Supramolecular Structure and Functional Analysis of the Type III Secretion System in Pseudomonas fluorescens 2P24.

The type III secretion system (T3SS) of plant and animal bacterial pathogens directs the secretion and injection of proteins into host cells. Some homologous genes of T3SS were found also in non-pathogenic bacteria, but the organization of its machinery and basic function are still unknown. In this study, we identified a T3SS gene cluster from the plant growth-promoting Pseudomonas fluorescens 2P24 and isolated the corresponding T3SS apparatus. The T3SS gene cluster of strain 2P24 is similar organizationally to that of pathogenic P. syringae, except that it lacks the regulator hrpR and the hrpK1 and hrpH genes, which are involved in translocation of proteins. Electron microscopy revealed that the T3SS supramolecular structure of strain 2P24 was comprised of two distinctive substructures: a long extracellular, filamentous pilus, and a membrane-embedded base. We show that strain 2P24 deploys a harpin homolog protein, RspZ1, to elicit a hypersensitive response when infiltrated into Nicotiana tabacum cv. xanthi leaves with protein that is partially purified, and by complementing the hrpZ1 mutation of pHIR11. The T3SS of strain 2P24 retained ability to secrete effectors, whereas its effector translocation activity appeared to be excessively lost. Mutation of the rscC gene from 2P24 T3SS abolished the secretion of effectors, but the general biocontrol properties were unaffected. Remarkably, strain 2P24 induced functional MAMP-triggered immunity that included a burst of reactive oxygen species, strong suppression of challenge cell death, and disease expansion, while it was not associated with the secretion functional T3SS.

Introduction

In natural systems, plants are attacked continuously by a broad spectrum of pathogens and, at the same time, they are protected by a large number of beneficial microorganisms. For plant pathogenic bacteria such as Pseudomonas, Erwinia, Xanthomonas, and Ralstonia, non-flagellar type III secretion system (T3SS) is deployed to secrete and deliver repertoires of effector proteins to suppress innate immunity and cause diseases (Mansfield et al., 2012). The T3SS apparatus, which is referred to as a needle complex, is comprised of three functional modules: (i) a cylindrical basal body that spans the bacterial inner and outer membranes with a presumed central rod to build a channel, (ii) a needle/pilus structure that extrudes from the bacterial outer membrane and functions as a conduit for effector transfer, and (iii) a translocon complex that produces a pore in the host plasma membrane to inject the effectors (Galán and Collmer, 1999; Wei and Collmer, 2012). In recent years, a large variety of structural studies on animal and human bacterial T3SS was conducted. Parts of the system have been described at molecular resolution (Deane et al., 2006; Moraes et al., 2008; Spreter et al., 2009; Schraidt and Marlovits, 2011; Fujii et al., 2012; Bergeron et al., 2013), but few plant-associated bacterial T3SS have been studied, and most of these studies have been in P. syringae (Roine et al., 1997; Hu et al., 2001; Jin et al., 2001; Li et al., 2002). In Pseudomonas syringae pv. tomato DC3000, a pilus is comprised of a major subunit of the T3SS, the HrpA1 protein, which extends to the plant cell (Roine et al., 1997). This pilus is flexible and its length of ∼2 μm is much greater than that of the needles found in animal pathogens (Roine et al., 1997). An in situ immunogold labeling was used to visualize the extrusion of the effector and harpin proteins from the tip of the Hrp pilus, which demonstrates that the bacterial pilus can function as a conduit for protein delivery (Jin et al., 2001; Li et al., 2002).

Pseudomonads, which are distributed widely in many natural niches, are an environmentally significant group of bacteria that includes both pathogenic and saprophytic species. Among the pathogenic fluorescent pseudomonads, the importance of the T3SS and its effectors has been well-studied in the opportunistic human and animal pathogen P. aeruginosa (Hauser, 2009) and the plant pathogen P. syringae (Alfano and Collmer, 2004; Xin and He, 2013). However, in the last 15 years the presence of a T3SS is continuously being reported in a few plant growth-promoting pseudomonads with partial and whole genome sequencing (Preston et al., 2001; Mazurier et al., 2004; Rezzonico et al., 2004, 2005; Mavrodi et al., 2011; Viollet et al., 2011; Barret et al., 2013; Duan et al., 2013; Berendsen et al., 2015). But unlike the plant pathogenic T3SS, the distribution and structure of the plant growth-promoting T3SS are not conserved highly, which results in a poor understanding of its function. For instance, a 20-kb type III gene cluster (rsp/rsc) that resembles the hrp/hrc locus of P. syringae was identified initially in the sugar beet isolate, P. fluorescens SBW25, which lacks the harpin-encoding gene, hrpZ1, but elicits a hypersensitive response (HR)-like cell death in Nicotiana clevelandii (Preston et al., 2001). In Q8r1-96, which is another well-studied P. fluorescens strain, a gene-encoding putative harpin-like protein (RspZ) was identified from the T3SS gene cluster, and the overall arrangement of the rsp/rsc genes in Q8r1-96 differed from that in P. fluorescens SBW25 (Mavrodi et al., 2011). A phylogenic analysis of biocontrol Pseudomonas strains based on partial hrcN sequences addressed the issue that horizontal gene transfer of the T3SS might take place from pathogenic bacteria to PGPR and that the T3SS apparatus may be maladaptive evolutionarily in some PGPR (Rezzonico et al., 2004). To date, no single T3SS machinery has been isolated from plant growth-promoting rhizobacteria (PGPR).

Pseudomonas fluorescens 2P24 is a PGPR strain isolated from wheat take-all decline soil in Shandong Province, China (Wei et al., 2004a). This strain produces several secondary metabolites, such as 2,4-diacetylphloroglucinol (2,4-DAPG), hydrogen cyanide (HCN), and siderophore(s), and it inhibits growth of a range of phytopathogenic fungi (Wei et al., 2004a). The antibiotic 2,4-DAPG was a key determinant in the antibiosis of plant pathogens (Wei et al., 2004b). In addition, strain 2P24 has excellent colonization ability in tomato and cotton rhizospheres to protect against tomato bacterial wilt and cotton rhizoctoniosis, respectively (Wei et al., 2004a). The biocontrol activity of strain 2P24 is regulated by the GacA/GacS two-component system and the quorum sensing regulation system (Wei and Zhang, 2005, 2006). In this work, we report the existence and organization of the T3SS cluster and characterization of a functional harpin-like protein in strain 2P24, and we isolate the T3SS machinery from P. fluorescens for the first time. Finally, we demonstrate that strain 2P24 induces strong MAMP-triggered Immunity (MTI), which is not associated with the T3SS.

Materials and Methods

Bacterial Strains, Plasmids, and Plant Material

Escherichia coli strains were grown in Luria–Bertani (LB) broth at 37°C. P. fluorescens and P. syringae were grown in King’s medium B (KB) broth (King et al., 1954) at 28°C. Construction of the cosmid library in E. coli DH5a was described in Wei and Zhang (2006). A summary of bacterial strains and plasmids is provided in Table . Antibiotics were used at the following concentrations unless otherwise stated (μg/ml): ampicillin, 100; gentamicin, 20; kanamycin, 50; rifampicin, 50; spectinomycin, 50; and tetracycline, 20. Nicotiana benthamiana and tobacco (N. tabacum cv. xanthi) plants were grown in a greenhouse with 16 h light/8 h dark, 65% humidity, and a temperature of 24°C during daylight and 22°C at night.

DNA Manipulations

Recombinant DNA techniques were performed according to standard protocols (Sambrook et al., 1989). Electroporation was performed using a Bio-Rad GenePulser according to the manufacturer’s protocol (Bio-Rad). Triparental mating was carried out using helper plasmid E. coli HB101 (pRK2013) according to the standard protocol. Plasmid DNA preparation and DNA gel extraction were done using the QIAprep Spin Miniprep Kit and QIAquick Gel Extraction Kit, respectively (Qiagen, China). Gateway recombination was conducted with LR clonase II, as recommended by the manufacturer (Invitrogen, China). DNA sequences of pN11-7, pN13-41, and pN31-20 were subcloned into pBluescript using EcoR I, Hind III, and Kpn I. Subclones were mapped, and selected subclones were sequenced using T3 and T7 primers. Additional sequences were obtained from subclones using specific oligonucleotide primers. All DNA sequencing was done at Invitrogen China. DNA sequences were assembled and analyzed with the sequence analysis software package of the Genetics Computer Group. DNA sequences were deposited in GenBank under the accession number KT582783.

Construction of the fliC, rspZ1, and rscC Mutants

To make a fliC mutant of P. fluorescens 2P24, a 0.5-kb fragment of fliC gene was amplified by PCR using primers P141 (5′-GCCGGCCTGCAAATCGCTACC-3′) and P655 (5′-ACCTCTACCACGACCAGTCTGC-3′) cloned into the SmaI site of pHSG299. The resulting pHSG299 derivative was transformed into P. fluorescens 2P24 to produce 2P24ΔfliC with kanamycin resistance. The fliC mutant was confirmed by the swimming mobility test on KB medium containing 0.3% agar. The rspZ1 mutation of 2P24 was made using a similar procedure as described above after a 0.5-kb fragment of rspZ1 gene was amplified using primers P181 (5′- GGTTCGACGGGCGGACAGTCTC -3′) and P681 (5′-GCGCGCCGGGTGCTGGTCCAT-3′). To delete the rscC gene from strain 2P24, two 1.1-kb fragments carrying the left and right flanking regions of rscC were amplified by PCR using primer pair P2658 (5′-CCGCCCATGAATTCCGCCG-3′) and P3740 (5′-GGTACGGGATCCGCGGACAC-3′) and primer pair P4332 (5′-TCGGGATCCACCGCACGCAAC-3′) and P5548 (5′-CGGCTGCAGGCATCGCCCTG-3′), respectively. Each fragment of the left and right regions was digested with relative restriction enzymes and was cloned into the EcoRI and PstI sites of pHSG299. The resulting pHSG299 derivative was transformed into P. fluorescens 2P24. The kanamycin resistance colonies were cured of pHSG299. The final kanamycin-sensitive mutants were screened by PCR.

Isolation of Type III Secretion Machinery from P. fluorescens 2P24

The methods used for P. syringae (Roine et al., 1997; Jin and He, 2001) and Salmonella (Kubori et al., 1998) were modified to isolate the P. fluorescens type III secretion machinery. Briefly, a 2 ml aliquot of overnight culture was inoculated into 200 ml KB liquid media, and the bacteria were grown until OD600 0.8. The bacteria collected by centrifugation were suspended in 20 ml of 0.5 M ice-cold sucrose solution containing 0.15 M Tris, 10 mM EDTA (pH 8.0), and 1 mg/ml lysozyme, followed by incubation for 1 h at 4°C. The resulting spheroplasts were lysed by addition of 30% Triton X-100 to the final concentration at 0.1% and incubated for 2 h at 4°C. Then, we added 2.3 ml 100 mM MgSO4 and centrifuged at 8000 r/min for 20 min. The supernatant was transferred to a new tube and adjusted to pH 11 with 1 M NaOH, followed by incubation at 4°C. To collect type III complexes, the lysate was subjected to ultracentrifugation at 22000 r/min for 1 h at 4°C. The pellet was then suspended in 20 ml buffer with 0.1 M KCl-KOH (pH 11.0), 0.5 M sucrose, and 0.1% Triton X-100, and centrifuged at 22000 r/min for 1 h at 4°C. We discarded the supernatant and added 15 ml buffer with 10 mM Tris-HCl (pH 8.0), 5 mM EDTA, 0.1% Triton X-100, and then fractionated with 30%(w/v) CsCl density gradient centrifugation at 22000 r/min for 2 h 4°C. The pelleted type III secretion complexes were suspended in a small amount of buffer and examined immediately using a JEOL JEM-1400 Transmission Electron Microscope (TEM).

Expression and Purification of Harpins

For the expression and purification of soluble harpins, the hrpZ1DC3000 and rspZ1 genes lacking stop codons were cloned into pET-22b expression vector, respectively. Derivative pET-22b plasmids produce C-terminal fusions with the His6 affinity tag. pET-22b plasmids were transformed into E. coli BL21(DE3). The expression process was described in a previous report with a slight modification (Kvitko et al., 2007). Single colonies of the expression strains were inoculated into 10 ml LB containing ampicillin and incubated for 12 h with shaking at 37°C. The starter cultures were used to inoculate 100 ml LB-carbenicillin cultures in flasks, which were incubated with shaking at 30°C to an optical density at 600 nm of ca. 0.4. IPTG was added to a final concentration of 1 mM, and the cultures were allowed to incubate for an additional 6 h. Cell pellets were harvested and lysed according to the Qiagen protocol. The suspension was sonicated on ice with a Fisher Scientific 550 sonic Dismembrator. Cleared lysates were harvested at 12,000 rpm for 30 min at 4°C and purified with Ni-nitrilotriacetic acid (NTA) agarose (QIAGEN). Purified harpins were stored at 4°C until use. Proteins were visualized by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), followed by staining with Coomassie brilliant blue. Protein concentrations were determined by the Bradford assay. Harpin preparations were diluted for plant reaction assays. Empty-vector preparations were obtained in parallel with each harpin preparation.

Western Blot and CyaA Translocation Reporter Assays

HopQ1 protein in cell and supernatant fractions were analyzed essentially as described by Kvitko et al. (2007). Samples were separated by electrophoresis on SDS-PAGE and analyzed by immunoblotting using primary anti-HA mouse monoclonal immunoglobulin G (IgG) antibodies and secondary anti-mouse IgG alkaline phosphatase conjugate antibodies, as described by Kvitko et al. (2007). An adenylate cyclase (CyaA) injection assay was used to test HopQ1 translocation (Kvitko et al., 2007). This assay can determine if a type III effector-CyaA fusion is injected into eukaryotic cells, because the CyaA enzyme is dependent on calmodulin, a protein present in sufficient amounts only inside eukaryotic cells. When a CyaA fusion is injected into plant cells, there is a substantial increase in cAMP, a product of the CyaA-catalyzed reaction. The fresh bacterial cells in 10 mM MgCl2 were infiltrated on N. benthamiana leaves at 108 cfu/ml. The leaf disks were collected at 12 h with a 1.0-cm-diameter cork borer. The cyclic AMP (cAMP) levels were determined by using a Correlate-EIA cAMP immunoassay kit according to the manufacturer’s instructions (Enzo, USA).

Phenotypic Characterization of the rscC Mutant

The rscC mutant was compared to the parental strain 2P24 for production of the antibiotic 2,4-DAPG, HCN, exoprotease, and siderophores, as described previously (Wei et al., 2004a; Wei and Zhang, 2006). Antibiosis detections of strain 2P24 and the rscC mutant were performed on a PDA plate with Rhizoctonia solani and Ralstonia solanacearum as target pathogens. Plant protection experiments against tomato bacterial wilt were carried out in a greenhouse according to the method of Wei et al. (2004a).

Assay for Reactive Oxygen Species (ROS)

For ROS measurements, N. benthamiana leaf tissue was inoculated with bacterial strains at 108 cfu/ml. At 15 h post-inoculation, leaf disks (0.5 cm diameter) were excised and placed into wells of 96-well plates pre-supplied with 100 ml of sterile water, and then 100 ml of 0.5 mM L-012 (Wako, Japan) in 10 mM morpholinepropanesulfonic acid–KOH buffer (pH 7.4) was added. The intensity of ROS generation was determined according to Oh et al. (2010).

Challenge-Inoculation HR and Assays for Bacterial Colony Development

The fresh P. fluorescens bacterial cells in 10 mM MgCl2 were infiltrated on N. benthamiana leaves at 108 cfu/ml. P. syringae DC3000 was challenge-inoculated 6 h later at 107 cfu/ml to overlap partially with the P. fluorescens pretreated area. After 48 h, leaves were photographed. To observe the suppression of inhibition of the growth of the challenge-inoculated virulent pathogen, the P. fluorescens strains were inoculated at 108 cfu/ml into N. benthamiana, then 6 h later, P. syringae DC3000ΔhopQ1 was challenge-inoculated at 105 cfu/ml on the edge of the pre-infiltrated area to produce an overlapped area and a non-overlapped area. Bacterial populations of P. syringae DC3000ΔhopQ1 in the overlapped area were assessed at 0 and 4 days post-inoculation. Each experiment was repeated three times.

Results

Cloning and Sequence Analysis of the P. fluorescens 2P24 T3SS Gene Cluster

Three cosmid clones, pN11-7, pN13-41, and pN31-20 were isolated from a genomic library of P. fluorescens 2P24 using primers P1280 (5′-AACCAGCCGGCKGTSATGA-3′) and P1680 (5′-AGGATGAAGACSCGYTCGCG-3′) designed from hrcC homologs. Subsequent mapping and sequencing of the subclones of these cosmids delimited a 30 kb cluster of TTSS-related genes (Figure ). A total of 25 predicted open reading frames (ORFs) were identified and assigned the gene names rsp (rhizosphere-expressed secretion gene) and rsc (rsp conserved) according to the non-pathogenic Pseudomonas T3SS convention published previously (Preston et al., 2001; Mavrodi et al., 2011).

Genetic organization of the . DC3000 (B). Predicted open reading frames and their orientation are shown by large arrows. Conserved rsc/hrc genes are shown as red arrows, conserved rsp/hrp genes as green arrows, and harpin proteins as black arrows. Additional ORFs are shown as blue arrows. Homologous genes are connected with gray shading. Full gene names within rsc/rsp and hrc/hrp clusters were shortened and are indicated by a single letter preceded by “c” or “p”. (D) The cloning procedures and subclones contain rsp/rsc gene fragments. For details, see Tables and .

The arrangement and orientation of the P. fluorescens 2P24 T3SS gene cluster bore a strong similarity to that of P. syringae, which has been studied extensively (Huang et al., 1988). It was reported that the hrp genes encoding the TTSS machinery in P. syringae are the conserved center region (CCR) of a tripartite pathogenicity island that includes exchangeable (EEL) and conserved (CEL) effector loci (Alfano et al., 2000). We did not find any corresponding EEL and CEL loci from the limited sequences of both sides of the 2P24 T3SS cluster. Specifically, we observed that the ORFs that flanked a 9.0 kb upstream region of the hrpS gene are similar to proteins unlikely to be linked to type III secretion (Figure ). The presence of T3SS-like genes has been reported recently in a few non-pathogenic fluorescent pseudomonads (Preston et al., 2001; Rezzonico et al., 2004; Mavrodi et al., 2011), in which T3SS-like genes of P. fluorescens Q8r1-96 share the greatest similarity with strain 2P24 (Table ). Overall, it appears that T3SS of strain 2P24 has six principal features:

A protein showing 31% identity to HrpZ1 harpin, which resides between HrpA1 and HrpB in the hrpJ operon of P. syringae DC3000, was identified from the same position in P. fluorescens 2P24. A HrpZ1 homolog was found also in Q8r1-96, which is another non-pathogenic P. fluorescens (Mavrodi et al., 2011); it was not found in P. fluorescens SBW25 (Preston et al., 2001) or P. fluorescens F113 (Redondo-Nieto et al., 2013), which are well-known PGPR.

In strain 2P24, a homolog of the SchE protein is present between HrpV and HrcU, but neither insertion sequences nor duplicated regions were detected around the flanking sequences of the schE gene.

The P. fluorescens 2P24 cluster carries an intact hrpV operon (hrpJ, hrcV, hrpQ, hrcN), which is significantly absent from P. fluorescens SBW25, but is very important for secretion of T3SS substrates in phytopathogenic Pseudomonas (Huang et al., 1988; Alfano and Collmer, 1997).

The P. fluorescens 2P24 cluster harbors only a single response regulator homolog, rspS, which is one of the two regulators (hrpS and hrpR) that are 64% identical to that in P. syringae DC3000 (Grimm et al., 1995; Deng et al., 1998); this is the same homolog that is found in P. fluorescens Q8r1-96 (Mavrodi et al., 2011), but different than the homolog found in P. fluorescens SBW25 (Preston et al., 2001).

In strain 2P24, hrcQ is an integrated gene, but it is segmented into two genes, hrcQa and hrcQb, in P. fluorescens SBW25 (Preston et al., 2001) and P. syringae (Huang et al., 1988).

Strain 2P24 has all nine hrc homologs, which show 58.6% identity to that of phytopathogenic bacteria, but hrp homologs show 37.7% identity. This result indicated that the T3SS component genes are more conserved than the genes that are associated with HR and pathogenicity.

Isolation of T3SS Supramolecular Machinery from P. fluorescens 2P24

To identify the P. fluorescens type III secretion machinery, we attempted to extract the pilus-like structures from strain 2P24 by a modified method. To prevent the interference of flagella and to facilitate isolation of the T3SS machinery, we first made a non-flagellated mutant by knocking out the fliC gene and, therefore, eliminated their swimming ability on the agar plates (Supplementary Figure S1). The fliC mutant of strain 2P24 grew to log phase and were shocked osmotically and purified further by 30% (W/V) CsCl density gradient centrifugation. The components of the type III machinery were pelleted by ultracentrifugation, and their structure and morphological features were examined by TEM. The secretion machinery exhibited a pilus-like structure with cylindrical symmetry (Figure ). Individual components of the machinery that were enlarged on electron micrographs indicated that the basal part was comprised of two rings. To estimate the size of each portion, 20 purified type III complexes were measured by TEM. The pilus appendages were curved and they fragmented easily during sampling as reported by Roine et al. (1997) for P. syringae. Therefore, the length of the pilus could not be measured accurately. But it would longer than 1 μm and its diameter was approximately 13.1 nm. The length of the basal portion was 26.3 nm. The upper rings were estimated to be 22.1 nm in diameter and 12.8 nm in thickness. The lower rings were similar in diameter to the upper rings, but they were half as thick as the upper rings. To our knowledge, this is the first report that documents the proposed supramolecular structure of the type III T3SS secretion machinery for P. fluorescens (Figure ).

Electron micrograph of purified type III secretion complexes from Purified type III secretion complexes at different magnifications. The sample was obtained from the lower fraction of a 30% CsCl gradient centrifugation and observed by TEM. Scale bars as indicated in the images. (D) Proposed size of the type III secretion complex of P. fluorescens 2P24. The size of each portion was measured based on the 20 best preserved type III secretion complexes.

P. fluorescens 2P24 Elicits HR in Tobacco Leaves with the Help of Cosmid pCPP2274, but not pLN18

P. fluorescens 2P24 does not elicit a HR or any pathogenic symptom when infiltrated into a range of plant leaves such as tobacco, tomato, soybean, rice, and Arabidopsis thaliana at inoculum levels up to 108 cfu/ml. No significant increase in bacterial population levels was observed in 7 days after infiltration of P. fluorescens 2P24 into plant leaves (Wei et al., 2004a). To determine the potential function of the T3SS components in P. fluorescens 2P24, a T3SS cosmid named pHIR11 and its derivatives were used to combine with strain 2P24. P. fluorescens 2P24 that carried the hrp/hrc cluster of P. syringae pv. syringae 61 on the cosmid pHIR11 elicited an HR in tobacco at 108 cfu/ml, as was observed for P. fluorescens Pf0-1, which is a non-T3SS Pseudomonas strain that was used as a control strain (Compeau et al., 1988), (Figure ). The strain of P. fluorescens 2P24 that carried pLN18, a derivative of pHIR11 with an insertion mutation in the avirulent hopA1 gene (Huang et al., 1991), was unable to elicit a HR, as observed for P. fluorescens Pf0-1. This indicated that there is no HopA1 homolog in P. fluorescens 2P24 similar to that in strain Pf0-1. However, pCPP2274, a derivative of pHIR11 with a mutation in the hrpZ1 gene, enabled strain 2P24, but not Pf0-1, to elicit a strong HR in tobacco leaves. Therefore, we postulate that the HrpZ1 homolog, RspZ1 of strain 2P24, would complement a harpin deficiency in pCPP2274. We then made a rspZ1 mutant of strain 2P24, 2P24ΔZ1, and introduced pCPP2274 into this mutant. As expected, 2P24ΔZ1 with pCPP2274 failed to trigger HR in tobacco, and a plasmid-born rspZ1 in Pf0-1(pCPP2274) recovered HR (Figure ). This indicated that RspZ1 of P. fluorescens 2P24 has the same function as HrpZ1 in plant pathogens.

Elicitation of the HR by . Leaf panels of tobacco (N. tabacum cv. xanthi) were infiltrated with bacterial suspensions at a concentration of 108 cfu/ml using a blunt-ended syringe. Cell death was evaluated and representative leaves were photographed 48 h after inoculation. The experiment was repeated three times with similar results.

Partially Purified RspZ1 from Strain 2P24 Can Elicit Cell Death in Tobacco Leaves

It is known that the primary property of harpins is their ability to elicit cell death when infiltrated into tobacco leaf intercellular spaces. To test for cell death elicitation, possibility by RspZ1, which is a new harpin candidate in this work, we produced RspZ1 of strain 2P24 from E. coli cells carrying an appropriate derivative of pET-22b (Supplementary Figure S2). Here, HrpZ1 from P. syringae DC3000 was employed as a positive control. Like HrpZ1, RspZ1 was soluble after overexpression in E. coli. Each protein at 100 μg/ml was infiltrated into leaves of tobacco with or without lanthanum chloride, an inhibitor of harpin-induced cell death (He et al., 1993; Kvitko et al., 2007). Surprisingly, RspZ1 elicited a lanthanum chloride-inhibitable cell death in tobacco, which was the same as HrpZ1 (Figure ). An undiluted empty-vector preparation infiltrated into the same leaf as a control could not elicit any visible response. Elicitation of cell death by the application of an exogenous protein indicated that RspZ1from P. fluorescens 2P24 possesses a defining property of harpin proteins.

Partially purified harpins RspZ1 (from . 6× His-tagged recombinant protein preparations were diluted in MES buffer and infiltrated into panels of tobacco leaves with or without 2 mM lanthanum chloride, an inhibitor of HR. The presence or absence of confluent cell death was evaluated 24 h post-infiltration. A mock, undiluted, empty-vector (EV) preparation was always tested in parallel. The experiment was repeated twice with similar results.

The T3SS of P. fluorescens 2P24 Retains Ability to Secrete Effectors, but Loses the Effector Translocation Trait

T3SSs are complex macromolecular machines that span both the bacterial cell envelope and host cell barriers. The basic property of T3SS is to secrete and deliver proteins, commonly termed effectors, from the bacterial cytoplasm into the host cytoplasm (Alfano and Collmer, 1997; Xin and He, 2013). To determine whether the T3SS of strain 2P24 has the natural traits of T3SS, we used hemagglutinin (HA) immunoblot analysis and an CyaA injection assay to test HopQ1 secretion and translocation in 2P24. We introduced constructs carrying HopQ1, an avirulence determinant of P. syringae DC3000 in N. benthamiana (Wei et al., 2007), into 2P24, 2P24ΔC, Pf0-1, and its derivatives. The strains were grown overnight in KB broth, and cell-bound and supernatant fractions were subjected to Western blot. HopQ1-HA was detected in supernatant fractions from wild type 2P24, but not from the 2P24 rscC mutant (Figure ). Meanwhile, HopQ1-HA was detected also in supernatant fractions from Pf0-1with pLN18 and pCPP6212 (Oh et al., 2010), which is a pLN18 derivative missing hrpK1and a key translocator encoding gene; HopQ1-HA was not detected from Pf0-1 with pCPP3297, a pLN18 hrcC mutant defective in type III secretion (Figure ). These results indicated that effector proteins are secreted in culture through P. fluorescens T3SS.

HopQ1-HA secretion assay. Strains transformed with pCPP5372-hopQ1 were grown from an OD600 of 0.3 to an OD600 of 0.5. Cell pellet (C) and supernatant (S) fractions were separated by centrifugation. Fractions were analyzed by SDS-PAGE, followed by immunoblotting with anti-HA antibodies. (B) HopQ1-CyaA translocation into N. benthamiana. Strains transformed with pCPP5371-hopQ1 were infiltrated into panels of N. benthamiana leaves at 108 cfu/ml. 1.0 cm leaf disks were collected at 12 h post-inoculation. Effector translocation assays, based on cAMP production by the HopQ1-CyaA reporter, were performed in triplicate on disks from independent leaves. Means shown with the same letters are not different statistically at the 5% confidence level on the basis of Duncan’s multiple range test. (C) Strain 2P24 expressing HopQ1 in N. benthamiana does not elicit tissue collapse in accordance with the failure of translocation in 2P24. The bacteria carrying pCPP5372-hopQ1 were infiltrated as described above. Cell death was evaluated and representative leaves were photographed 48 h after inoculation. The experiment was repeated three times with similar results.

We then infiltrated the strains harboring HopQ1-CyaA into N. benthamiana leaves and determined cAMP levels, a product of the CyaA-catalyzed reaction, and cell deaths 12 and 48 h later, respectively. Plant tissue inoculated with P. fluorescens Pf0-1(pLN18)-expressing HopQ1-CyaA showed high levels of cAMP and strong HR, but we detected a sharply lower level of cAMP from the leaves with P. fluorescens Pf0-1(pCPP6212)-expressing HopQ1-CyaA, and no cAMP was detected from the leaves with P. fluorescens Pf0-1(pCPP3297)-expressing HopQ1-CyaA (Figure ). Accordingly, HopQ1-CyaA expressed in P. fluorescens Pf0-1(pLN18), but not in P. fluorescens Pf0-1(pCPP3297), triggered very strong cell death (Figure ). P. fluorescens Pf0-1(pCPP6212)-expressing HopQ1-CyaA elicited a weak cell death, because of the missing key translocator HopK1 (Figure ). However, we did not detect cAMP and cell death from plant tissue where HopQ1-CyaA was expressed in wild type 2P24 and 2P24ΔC (Figures ). Taken together, the results demonstrated that HopQ1 was injected into plant leaf cells by P. syringae, but not by P. fluorescens T3SS.

The T3SS Mutation has no Changes on Biocontrol Capacity of Strain 2P24

The rscC mutant strain was tested in vitro for possible phenotypic changes in traits that contribute to biocontrol by P. fluorescens 2P24. The mutant was compared to the parental strain 2P24 for the ability to produce secondary metabolites, such as the antibiotic 2,4-DAPG, HCN, exoprotease, and siderophores. Unfortunately, no phenotypic changes were found from the rscC mutant in any of the aforementioned tests (data not shown). The mutant strain was tested also for the ability to antagonize the plant pathogens Rhizoctonia solani and Ralstonia solanacearum. The results indicated that inactivation of the T3SS did not reduce the antagonistic ability of strain 2P24 against plant pathogens (Supplementary Table S1). The further biocontrol assays on tomato bacterial wilt disease also showed that the T3SS mutation did not result in a reduction in the biocontrol activity of strain 2P24 (Supplementary Table S2).

Strain 2P24 can Trigger Strong Functional MTI that is not Associated with T3SS

Pseudomonas fluorescens 2P24 is a soil-born PGPR that is present normally in the rhizosphere. We did not know if it could trigger local MTI when inoculated in plant leaves or whether the T3SS had some effect on potential MTI. We then used established assays to determine the extent that 2P24 and 2P24ΔC trigger ROS production, suppress P. syringae DC3000 HR and DC3000ΔhopQ1 disease as reported previously (Wei et al., 2013). Strain 2P24 triggered high levels of ROS production that might be induced by the flagellin because the fliC mutant of 2P24 failed to trigger ROS (Figure ), which is consistent with a previous report (Wei et al., 2013). Strain 2P24 also exhibited strong suppression of HR triggered by P. syringae DC3000 and pathogen growth of P. syringae DC3000ΔhopQ1 in N. benthamiana (Figures ). However, the deficiency of the T3SS did not impact functional MTI elicited by 2P24 in any of these tests (Figure ).

ROS assay of strain 2P24 and the rscC mutant. The bacteria were infiltrated at 108 cfu/ml into N. benthamiana leaves and 15 h later assayed for ROS production using L-102 chemiluminescence. ROS assay results are presented as the mean and SD based on three samples from three different plants. Means shown with the same letters are not different statistically at the 5% confidence level on the basis of Duncan’s multiple range test. (B) Challenge inoculum HR assays for functional MTI. Strain 2P24 and the rscC mutant were initiated by infiltrating N. benthamiana leaves with 108 cfu/ml (upper circles). After 6 h, an overlapping inoculation of 107 cfu/ml of the HR-inducing strain P. syringae pv. tomato DC3000 (lower circles) was made. The presence or absence of confluent cell death in the overlapping region was evaluated 48 h after strain DC3000 infiltration. (C) In the assay for functional MTI based on relative growth of virulent bacteria, strain 2P24 and the rscC mutant were infiltrated into N. benthamiana leaves at 108 cfu/ml and challenged 6 h later with an overlapping inoculation of DC3000ΔhopQ1 at 105 cfu/ml. At the indicated days after the challenge inoculation (dpi), 0.5 cm leaf disks were collected from areas of overlap between pre-treatment and challenge inoculations and bacterial populations were determined by dilution plating. Bacterial populations from three independent leaves were assayed in triplicate. Means shown with the same letters are not different statistically at the 5% confidence level on the basis of Duncan’s multiple range test.

Discussion

Most of the P. fluorescens bacteria are natural inhabitants of plant roots and soil. An increasing number of P. fluorescens strains are being studied due to their ability to produce secondary metabolites, such as antibiotics, volatile compounds, HCN, siderophores, cell wall degrading enzymes, and phytohormones (Majumder et al., 2014). As part of our research into the genetic basis for biocontrol capacity of P. fluorescens strain 2P24, we isolated and identified a gene cluster that encoded a typical T3SS from the genomic library. The T3SS gene cluster of P. fluorescens 2P24, rsp/rsc, showed greatest similarity to the hrp/hrc pathogenicity island of P. syringae, both at the level of genomic organization and amino acid sequence. The rsp/rsc cluster contained all of the nine conserved hrc genes and the hrpA1 gene, which composes the basal body and pilus of the T3SS in plant pathogens (Tampakaki et al., 2004). The same composition and organization of T3SS genes were found also from P. fluorescens Q8r1-96 (Mavrodi et al., 2011). And yet, P. fluorescens Q8r1-96 and 2P24 have the most intact T3SS components compared to other P. fluorescens strains.

Although the T3SS in P. fluorescens has been studied for many years, its supramolecular structure is still obscure. The presence of hrpA1 and all hrc homologs lends support to the proposition that T3SS machinery is produced in P. fluorescens 2P24. In this study, we modified the procedures and then isolated and visualized successfully the T3SS complexes from strain 2P24 for the first time after many attempts. Because P. fluorescens 2P24 also produces flagella, which is another kind of surface appendage that is very difficult to distinguish from the T3SS pilus when detached from bacteria, we created and used a fliC mutant that does not produce flagellin and forfeits swimming ability, under the guidance of similar reports on P. syrinage and Salmonella typhimurium (Kubori et al., 1998; Hu et al., 2001). The secretion machinery of P. fluorescens 2P24 exhibited a pilus-like structure similar to that of P. syringae that is composed of an elongated pilus and a cylindrical basal body (Hu et al., 2001). The successful isolation and identification of T3SS machinery from P. fluorescens 2P24 confirms the integrity of rsp/rsc genes in the genomic organization. Unlike the isolation condition for T3SS complex from plant pathogen P. syringae (Roine et al., 1997), we only were able to isolate the T3SS complex from KB rich medium, but not from the hrp-inducing medium. This might suggest that the T3SS in P. fluorescens 2P24 is not a strict pathogenic hrp-induced system, which is consistent with the presence of PGPR in the rhizosphere but not the leaf ecosystems.

Bacterial T3SS is of special interest because, by utilizing this system, bacteria are able to inject bacterial effector proteins directly into host cells. The typical process includes crossing the bacterial membranes termed secretion and the step of crossing the host membranes being called translocation (Alfano and Collmer, 2004). The cosmid pLN18 that contains a functional cluster of hrp/hrc T3SS genes from P. syringae, which is expressed in P. fluorescens, is sufficient to deliver effector proteins into plant cells (Huang et al., 1988). To test the functionality of P. fluorescens 2P24 T3SS, we introduced HopQ1 from P. syringae into P. fluorescens 2P24 and Pf0-1(pLN18) and tried to observe a HopQ1-dependent HR in leaves of N. benthamiana. However, we did not find expected HR from 2P24-expressing HopQ1, but we did find HR from P. fluorescens Pf0-1(pLN18)-expressing HopQ1. An immunoblot analysis showed that HopQ1-HA was secreted successfully through the T3SS by strain 2P24 that was dependent on the rscC gene present. But the HopQ1-CyaA translocation assay demonstrated that strain 2P24 failed to inject HopQ1-CyaA into plant cells, although a high level of HopQ1-CyaA proteins was detected from plant leaves expressed by P. fluorescens Pf0-1(pLN18). Further determination suggested the HopQ1-dependent HR expressed by P. fluorescens Pf0-1(pLN18) was patently dependent on HrpK1, which is a major translocator of bacterial T3SS, and which is absent from strain 2P24. Although the most similar T3SS in P. fluorescens Q8r1-96 was reported to translocate Rop effectors into tobacco leaves, the level of effector proteins was 100-fold lower than that expressed by P. fluorescens 55(pLN1965) (Mavrodi et al., 2011). It is very difficult to postulate that such translocation capacity by P. fluorescens Q8r1-96 is sufficient to trigger strong effector-dependent phenotypes like HR. Mavrodi et al. (2011) showed that the three Q8r1-96 Rop effectors expressed in P. fluorescens 55(pHIR11) and P. fluorescens 55(pLN1965) were capable of suppressing HopA1-dependent HR and flg22-dependent ROS production. It should be noted that these capabilities were based on high translocation levels of pHIR11and (pLN1965) in P. fluorescens 55, but not in the native T3SS of P. fluorescens Q8r1-96 (Mavrodi et al., 2011). Although the genome of strain 2P24 has not been sequenced and we do not know if 2P24 really has effector homologs, the fact that wild type 2P24 and the rscC mutant triggered the same high level of ROS production suggested that no significant T3SS-dependent MTI suppressor was present in strain 2P24. We also found that 2P24-expressing HopQ1 did not reduce the ROS level of wild type 2P24 (Supplementary Figure S3), which indicated also that HopQ1 was not translocated into plant cells through the T3SS of strain 2P24.

Besides effectors, other proteins like harpins secreted by T3SS play a critical role in microbe-host interactions. Harpins are universal components of plant pathogen T3SSs, which can elicit innate immunity when applied exogenously to plant cells (He et al., 1993; Kvitko et al., 2007). In P. syringae DC3000, four harpin proteins, HrpZ1, HrpW1, HopAK1, and HopP1, triggered cell death in tobacco with the purified proteins and they were involved also in effector translocation (Kvitko et al., 2007). The DNA sequence of the P. fluorescens 2P24 rsp/rsc cluster revealed the presence of a harpin-like encoding gene rspZ1. The purified RspZ1 protein elicited cell death in tobacco as do the usual harpin proteins. And rspZ1 also complemented the mutation of hrpZ1 from pHIR11 to translocate HopA1 and trigger cell death in tobacco. To date, in all of T3SS+ PGPR, only P. fluorescens Q8r1-96 was reported as having a RspZ1 homolog in the rsp/rsc cluster, whereas the functionality of it has not been determined (Mavrodi et al., 2011). Although our work could not define HrpZ1 as the sole harpin and translocator in strain 2P24, our results show for the first time that the cell death-like innate immunity triggered by RspZ1 aids our comprehensive understanding of the induced immunity and resistance by PGPR.

MAMPs are common elicitors in PGPR for basic resistance and induced systemic resistance (ISR) in plants (De Vleesschauwer and Hofte, 2009). Flagellin was investigated as the major MAMPs in pathogenic P. syrinage DC3000 or non-pathogenic P. fluorescens Pf0-1 (Wei et al., 2013). The flagellin-triggered MTI could be suppressed by injection of effectors (Wei et al., 2013). In P. fluorescens Q8r1-96, RopM, RopB, and RopAA suppressed both MTI and ETI immune responses, which was contrary to the capacity of Q8r1-96 to induce ISR in Arabidopsis thaliana (Mavrodi et al., 2011). However, strain 2P24 could elicit strong functional MTI and its endogenous TTSS could not deliver effectors to suppress MTI and ETI (Figure and Supplementary Figure S3), which is apparently consistent with the capacity of strain 2P24 to induce resistance in tomato (Wei et al., 2004a). Summarily, our data suggest that P. fluorescens 2P24 is a fantastic PGPR agent, which not only produces important secondary metabolites, but which also elicits strong functional MTI. Although we were unable to identify a role for 2P24 T3SS in biocontrol, it does not mean the T3SS in PGPR has no biological role. As a rhizosphere colonization bacterium, 2P24 is not like phyllosphere-derived pathogens in essence to inject proteins into mesophyll cells and trigger local innate immunity. A plausible explanation is that the T3SS acquirement in PGPR strains might be a consequence of cooption and could play a role in rhizosphere environment adaption and fitness (Jackson et al., 2005). Our ability to isolate the secretion+/translocation- T3SS machinery clarifies the basic functionality of PGPR T3SS, which should focus our future attention on identifying potential T3SS-secreted proteins that occur during root colonization or cell–cell interactions.

Author Contributions

H-LW and XZ designed research; PL, WZ, and H-LW performed research; PL, WZ, L-QZ, and HW analyzed data; H-LW wrote the paper.

Conflict of Interest Statement

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Table 1

Bacterial strains and plasmids used in this study.

Strain or plasmid	Genotype or relative phenotype	Source
Escherichia coli
DH5α	F- recA1 endA1 hsdR17 supE44 thi-1 gyrA96 relA1Δ (argF-lacZYA)I169Φ80lacZΔM15	Sambrook et al., 1989
Pseudomonas fluorescens
2P24	Plant growth-promoting bacterium	Wei et al., 2004a
ΔC	rscC deletion mutant	This study
ΔZ1	rspZ1 insertion mutant	This study
ΔfliC	fliC insertion mutant	This study
Pf0-1	Non-T3SS bacterium	Compeau et al., 1988
P. syringae
DC3000	Wild type; Rifr	Buell et al., 2003
ΔhopQ1	hopQ1 deletion mutant of strain DC3000	Wei et al., 2007
plasmids
pBluescript II SK+	ColE1 origin; Apr	Stratagene
pHSG299	ColE1 origin; Kmr	TaKaRa
pRK2013	ColE1 replicon with RK2 transfer region, helper plasmid; Kmr	Figurski and Helinski, 1979
pENTR/SD-TOPO	Entry vector for Gateway cloning; Kmr, Cmr	Invitrogen
pET-22b(+)	Expression vector; Apr	Novagen
pLAFR5	oriT cosmid; Tcr	Keen et al., 1988
pN11-7	rsp genes positive cosmid clone	This study
pN13-41	rsp genes positive cosmid clone	This study
pN31-20	rsp genes positive cosmid clone	This study
pBS11-7a	pBluescript containing 1.5 kb Hind III fragment from pN11-7	This study
pBS11-7b	pBluescript containing 5.8 kb EcoR I fragment from pN11-7	This study
pBS11-7c	pBluescript containing 6.4 kb EcoR I fragment from pN11-7	This study
pBS31-20b	pBluescript containing 4.1 kb EcoR I fragment from pN31-20	This study
pBS31-20a	pBluescript containing 6.6 kb Kpn I fragment from pN31-20	This study
pBS13-41	pBluescript containing 14 kb Kpn I fragment from pN13-41	This study
pHSGΔC	pHSG299::rscC	This study
pHSGΔZ1	pHSG299::rspZ1	This study
pHSGΔfliC	pHSG299::fliC	This study
pHIR11	pLAFR3 containing the P. syringae pv. syringae 61 hrp-hrc gene region	Huang et al., 1988
pLN18	pHIR11 derivative with shcA and hopA1 replaced by an nptII cassette	Huang et al., 1991
pCPP3297	pLN18 containing an unmarked hrcC deletion	Huang et al., 1991
pCPP2274	pHIR11 containing an unmarked deletion hrpZ1	Gopalan et al., 1996
pCPP5371	pBBR1MCS containing avrPto1 promoter, Gateway reading frame B cassette, and codons 2 to 406 of cya; Gmr, Cmr	Oh et al., 2007
pCPP5372	pBBR1MCS containing avrPto1 promoter, Gateway reading frame B cassette, and C-terminal HA tag; Gmr, Cmr	Oh et al., 2007
pEN-rspZ1	pENTR/SD-TOPO containing full length of rspZ1without stop codon	This study
pET22-rspZ1	pET22b expressing rspZ1	This study
pET22-hrpZ1	pET22b expressing hrpZ1DC3000	This study
p5372-rspZ1	pCPP5372 expressing rspZ1	This study
p5371-hopQ1	pCPP5371 expressing hopQ1	This study
p5372-hopQ1	pCPP5372 expressing hopQ1	This study

Table 2

Comparison of rsp/rsc and hrp/hrc cluster proteins in P. fluorescens and P. syringae.

ORFs	Length of predicted peptides(a.a.) in strain 2P24	Length of predicted peptides(a.a.) in the following strains/percentage identity to that of strain 2P24			Predicted function
		SBW25	Q8r1-96	DC3000
pL	183	183/51	197/98	184/44	RNA polymerase sigma factor; cytoplasmic
pJ	380	196/36	375/96	368/36	Type III secreted protein for translocation of effectors
cV	695	–1	699/63	695/96	Inner membrane associated protein
pQ	268	–	297/86	330/32	Similar to FliG, a cytoplasmic protein regulating flagellar biogenesis
cN	452	–	452/97	449/69	Inner membrane associated protein, soluble components, ATPases
pO	139	148/24	139/90	148/30	Protein of the export apparatus, cytoplasmic, chaperone-like activity
pP	189	152/38	189/83	189/28	Required for elicitation of HR and translocation and secretion of AvrPto1
cQ	368	337/41	367/87	238+137/37+622	Inner membrane associated protein
cR	217	217/68	217/98	200/72	Inner membrane associated protein
cS	84	87/71	84/100	88/70	Inner membrane associated protein
cT	265	262/59	265/97	264/54	Inner membrane associated protein
cU	366	365/58	366/96	359/54	Inner membrane associated protein
cE	149	–	149/93	131/49	Type III chaperone ShcE
pV	125	117/42	123/94	119/39	Negative regular of hrp expression; cytoplasmic
pT	69	67/37	69/99	67/50	Accessory protein, outer-membrane associated protein
cC	716	713/50	716/96	699/49	Outer-membrane associated protein
pG	145	130/31	145/90	143/30	Suppressor of the negative regulator HrpV mediated
pF	74	71/22	74/99	74/38	Required for elicitation of HR and translocation and secretion of AvrPto1
pE	197	191/31	197/87	193/30	Required for elicitation of HR
pD	196	193/33	196/87	176/40	Required for elicitation of HR and translocation and secretion of AvrPto1
cJ	295	271/62	293/94	268/58	Putative connectors of the secretion apparatus across the periplasm
pB	124	121/29	124/92	124/43	Required for elicitation of HR and translocation and secretion of AvrPto1
pZ1	309	–	309/92	370/31	Harpin, type III secreted protein
pA1	69	63/22	69/96	113/35	Structural component of pilus, type III secreted protein
pS	312	–	307/98	302/59	Transcriptional regulator, cytoplasmic