxygenation was carried out by exposing neurons to normal medium and further incubating for 24 h. After OGD/R induction, cortical neurons were treated with or without AR (3, 10, and 30 μM) in the presence or absence of PD98095 (20 μM, a specific ERK1/2 inhibitor) and/or GF109203X (5 μM, a specific PKC inhibitor) for indicated time in the following experiments. Cell viability was evaluated by MTT assay as described previously (Fan et al., 2014) at 8 h after incubation.
Apoptosis detection and LDH assay
After 8 h treatment with indicated agents, the treated cortical neurons were digested with trypsin (2.5 g/l), centrifuged at 1000 rpm for 10 min and resuspended, and then loaded with Annexin V-FITC/propidium iodide (PI) at 4°C for 30 min. The apoptotic frequency was quantified by flow cytometry with FACSCanto (Becton Dickinson) as previously described (Naumann et al., 2009).The cell injury was evaluated by measuring lactate dehydrogenase (LDH). LDH release was detected in culture medium using the LDH assay kit (Jiancheng, Nanjing, China) according to previous research (Zhang et al., 2012). After OGD/R and followed by 8 h treatment with indicated agents, LDH release was measured at 492 nm using a microplate reader (BioRad), while the background absorbance at 620 nm was subtracted.
Western blot analysis
At 72 h after reperfusion, animals were executed under 10% chloral hydrate anesthesia. The infarct side of cortex (from an area between 3 and 6 mm posterior to the frontal pole) was harvested and stored at −80°C until protein extraction. As for in vitro study, neurons were washed twice with ice-cold PBS and collected for subsequent protein extraction after treatment with indicated agents at different indicated times. Protein extracts from nuclear and cytosolic fraction were obtained using a nuclear extraction kit following the manufacturer protocol (Millipore, Bedford, MA, USA), while protein concentration was determined by Bradford assay. Equal amounts of total protein extracts or nuclear protein extracts were separated in 10% SDS-PAGE and transferred onto polyvinylidene difluoride membranes. After being blocked with 5% nonfat milk in TBST (0.1% Tween 20 in TBS) for 1 h at room temperature, the membranes were incubated with primary antibodies overnight at 4°C. Then the membranes were incubated with HRP-conjugated secondary antibodies at room temperature for 2 h. Then the membrane was incubated with horseradish peroxidase-conjugated secondary antibody for 2 h. Labeled proteins were detected with the ChemiDocXRS + chemiluminescence imaging system (Bio-Rad, Hercules, CA, USA) and the intensity of bands were quantified by Image pro plus software. The bcl-2, bcl-xl, and bax expression levels were normalized to β-actin, while the phosphorylated level was expressed as a ratio of phosphorylated protein to total protein. In addition, the cytoplasmic p90RSK level was normalized to cytoplasmic β-actin, and the nuclear p90RSK level was normalized to nuclear β-tubulin.
Quantitative real-time PCR
For preparation of total RNA of primary cortical neurons, total RNA extraction reagent (Vazyme, Nanjing, China) was applied as manufacturer's instructions after 8 h treatment with indicated agents. While cDNA preparation with Prime Script RT reagent kit (Takara, Dalian, China) completed, quantitative real-time PCR was carried out using SYBR Premix Ex Taq II (Takara, Dalian, China) on 7500 Real-Time PCR System (Applied Biosystems, CA, USA). Specific forward and reverse primers were as follows: bcl-2, forward primers, 5′- GAACTGGGGGAGGATTGTGG -3′, reverse primers, 5′- GCATGCTGGGGCCATATAGT -3′, 194 bps; bcl-xl, forward primers, 5′- AGGGGCTTAGCTGCTGAAAG -3′, reverse primers, 5′- GTGGACAAGGATCTTGGGGG -3′, 81 bps; bax, forward primers, 5′- CTGGATCCAAGACCAGGGTG -3′, reverse primers, 5′- GTGAGGACTCCAGCCACAAA -3′, 96 bps. GAPDH mRNA acted as a control to get the relative quantification.
Statistical analysis
Apart from neurological deficit scores, other data were expressed as means ± SD. Statistical analyses were carried out using the SPSS 16.0 software, and the significance of intergroup differences was compared using the One-way ANOVA followed by Bonferroni post-hoc test. Probability value (P) less than 0.05 was considered to be statistically significant. The neurological deficit scores were expressed as the median (range) and analyzed with a Kruskal–Walls test followed by the Mann–Whitney U-test for multiple comparisons. All statistical figures were performed with Graph Pad Prism Version 6.0.
Results
AR ameliorated ischemia/reperfusion lesion by reducing infarct area, cerebral edema, and neurologic deficits in vivo
Three-day intraperitoneal administration of AR notably diminished infarct volumes of MACO rats. As illustrated in Figures 1A,B, a remarkably decreased pale-colored region was observed in AR (8, 16, and 32 mg/kg) treated rats (p < 0.05, p < 0.01, p < 0.001). Similarly, the ratio of cerebral edema significantly decreased (p < 0.05, p < 0.01) in rats administrated with AR (16 and 32 mg/kg) at 72 h after reperfusion (Figure 1C). Neurological behavioral tests also indicated that rats in AR-treated groups (8, 16, and 32 mg/kg) performed better on the behavioral test and got lower neurological deficit scores (p < 0.05, p < 0.01, p < 0.001; Figure 1D). These data were sufficient to confirm that AR can serve as a feasible agent to lessen ischemia/reperfusion injury in animal model.
Figure 1
The effect of AR on cerebral infarction, cerebral edema, and neurological deficit score in MCAO rats. The vehicle group and AR groups underwent MCAO while the sham group underwent the same surgical procedure without the filament inserted. After MCAO performed, rats in AR groups were intraperitoneally administrated with AR (8, 16, and 32 mg/kg) for 3 days. (A) TTC staining was applied after rats were sacrificed, and brain images were analyzed by Image J software. And infarct area percentage data indicated in (B) were calculated as infarct area/whole area. (C) Cerebral edema was calculated as formula illustrated in the methods. (D) The neurological deficit evaluation were performed at 72 h after reperfusion and analyzed with a Kruskal–Walls test followed by the Mann–Whitney U-test for multiple comparisons. Apart from neurological deficit scores, other data were presented as mean ± SD, neurological deficit scores were presented as median (n = 8). *P < 0.05; **P < 0.01; ***P < 0.001. N.S, not significant.
The effect of AR on cerebral infarction, cerebral edema, and neurological deficit score in MCAOrats. The vehicle group and AR groups underwent MCAO while the sham group underwent the same surgical procedure without the filament inserted. After MCAO performed, rats in AR groups were intraperitoneally administrated with AR (8, 16, and 32 mg/kg) for 3 days. (A) TTC staining was applied after rats were sacrificed, and brain images were analyzed by Image J software. And infarct area percentage data indicated in (B) were calculated as infarct area/whole area. (C) Cerebral edema was calculated as formula illustrated in the methods. (D) The neurological deficit evaluation were performed at 72 h after reperfusion and analyzed with a Kruskal–Walls test followed by the Mann–Whitney U-test for multiple comparisons. Apart from neurological deficit scores, other data were presented as mean ± SD, neurological deficit scores were presented as median (n = 8). *P < 0.05; **P < 0.01; ***P < 0.001. N.S, not significant.
AR impeded apoptosis via modulating bcl-2, bcl-xl, and bax expressions in the cortex of MCAO rats
To shed light on the mechanism of AR-induced outstanding anti-cerebral ischemia action, TUNEL assay was performed. The number of TUNEL-positive cells in the penumbral area of MCAOrats (Figure 2B) was significantly reduced by AR treatment (8, 16, and 32 mg/kg) as compared with that in vehicle group (p < 0.05, p < 0.01, p < 0.001; Figures 2A,C). Furthermore, immunohistochemical staining indicated that a dramatic increment of immunoreactive cells for bcl-2 (p < 0.05, p < 0.01, p < 0.001) and bcl-xl (p < 0.05, p < 0.01, p < 0.001) was found in MCAOrats experiencing AR-treatment (8, 16, and 32 mg/kg; Figures 2A,D,E), while the bax-positive cell numbers in cortex appeared to be reduced in AR treated MCAOrats (8, 16, and 32 mg/kg; p < 0.05, p < 0.01, p < 0.001; Figures 2A,F), suggesting that anti-apoptosis pathway seemed to serve as a pivotal role in the anti-cerebral ischemia triggered by AR.
Figure 2
The effect of AR on neurons apoptosis and bcl-2, bcl-xl, and bax expressions in the penumbral area. The vehicle group and AR groups underwent MCAO while the sham group underwent the same surgical procedure without the filament inserted. After MCAO performed, rats in AR groups were intraperitoneally administrated with AR (8, 16, and 32 mg/kg) for 3 days. (A) Representative photographs of TUNEL staining, immunohistochemical staining of bcl-2, bcl-xl, and bax in the cortex of MCAO rat. (B) The black square indicates the penumbral area. (C) TUNEL staining was analyzed by Image Pro Plus, and each datum was presented as TUNEL positive cells numbers in per mm2 within five random independent view fields. Quantification of the levels of bcl-2 (D), bcl-xl (E), and bax (F) expressions was presented as immunohistochemical positive cells numbers in per mm2 within five random independent view fields. The values were presented as mean ± SD (n = 8). *P < 0.05; **P < 0.01; ***P < 0.001.
The effect of AR on neurons apoptosis and bcl-2, bcl-xl, and bax expressions in the penumbral area. The vehicle group and AR groups underwent MCAO while the sham group underwent the same surgical procedure without the filament inserted. After MCAO performed, rats in AR groups were intraperitoneally administrated with AR (8, 16, and 32 mg/kg) for 3 days. (A) Representative photographs of TUNEL staining, immunohistochemical staining of bcl-2, bcl-xl, and bax in the cortex of MCAOrat. (B) The black square indicates the penumbral area. (C) TUNEL staining was analyzed by Image Pro Plus, and each datum was presented as TUNEL positive cells numbers in per mm2 within five random independent view fields. Quantification of the levels of bcl-2 (D), bcl-xl (E), and bax (F) expressions was presented as immunohistochemical positive cells numbers in per mm2 within five random independent view fields. The values were presented as mean ± SD (n = 8). *P < 0.05; **P < 0.01; ***P < 0.001.
AR improved primary cortical neurons survival and mitigated cell apoptosis and injury induced by OGD/R
As shown in Figure S1, the inhibitive effect of 20 μM PD98095 on ERK1/2 phosphorylation, and the inhibitive effect of 5 μM GF109203X on cPKC (PKCα, PKCβ1/β2, PKCγ) phosphorylation could reach the maximum in primary cortical neurons, so that the concentrations were used for the following experiments. After 8 h AR or inhibitors treatment, primary cortical neurons viability was determined by MTT assay. It was found that while OGD/R caused neurons to incur great loss in cell viability (p < 0.001), AR (3, 10, 30 μM) remarkably abated this decrement (p < 0.05, p < 0.01, p < 0.001). Interestingly, this AR-triggered action was partly blocked by PD98095 (20 μM) or GF109203X (5 μM; p < 0.05, p < 0.05), and was totally reversed in the presence of PD98095 (20 μM) and GF109203X (5 μM; Figure 3J). Additionally, Figure 3J also showed that PD98095 (20 μM) or GF109203X had no toxic effects on cortical neurons. Similarly, an obvious increment in apoptosis rate also appeared after OGD/R (p < 0.001), and this augmented apoptosis rate in neurons was markedly reduced by 8 h AR treatment (3, 10, 30 μM; p < 0.05, p < 0.01, p < 0.001). Moreover, AR-induced anti-apoptosis effect was canceled on condition that neurons were incubated with both PD98095 (20 μM) and GF109203X (5 μM) for 8 h together with AR incubation. But incubation with PD98095 (20 μM) or GF109203X (5 μM) respectively failed to indicate the same effect, and declined apoptosis rate in cortical neurons caused by AR was slightly reversed in this condition (p < 0.05, p < 0.05; Figures 3A–I). Measurement of LDH release into the culture medium was carried out to assess cell injury after 8 h incubation (Figure 3K). In response to OGD/R injury, a notable elevation of LDH levels in culture medium was detected (p < 0.001), while this change in LDH release was reversed by AR (3, 10, 30 μM; p < 0.05, p < 0.01, p < 0.001) in various degrees. However, when this AR-induced protective action was challenged by PD98095 (20 μM) or GF109203X (5 μM) respectively, its inhibition on LDH release was partly canceled (p < 0.05, p < 0.05). In the presence of these two specific inhibitors, AR-treatment did not affect this augmented LDH release.
Figure 3
The effect of AR on apoptosis rates, cell viability, LDH levels in primary cortical neurons. After OGD/R and then followed by 8 h AR (3, 10, and 30 μM) or indicated inhibitors treatment, the OGD/R was applied as illustrated in methods. Apoptosis rates were detected with annexin V/PI double staining after incubation and presented in (A) normal neurons, (B) neurons only experiencing OGD/R, (C) neurons treated with 3 μM AR after OGD/R, (D) neurons treated with 10 μM AR after OGD/R, (E) neurons treated with 30 μM AR after OGD/R, (F) neurons were exposed to PD98095 together with 10 μM AR treatment 8 h after OGD/R, (G) neurons were exposed to GF109203X together with 10 μM AR treatment 8 h after OGD/R, and (H) neurons were exposed to PD98095 and GF109203X together with 10 μM AR treatment 8 h after OGD/R. (I) Quantification of apoptotic rates. (J) Cell viability was analyzed by MTT assay and data were described as % of normal neurons. (K) Neurons injury was determined by LDH activity assay. Results mentioned-above were mean ± SD for 4 individual experiments which, for each condition, were performed in quadruplicate. *P < 0.05; **P < 0.01; ***P < 0.001. N.S, no significant.
The effect of AR on apoptosis rates, cell viability, LDH levels in primary cortical neurons. After OGD/R and then followed by 8 h AR (3, 10, and 30 μM) or indicated inhibitors treatment, the OGD/R was applied as illustrated in methods. Apoptosis rates were detected with annexin V/PI double staining after incubation and presented in (A) normal neurons, (B) neurons only experiencing OGD/R, (C) neurons treated with 3 μM AR after OGD/R, (D) neurons treated with 10 μM AR after OGD/R, (E) neurons treated with 30 μM AR after OGD/R, (F) neurons were exposed to PD98095 together with 10 μM AR treatment 8 h after OGD/R, (G) neurons were exposed to GF109203X together with 10 μM AR treatment 8 h after OGD/R, and (H) neurons were exposed to PD98095 and GF109203X together with 10 μM AR treatment 8 h after OGD/R. (I) Quantification of apoptotic rates. (J) Cell viability was analyzed by MTT assay and data were described as % of normal neurons. (K) Neurons injury was determined by LDH activity assay. Results mentioned-above were mean ± SD for 4 individual experiments which, for each condition, were performed in quadruplicate. *P < 0.05; **P < 0.01; ***P < 0.001. N.S, no significant.
Upregulated ERK1/2 and cPKC phosphorylation along with p90RSK translocation into nucleus and CREB activation mediated bcl-2, bcl-xl, and bax expressions in response to AR
In view of the alterations of bcl-2, bcl-xl and bax expressions in vivo, we then investigated other related proteins involved in this action. In this part, primary cortical neurons were incubated with 10 μM AR for indicated time after OGD/R, and then the proteins derived from each sample were subjected to western blot analysis. As shown in Figures 4A,B, after AR incubation, obvious upregulations in phosphorylation rates of ERK1/2 and PKCα, PKCβ1/β2, and PKCγ emerged, and reached the maximum (62.5, 58.7, 51.9, and 56.2%) at 2 h, then their phosphorylation rates began to decline till 6 h. As phosphorylation and subsequent translocation of p90RSK are upstream events of CREB activation that act as a crucial role in modulating bcl-2 and bcl-xl expressions, time kinetics of p90RSK phosphorylation and translocation were studied. p90RSK phosphorylation initiated at 1 h after AR treatment and with the maximum at 4 h, then reduced to a basal level at about 10 h (Figures 4C,D). p90RSK translocation into nucleus was almost synchronous with its phosphorylation process, the maximum that p90RSK shuttled into nucleus from cytoplasm appeared at 4 h after AR incubation, and this level maintained at least 8 h afterwards (Figures 4E,F). As a positive transcription modulator, CREB being phosphorylated by other kinase was essential for its activation and followed by binding to CRE. At 2 h after AR incubation, CREB phosphorylation started and reached the extremum at 6 h, then returned to a basal level at about 12 h (Figures 4G,H). In response to AR-triggered CREB activation, bcl-2 and bcl-xl expressions were increased at about 4 h, while bax expressions started to decline at same time, and reached the extremum at 6 h after AR treatment, then the expressions remained stable during the later 8 h (Figures 4I,J).
Figure 4
The effect of AR on the phosphorylation of ERK1/2, cPKC, p90RSK, CREB and bcl-2, bcl-xl and bax expressions in primary cortical neurons after OGD/R. Primary cortical neurons were treated with 10 μM AR for indicated time after OGD/R operation and then protein phosphorylation levels or expressions were determined by western blot assay. (A) Representative result of ERK1/2 and cPKC (PKCα, PKCβ1/β2, PKCγ) phosphorylation alterations in neurons experiencing different time AR treatment, and data from four individual experiments were described in (B). (C) Representative results of p90RSK phosphorylation alterations in neurons experiencing different time AR treatment, and this time-kinetic data were described in (D). (E) Representative result of p90RSK nucleus-cytoplasm distribution alterations in neurons experiencing different time AR treatment, and this time-kinetic data were described in (F). (G) Representative result of CREB phosphorylation alterations in neurons experiencing different time AR treatment, and this time-kinetic data were described in (H). (I) Representative result of bcl-2, bcl-xl, and bax expressions changes in neurons experiencing different time AR treatment, and this time-kinetic data were described in (J). Results mentioned-above were mean ± SD for four individual experiments which, for each condition, were performed in quadruplicate.
The effect of AR on the phosphorylation of ERK1/2, cPKC, p90RSK, CREB and bcl-2, bcl-xl and bax expressions in primary cortical neurons after OGD/R. Primary cortical neurons were treated with 10 μM AR for indicated time after OGD/R operation and then protein phosphorylation levels or expressions were determined by western blot assay. (A) Representative result of ERK1/2 and cPKC (PKCα, PKCβ1/β2, PKCγ) phosphorylation alterations in neurons experiencing different time AR treatment, and data from four individual experiments were described in (B). (C) Representative results of p90RSK phosphorylation alterations in neurons experiencing different time AR treatment, and this time-kinetic data were described in (D). (E) Representative result of p90RSK nucleus-cytoplasm distribution alterations in neurons experiencing different time AR treatment, and this time-kinetic data were described in (F). (G) Representative result of CREB phosphorylation alterations in neurons experiencing different time AR treatment, and this time-kinetic data were described in (H). (I) Representative result of bcl-2, bcl-xl, and bax expressions changes in neurons experiencing different time AR treatment, and this time-kinetic data were described in (J). Results mentioned-above were mean ± SD for four individual experiments which, for each condition, were performed in quadruplicate.
AR-induced p90RSK phosphorylation and translocation depended on both ERK1/2 and cPKC activation
As shown in Figures 5A–E, the phosphorylation rates of ERK1/2 and PKCα, PKCβ1/β2, and PKCγ were markedly reduced in cortical neurons experiencing OGD/R, while AR (3, 10, 30 μM) treatment obviously restored this decreased phosphorylation level (P < 0.05, P < 0.01, P < 0.001). Additionally, the phosphorylation rates of ERK1/2 or cPKC were inhibited by special inhibitor (PD98095 or GF109203X) respectively. To investigate the relationship between p90RSK translocation and ERK1/2 and cPKC phosphorylation, two specific inhibitors targeting ERK1/2 and cPKC were applied. After OGD/R injury, p90RSK phosphorylation levels were diminished by ~70% (P < 0.001), and AR (3, 10, 30 μM) incubation alleviated this lose in phosphorylation rates (P < 0.05, P < 0.01, P < 0.001). However, when inhibitors PD98095 (20 μM) or GF109203X (5 μM) were respectively added to the medium together with AR (10 μM) incubation for indicated times, this increment of phosphorylation rates triggered by AR (10 μM) was slightly reduced (P < 0.05, P < 0.05). And when the two inhibitors were added simultaneously, AR (10 μM)-induced upregulation of p90RSK phosphorylation was thoroughly abolished (Figures 5F,G). Additionally, the phosphorylation rate of p90RSK was inhibited by BI-D1870. This observation was in line with p90RSK translocation process detected in our experiments. OGD/R condition notably inhibited p90RSK translocation into nucleus, while AR (3, 10, 30 μM) restored this p90RSK distribution between cytoplasm and nucleus by promoting p90RSK shuttling into nucleus (P < 0.05, P < 0.01, P < 0.001; Figures 5H–J).
Figure 5
AR-modulated p90RSK translocation depended on ERK1/2, cPKC (PKCα, PKCβ1/β2, PKCγ) phosphorylation. OGD/R were applied, and then incubation with AR (10 μM) or indicated inhibitors for indicated times. (A) Representative results of ERK1/2 and cPKC (PKCα, PKCβ1/β2, PKCγ) phosphorylation alterations in neurons experiencing 2 h AR treatment or inhibitor(s) blocking after OGD/R, and quantification data from four individual experiments were described in (B) ERK1/2, (C) PKCα, (D) PKCβ1/β2, and (E) PKCγ. (F) Representative result of p90RSK phosphorylation alterations in neurons experiencing 4 h AR treatment or inhibitor(s) blocking after OGD/R, and this quantification data were described in (G). (H) Representative result of p90RSK nucleus-cytoplasm distribution alterations in neurons experiencing 6 h AR treatment or inhibitor(s) blocking after OGD/R, and this quantification data were described in (I,J). Results mentioned-above were mean ± SD for four individual experiments which, for each condition, were performed in quadruplicate. *P < 0.05; **P < 0.01; ***P < 0.001.
AR-modulated p90RSK translocation depended on ERK1/2, cPKC (PKCα, PKCβ1/β2, PKCγ) phosphorylation. OGD/R were applied, and then incubation with AR (10 μM) or indicated inhibitors for indicated times. (A) Representative results of ERK1/2 and cPKC (PKCα, PKCβ1/β2, PKCγ) phosphorylation alterations in neurons experiencing 2 h AR treatment or inhibitor(s) blocking after OGD/R, and quantification data from four individual experiments were described in (B) ERK1/2, (C) PKCα, (D) PKCβ1/β2, and (E) PKCγ. (F) Representative result of p90RSK phosphorylation alterations in neurons experiencing 4 h AR treatment or inhibitor(s) blocking after OGD/R, and this quantification data were described in (G). (H) Representative result of p90RSK nucleus-cytoplasm distribution alterations in neurons experiencing 6 h AR treatment or inhibitor(s) blocking after OGD/R, and this quantification data were described in (I,J). Results mentioned-above were mean ± SD for four individual experiments which, for each condition, were performed in quadruplicate. *P < 0.05; **P < 0.01; ***P < 0.001.
CREB activation was essential for up/down-regulation of bcl-2, bcl-xl, and bax transcription and expression in response to AR
In this part, BI-D1870 (specific inhibitor of p90RSK) and KG-501 (specific inhibitor of CREB) were used to determine the role of p90RSK and CREB in the modulation of bcl-2, bcl-xl, and bax expression in response to AR. As a result, a significant decline of CREB phosphorylation level was observed in OGD/R treated neurons (p < 0.001), and this decrease in CREB phosphorylation was reversed by AR treatment (3, 10, 30 μM) in various degrees (p < 0.05, p < 0.01, p < 0.001). While this action of AR on CREB phosphorylation was slightly blocked in the presence of PD98095 (20 μM; p < 0.05) or GF109203X (5 μM; p < 0.05), incubation with both PD98095 (20 μM) and GF109203X (5 μM) or BI-D1870 (10 μM) alone was sufficient to totally suppress this up-regulation (p < 0.01, p < 0.01; Figures 6A,B). Additionally, the phosphorylation rate of CREB was inhibited by KG-501. To investigate bcl-2, bcl-xl, and bax mRNA and protein expressions, qPCR and western blot analysis were applied (Figures 6C–I). As a result, bcl-2 and bcl-xl mRNA or protein expressions were up-regulated by AR (3, 10, 30 μM) incubation after OGD/R, while bax mRNA and protein levels in cortical neurons were reduced by virtue of AR (3, 10, 30 μM) after OGD/R. These AR-induced alterations were partly reversed by PD98095 (20 μM; p < 0.05) or GF109203X (5 μM; p < 0.05), and were almost wholly blocked by combined incubation with PD98095 (20 μM) and GF109203X (5 μM) or KG-501 (10 μM) alone (p < 0.01, p < 0.01).
Figure 6
AR-mediated bcl-2, bcl-xl, and bax expressions depended on the activation of p90RSK and CREB. OGD/R were applied, and then incubation with AR (3, 10, 30 μM) or indicated inhibitors for indicated times. (A) Representative result of CREB phosphorylation alterations in neurons experiencing 6 h AR treatment or inhibitor(s) blocking after OGD/R, and this quantification data were described in (B). (C) Representative results of bcl-2, bcl-xl, and bax expressions changes in neurons experiencing 8 h AR treatment or inhibitor(s) blocking after OGD/R, and quantification data from four individual experiments were described in (D) bcl-2, (E) bcl-xl, and (F) bax. Bcl-2 (G), bcl-xl (H), and bax (I) gene expressions changes in neurons experiencing 8 h AR treatment or inhibitor(s) blocking after OGD/R were evaluated using qRT-PCR assay, and quantification data were from four individual experiments. Results mentioned-above were mean ± SD for four individual experiments which, for each condition, were performed in quadruplicate. *P < 0.05; **P < 0.01; ***P < 0.001.
AR-mediated bcl-2, bcl-xl, and bax expressions depended on the activation of p90RSK and CREB. OGD/R were applied, and then incubation with AR (3, 10, 30 μM) or indicated inhibitors for indicated times. (A) Representative result of CREB phosphorylation alterations in neurons experiencing 6 h AR treatment or inhibitor(s) blocking after OGD/R, and this quantification data were described in (B). (C) Representative results of bcl-2, bcl-xl, and bax expressions changes in neurons experiencing 8 h AR treatment or inhibitor(s) blocking after OGD/R, and quantification data from four individual experiments were described in (D) bcl-2, (E) bcl-xl, and (F) bax. Bcl-2 (G), bcl-xl (H), and bax (I) gene expressions changes in neurons experiencing 8 h AR treatment or inhibitor(s) blocking after OGD/R were evaluated using qRT-PCR assay, and quantification data were from four individual experiments. Results mentioned-above were mean ± SD for four individual experiments which, for each condition, were performed in quadruplicate. *P < 0.05; **P < 0.01; ***P < 0.001.
AR augmented the phosphorylation levels of ERK1/2, cPKC, p90RSK, and CREB and mediated bcl-2, bcl-xl, and bax expressions in vivo
At 72 h after MCAO injury, ERK1/2, cPKC, p90RSK, and CREB phosphorylation levels in the infarct side of cortex were markedly reduced, which was in accordance with the results obtained in vitro (Figures 7A–G). While AR (8, 16, and 32 mg/kg) was administrated intraperitoneally to rats after MACO/R surgery, these decreased phosphorylation rates were up-regulated in various degrees. The expressions of downstream proteins bcl-2, bcl-xl, and bax were also detected after indicated treatment. As a result, bcl-2 and bcl-xl levels in cortex were decreased after MCAO and reperfusion, and bax levels were augmented in MACO group as compared with sham group. These alterations in protein expressions were almost reversed by AR treatment (8 mg/kg, 16 mg/kg and 32 mg/kg; Figures 7A,H–J).
Figure 7
The effect of AR on the phosphorylation of ERK1/2, cPKC, p90RSK, CREB and bcl-2, bcl-xl and bax expressions in cortex of MCAO rats. The vehicle group and AR groups underwent MCAO while the sham group underwent the same surgical procedure without the filament inserted. After MCAO performed, rats in AR groups were intraperitoneally administrated with AR (8, 16, and 32 mg/kg) for 3 days. (A) Representative results of ERK1/2, cPKC, p90RSK, CREB phosphorylation alterations and bcl-2, bcl-xl, and bax expressions changes in MCAO rats, and quantification data were described in (B) ERK1/2 phosphorylation level, (C) PKCα phosphorylation level, (D) PKCβ1/β2 phosphorylation level, (E) PKCγ phosphorylation level, (F) p90RSK phosphorylation level, (G) CREB phosphorylation level, and (H) bcl-2, (I) bcl-xl, and (J) bax expressions. Results mentioned-above were described as mean ± SD (n = 8). *P < 0.05; **P < 0.01; ***P < 0.001.
The effect of AR on the phosphorylation of ERK1/2, cPKC, p90RSK, CREB and bcl-2, bcl-xl and bax expressions in cortex of MCAOrats. The vehicle group and AR groups underwent MCAO while the sham group underwent the same surgical procedure without the filament inserted. After MCAO performed, rats in AR groups were intraperitoneally administrated with AR (8, 16, and 32 mg/kg) for 3 days. (A) Representative results of ERK1/2, cPKC, p90RSK, CREB phosphorylation alterations and bcl-2, bcl-xl, and bax expressions changes in MCAOrats, and quantification data were described in (B) ERK1/2 phosphorylation level, (C) PKCα phosphorylation level, (D) PKCβ1/β2 phosphorylation level, (E) PKCγ phosphorylation level, (F) p90RSK phosphorylation level, (G) CREB phosphorylation level, and (H) bcl-2, (I) bcl-xl, and (J) bax expressions. Results mentioned-above were described as mean ± SD (n = 8). *P < 0.05; **P < 0.01; ***P < 0.001.
Discussion
Stroke, which is associated with high morbidity and mortality, has become the third leading cause of death in many countries (Lu et al., 2012; Zhao et al., 2013). Increased mortality rate of neuronal cells following cerebral I/R is a major cause for ischemic stroke (Kim et al., 2015). Because of the increased risk, new agents for ischemic stroke are urgently needed. Recently, a principal active component, clematichinenoside (AR) was shown to possess anti-inflammatory and antirheumatoid activities (Li et al., 2013). It has been shown that AR was potentially beneficial for cardiovascular diseases. Furthermore, our pre-test results showed that AR prevented apoptosis induced by OGD/R injury in primary cortical neurons.In the present study, we performed both in vivo and in vitro experiments to explore whether AR had the neuroprotective effect on ischemia. Collectively, our results showed that administration of AR reduced the neurological deficit score (Figure 1C), the brain edema (Figure 1D) and the elevated infarct size in rat brain after injury (Figures 1A,B). Apoptosis plays an important role in the process of cerebral I/R (Broughton et al., 2009). Previous study revealed that apoptosis-associated genes such as bcl-2, bcl-xl, and bax were activated by transient cerebral ischemia. As the anti-apoptotic factors, bcl-2 and bcl-xl were pivotal for cell survival while bax can promote apoptosis (Yang et al., 1995; Koistinaho and Hokfelt, 1997). Further study verified that AR could effectively reduce the apoptotic rate after MCAO using TUNEL staining. To investigate the ability of AR on preventing neuronal cell death after ischemia in vitro, we performed the OGD/R model in cortical neurons. The LDH activity was considered as an index of cell injury in the OGD/R induced cortical neurons (Wu et al., 2014). The decreased LDH activity induced by AR demonstrated that AR could markedly attenuate the cell injury (Figure 3K). Furthermore, we used flow cytometric analysis to test apoptosis in neuron cells which was considered as a critical consequence of cerebral I/R injury (Sun et al., 2010). As expected, the apoptotic rate in cortical neuron cells was markedly reduced by AR (Figure 3I). Besides, immunohistochemistry, western blot and qRT-PCR assays also confirmed the effects of AR on the expressions of bcl-2, bcl-xl, and bax. Additionally, we noticed that PD98095, GF109203X, and KG-501 significantly blocked the effect of AR on the expressions of bcl-2bcl-xl and bax, indicating that CREB phosphorylation could promote ERK1/2 and cPKC-mediated up-regulation of bcl-2 and bcl-xl, and subsequently decrease cell apoptosis.The family of MAPKs including ERK1/2, p38, and JNK1/2, is largely characterized as proline-directed serine/threonine kinases, and plays a key role in mediating proliferation, differentiation and apoptosis caused by various stimuli (Hamanoue et al., 2007; Han et al., 2007; Yoo et al., 2008). Figure 5 showed that AR could promote ERK1/2 phosphorylation, which was confirmed by the result that PD98095 blocked the protective effect of AR on OGD/R injury-induced apoptosis. Additionally, the phosphorylation of p90RSK, and CREB were decreased and the expression of bcl-2, bcl-xl, and bax were significantly affected by PD98095. Interestingly, GF109203X had the similar effect with PD98095, suggesting that apart from ERK1/2, cPKC was also involved in the neuroprotective mechanism of AR. cPKC including PKCα, PKCβ1, PKCβ2, and PKCγ, are members of Protein kinase C (PKC) and plays important roles in adjusting cell growth, death, and stress responses (Yuspa, 1986). Furthermore, up to now, it has been shown that there were complicated relationships and interactions between ERK1/2 and cPKC during cell apoptosis (Carduner et al., 2014; Darmani et al., 2015). In previously research, Xu et al. (2013) demonstrated that simvastain provided robust neuroprotection against dopaminergic neurodegenetation though regulating the PI3K/Akt/caspase 3 anti-apoptotic pathway. In our study, we examined how AR regulated ERK1/2 and cPKC anti-apoptotic mechanism unlike simvastain to play a vital role in neuroprotective process, and finally ameliorate ischemic stroke.p90RSK, a high degree of sequence homology, consists of a family of four kinases (Rsk1-4; Wallert et al., 2015). Western blot assay (Figures 5F,G) revealed that p90RSK phosphorylation was blocked with PD98095, whereas it was also significantly decreased by GF109203X, demonstrating that p90RSK is a downstream target of ERK1/2 and cPKC pathways. Furthermore, our findings with BI-D1870 (a specific inhibitor of p90 RSK) on decreased CREB phosphorylation notably provided further evidence for the vital role of p90RSK in the treatment of ischemic stroke through anti-apoptotic pathway. CREB could be activated by phosphorylation, and regulate the expression of genes in cellular physiological events such as apoptosis. (Hardingham et al., 2002; Sakamoto and Frank, 2009; Kajimura et al., 2014). According to western blot assay (Figures 6A,B), we could deduce that CREB, a downstream target of both ERK1/2 and cPKC, was activated by phospho-p90RSK and involved in the regulation of apoptotic cell death.To demonstrate how p90RSK and CREB regulate the expressions of bcl-2, bcl-xl, and bax, we further evaluated the phospho-p90RSK localization using western blotting. The nuclear translocation of phospho-p90RSK was markedly increased in cortical neurons (Figures 5H–J), indicating the underlying mechanism of AR-induced protective effect on ischemic stroke. It has been shown that when activated by the nuclear phospho-p90RSK, CREB, the cAMP response element binding protein, could bound to a DNA element known as the CRE to activate an array of downstream genes (Kwok et al., 1994). Furthermore, KG-501 notably inhibited the down-regulation of bax and up-regulation of bcl-2 and bcl-xl indeced by AR (Figures 6C–I), which provided further evidence that AR induced p90RSK nuclear localization and the subsequent regulation of the downstream CREB phosphorylation and nuclear apoptotic gene expression.In the case of the vitro study, Figure 4 showed that AR notably promoted both ERK1/2 and cPKC phosphorylation at 2 h after incubation, which up-regulated the phosphorylation and nuclear localization of p90RSK at 4 h after incubation. As a consequence of the nuclear translocation of phosphor-p90RSK, the nucleoprotein CERB was activated and bound to the CRE, leading to the upregulation of bcl-2 and bcl-xl and the downregulation of bax at 8 h after incubation with AR. The in vivo data were in line with the results observed in vitro (Figure 7), which further established a compelling rationale to recognize the pivotal role of AR in anti-apoptosis action. Our data provide an additional systematic mechanism through which reduced apoptosis was induced by AR treatment and show ERK1/2 and cPKC act vital roles in the process of anti-apoptosis together.Additionally, increasing evidence indicates that the enhanced activity of ERK1/2 or cPKC results in activation of various signaling mechanisms like reactive oxygen species (ROS)/NO, mitogen-activated protein kinases (MAPK), nuclear factor kappa light chain enhancer of B cells (NF-κB), and thus leads to regulation of oxidative stress and inflammation (Sandireddy et al., 2014; Zhang et al., 2014). Oxidative stress and neuroinflammation have been excessively induced after ischemic stroke, and have been clinically described as important causative factors on various neurodegenerative diseases such as Parkinson's disease (PD), Alzheimer's disease (AD), amyotrophic lateral sclerosis (ALS), and multiple system atrophy (MSA) (Ben Haim et al., 2015; Chen et al., 2015; Herrera et al., 2015; Tang and Le, 2015; Thakur and Nehru, 2015). Furthermore, accumulating evidence suggests that inhibition of oxidative stress and neuroinflammation could be a new therapeutic approach for preventing brain injury from neurodegenerative diseases (Labandeira-Garcia et al., 2011; D'Ambrosi et al., 2014; Singh et al., 2015; Skaper et al., 2015). Thus, further studies to investigate the effect of AR on neurodegenerative diseases are necessary.In summary, our study demonstrated that AR could protect against I/R injury by reducing apoptosis in vivo and vitro. Moreover, AR exerted anti-apoptotic effect through both ERK1/2 and cPKC signaling pathways. These data revealed that AR can be developed as an effective drug for preventing neuron death after cerebral ischemia.
Author contributions
CL and QD designed the study and wrote the first draft of the paper, XZ analyzed the data, and ZT polished the paper. CL, QD, XZ, and ZT carried out all experiments together. All authors contributed to the study and have approved the final manuscript.
Funding
This study was supported by the National Natural Science Foundation of China (Program No. 81202974), Project Program of State Key Laboratory of Natural Medicines, China Pharmaceutical University (Program No. JKGQ201108), Graduate Innovation Program of Jiangsu Province of China (Program No. CXLX12_0321), and sponsored by the Qing Lan Project.
Conflict of interest statement
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Authors: Jose L Labandeira-Garcia; Jannette Rodriguez-Pallares; Begoña Villar-Cheda; Ana I Rodríguez-Perez; Pablo Garrido-Gil; Maria J Guerra Journal: Aging Dis Date: 2011-04-20 Impact factor: 6.745
Authors: Alfeu Zanotto-Filho; Martin Cammarota; Daniel P Gelain; Ramatis B Oliveira; Andres Delgado-Cañedo; Rodrigo J S Dalmolin; Matheus A B Pasquali; José Cláudio F Moreira Journal: Toxicol In Vitro Date: 2008-04-07 Impact factor: 3.500
Authors: Laura García-Pupo; Emily Van San; René Delgado-Hernández; Tom Vanden Berghe; Wim Vanden Berghe Journal: Brain Behav Immun Health Date: 2020-10-03