Literature DB >> 26761872

Virulence Factors of Staphylococcus aureus Isolated from Korean Pork bulgogi: Enterotoxin Production and Antimicrobial Resistance.

Byeong Su Jung1, Yong Ju Lee1, Na-Kyoung Lee1, Hyoun Wook Kim2, Mi-Hwa Oh2, Hyun-Dong Paik3.   

Abstract

The aim of this study was to investigate the antimicrobial resistance profiles of and the enterotoxin gene distribution in 4 strains of Staphylococcus aureus (S10-2, S10-3, S12-2, and S13-2) isolated from 90 bulgogi samples. The S. aureus enterotoxin H gene (seh) was found in all the strains, while the S. aureus enterotoxin A gene (sea) was found only in 3 of the 4 strains. The S10-2 strain expressed a combination of enterotoxin genes - seg, seh, sei, sej, selm, and seln. The strains S10-2 and S13-2 were resistant to ampicillin and penicillin G, and all the isolated strains were resistant to tetracycline. The S10-2 strain was the only mecA-positive strain; it was also resistant to β-lactam antibiotics. Thus, genes encoding enterotoxin as well as those conferring antibiotic resistance were identified in the S. aureus strains isolated from pork bulgogi. These results represents the potential occurrence of MRSA in pork bulgogi, and the need for a monitoring system for pork bulgogi in order to prevent an outbreak of staphylococcal food poisoning.

Entities:  

Keywords:  Staphylococcus aureus; antibiotic susceptibility; enterotoxin; foodborne pathogen

Year:  2015        PMID: 26761872      PMCID: PMC4662133          DOI: 10.5851/kosfa.2015.35.4.502

Source DB:  PubMed          Journal:  Korean J Food Sci Anim Resour        ISSN: 1225-8563            Impact factor:   2.622


Introduction

Staphylococcus aureus is one of the most common causes of food borne diseases and is found in a variety of foods (Andreja, 2012). S. aureus is a public health concern because of its ability to produce enterotoxins and to survive in harsh conditions. Staphylococcal enterotoxins (SEs) are a leading cause of staphylococcal food poisoning in humans; they may also be involved in other types of infections. The symptoms of SE poisoning are increased saliva secretion, vomiting, abdominal cramping, and diarrhea, with blood in some cases. Staphylococcal enterotoxins A (SEA) through to staphylococcal enterotoxin E (SEE) are the most commonly isolated enterotoxins in food poisoning outbreaks (Argudín . However, a number of other enterotoxin types designated SEG-SEJ, SElM, SElN, and SElO has been defined (Argudín ; Yarwood ). The extensive therapeutic use of antibiotics in humans and animals has contributed to the increase in antibiotic resistance in pathogens. Especially problematic among these resistant pathogens are methicillin-resistant S. aureus (MRSA), which have become a serious concern due to the high rates of community and nosocomial-acquired infections. In addition, the phenomenon of horizontal gene transfer has resulted in the spread of methicillin resistance, increasing the pressure on a limited supply of alternative antibiotics. Antibiotic resistance in MRSA is determined by the mecA and femA genes (Keun ). The mecA gene encodes a penicillin binding protein (PBP-2a), which has a low binding affinity for methicillin and other β-lactam antibiotics. Pork bulgogi is barbecued or pan-fired pork that has been marinated with a mixture of soy sauce, sugar, minced garlic, green onion, black pepper, and sesame oil. Its microbial safety was reported their bacterial condition (Ahn ; Hong ; Jo ). Due to the high salt content of soy sauce, bulgogi does not provide an environment suitable for microbial growth (Jo ). As a result, just 5 strains were isolated from 90 pork bulgogi samples (Ahn ). The low numbers of S. aureus isolates may be due to soy sauce, which has been shown to exert antimicrobial effects against S. aureus, Shigella flexneri, Vibrio cholera, Salmonella Enteritidis, and Escherichia coli (Kataoka, 2005). The aim of this study was to investigate the antimicrobial resistance profiles of and the enterotoxin gene distribution in S. aureus strains isolated from pork bulgogi.

Materials and Methods

Bacterial strains

The four S. aureus strains S10-2, S10-3, S12-2, and S13-2 were isolated from raw pork bulgogi using Baird-Parker agar plates enriched with egg yolk (EY) tellurite (Ahn ). Five different S. aureus strains KCCM 11593, ATCC 25923, KCCM 40510, KCCM 40511, and KCCM 40512 were used as standards. Frozen stocks were maintained at −80℃ in tryptic soy broth (TSB, Difco Laboratories, USA) containing 20% glycerol. The S. aureus strains were incubated at 37℃ for 24 h in TSB, and used for further study.

S. aureus DNA extraction

Following overnight growth, the S. aureus strains were harvested by centrifugation at 8,900 × g for 15 min. The pelleted cells were used for genomic DNA extraction using the AccuPrep® genomic DNA extraction kit (Bioneer Co., Korea), together with lysozyme treatment (Sigma Chemical Co., USA), according to the manufacturer’s instructions.

PCR detection of Staphylococcal enterotoxin genes

PCR was used to test for the presence of 23S rRNA, nuc, and staphylococcal enterotoxin (SE) genes defined (Argudín ; Yarwood ). The PCR reaction was performed in a 20 μL reaction volume containing 10 pmol of each primers (Table 1), 25 μL of 2×Go Taq® Green Master Mix (Promega, USA), 2 μL of template DNA. The final volume was adjusted to 50 μL using RNase free sterile water. All amplification steps were carried out in a thermocycler (Bioer, Switzerland) with an initial denaturation step at 94℃ for 5 min, followed by 30 cycles of denaturation at 94℃ for 2 min, annealing at 55-64℃ for 30 s, and a 30 s extension at 72℃, follow by a final extension at 72℃ for 10 min. The amplified PCR products were resolved by electrophoresis in a 1% agarose gel.
Table 1.

Used oligonucleotide primers and amplification conditions

GenesPrimerOligonucleotide sequencesProduct size (bp)Annealing temp. (℃)
23S rRNASTAUR2ACGGAGTTACAAAGGACGAC1,25064
STAUR4AGCTCAGCCTTAACGAGTAC
nucnuc-1GCGATTGATGGTGATACGGTT27955
nuc-2AGCCAAGCCTTGACGAACTAAAGC
seaSEA-1AAAGTCCCGATCAATTTATGGCTA219 55
SEA-2GTAATTAACCGAAGGTTCTGTAGA
sebSEB-1TCGCATCAAACTGACAAACG47655
SEB-2GCAGGTACTCTATAAGTGCC
secSEC-1GACATAAAAGCTAGGAATTT25755
SEC-2AAATCGGATTAACATTATCC
sedSED-1CTAGTTTGGTAATATCTCCT31755
SED-2TAATGCTATATCTTATAGGG
seeSEE-1TAGATAAAGTTAAAACAAGC16955
SEE-2TAACTTACCGTGGACCCTTC
segSEG-1AATTATGTGAATGCTCAACCCGATC64255
SEG-2AAACTTATATGGAACAAAAGGTACTAGTTC
sehSEH-1CAATCACATCATATGCGAAAGCAG37655
SEH-2CATCTACCCAAACATTAGCACC
seiSEI-1CTCAAGGTGATATTGGTGTAGG57755
SEI-2AAAAAACTTACAGGCAGTCCATCTC
sejSEJ-1CATCAGAACTGTTGTTCCGCTAG19255
SEJ-2CTGAATTTTACCATCAAAGGTAC
selmSEM-1TCTTAGGAACTATTATGGTAGC47155
SEM-2CCTGCATTAAATCCAGAA
selnSEN-1GGAGTTACGATACATGATGG29255
SEN-2ACTCTGCTCCCACTGAAC
seloSEO-1 TGATGATTATATAAATAATCGATTTACG24955
SEO-2ATATGTACAGGCAGTATCC
mecAmecA-1TCACCTTGTCCGTAACCTGA67857
mecA-2TCGTGTCACAATCGTTGACG
femAfemA-1CGAGGTCATTGCAGCTTGCT23157
femA-2CCAGCATTACCTGTAATCTCGCCA

Antibiotic susceptibility

Antibiotic susceptibility of the S. aureus strains were tested using the disc agar diffusion method on Mueller Hinton agar (Dection Dickinson, France), following the guidelines of the Clinical and Laboratory Standards Institute (CLSI, 2007). The antibiotic discs used were as tetracycline (30 μg), streptomycin (10 μg), gentamicin (30 μg), vancomycin (30 μg), amoxicillin (20 μg) and clavulanic acid (10 μg), ampicillin (10 μg), penicillin (10 IU), oxacillin (10 μg), cefazolin (30 μg), and cephalothin (30 μg). The strains were classified as susceptible, intermediate, or resistant according to the supplier’s instructions.

Detection of mecA and femA genes

The mecA and femA genes primers used as a biomarker for resistance. The FastPCR software program (http://primerdigital.com/fastpcr.hml) was used to analyze primers (Table 1) for self-dimerization, cross-dimerization, and optimum annealing temperature. PCR conditions was followed manufacture’s instruction, and annealing temperatures are shown in Table 1.

Results and Discussion

Detection of enterotoxin genes of the S. aureus strains isolated from pork bulgogi

The S. aureus strains were isolated from pork bulgogi using a selective medium in our previous study and were identified as S. aureus by Gram staining, catalase testing, latex agglutination, and the API Staph System (Ahn ). In this study, the 4 isolates were confirmed as S. aureus strains by PCR amplification of the 23S rRNA and nuc genes (Table 2).
Table 2.

Characteristics of isolated S. aureus strains from pork bulgogi

Isolate23S rRNA genenuc geneSE genesfemA genemecA gene
S10-2++seg, seh, sei, sej, selm, seln++
S10-3++sea, seh+
S12-2++sea, seh+
S13-2++sea, sed, seh+
Staphylococcal enterotoxins (SEs) belong to a large family of staphylococcal pyrogenic exotoxins, which have been implicated in food poisoning, causing toxic shock-like syndromes, and several allergic and autoimmune diseases (Ortega ). Fig. 1 shows the results for the PCR detection of the enterotoxin genes sea to selo. The strain S10-2 possessed 6 enterotoxin genes: seg, seh, sei, sej, selm, and seln. Strains S10-3 and S12-2 possessed the sea and seh enterotoxin genes. The strain S13-2 was shown to possess 3 genes encoding SEA, SED, and SEH. The seh gene, which encodes SEH, was detected in all the strains; however, there was no amplification of the enterotoxin genes seb, sec, see, and selo. Results of enterotoxin genes had a different as the strains. The enterotoxins SEA, SEB, and SED are the most common enterotoxins associated with human food-poisoning outbreaks (Argudín ; Zschck ). In addition, SEG, SEH, and SEI have also been shown to be emetic after oral administration in a primate model (Argudín ).
Fig. 1.

Agarose gel electrophoresis analysis of PCR products of enterotoxin genes. (A) 10-2, (B) 10-3, (C) 12-2, (D) 13-2. Lane 1, sea; lane 2, seb; lane 3, sec; lane 4, sed; lane 5, see; lane 6, seg; lane 7, seh; lane 8, sei; lane 9, sej; lane 10, selm; lane 11, seln; lane 12, selo.

S. aureus infections are primarily controlled through antibiotics. It is therefore concerning how rapidly this organism develops resistance to a large number of antibiotics. Here, we compared the antibiotic resistance of the S. aureus strains isolated from pork bulgogi to that of the standard strains (KCCM 11593 and ATCC 25923) and the MRSA strains (KCCM 40510, KCCM 40511, and KCCM 40512) (Table 3). As expected the standard S. aureus strains demonstrated no antibiotic resistance. The KCCM 40510 strain was resistant to tetracycline, streptomycin, amoxicillin and clavulanic acid, ampicillin, penicillin, oxacillin, cefazoline, and cephalothin. The strains KCCM 40511 and KCCM 40512 were resistant to ampicillin, penicillin G, and oxacillin. The S. aureus isolates S10-2, S10-3, S12-2, and S13-2 strains were all resistant to tetracycline, whereas the S10-2 and S13-2 strains were resistant to ampicillin and penicillin G. Thus, the resistance profile of the isolated strains was similar to that of the MRSA strains, KCCM 40511 and KCCM 40512. Our findings are also consistent with those of Pereira , who reported that ampicillin and penicillin resistance was frequently founded at a ratio of 70 and 73%, respectively.
Table 3.

Antibiotic resistance of control strains and isolated S. aureus from pork bulgogi

Antibiotic groupsAntibioticStrains
KCCM 11593ATCC 25923KCCM 40510KCCM 40511KCCM 40512S10-2S10-3S12-2S13-2
TetracyclinesTetracycline (30 μg)SaSRbSSRRRR
AminoglycosidesStreptomycin (10 μg)SSRSSSSSS
Gentamicin (30 μg)SSSRSSSSS
GlycopeptideVancomycin (30 μg)SSSSSSSSS
Amino penicillinAmoxicillin (20 μg)+Clavulanic acid (10 μg)SSRSSSSSS
β-LactamAmpicillin (10 μg)SSRRRRSSR
Penicillin (10 IU)SSRRRRSSR
Oxacillin (10 μg)SSRRRRSSS
CephalosporinsCefazoline (30 μg)SSRSSSSSS
Cephalothin (30 μg)SSRSSSSSS

aSensitive; bresistant.

aSensitive; bresistant. Table 2 shows results for detection of mecA and femA genes in the S. aureus strains isolated from pork bulgogi. All the tested strains possessed the femA gene. The MRSA strains KCCM 40510 and KCCM 40511 were positive for the mecA gene. Although the mecA gene was not detected in the S. aureus strain KCCM 40512, this strain was resistant to oxacillin. Among the strains isolated from pork bulgogi, only the strain S10-2 possessed the mecA gene; consequently, this strain was identified as a MRSA. Although the mecA gene was not detected in the S13-2 strain, antibiotic susceptibility testing revealed resistance to the β-lactam antibiotics, ampicillin, and penicillin. This may be due to a modified mecA gene, which was not detected by the primers used in this study. Antibiotic resistance can also be plasmid encoded rather than chromosomal (Lee and Lim, 2002). The MRSA strains isolated from pork bulgogi were resistant to a higher number of antibiotics than the methicillin-sensitive strains were. This is consistent with the finding that MRSA strains generally express genes that confer resistance to multiple antibiotics (Kumar ). The S10-2 and S13-2 strains were both resistant to ampicillin and penicillin G. However, the S10-2 stain expressed 6 enterotoxin genes (seg, seh, sei, sej, selm, and seln), while the S13-2 strain possessed only 3 enterotoxin genes (sea, sed, and seh). These results represents the potential occurrence of MRSA in pork bulgogi, and the need for a monitoring system for pork bulgogi in order to prevent an outbreak of staphylococcal food poisoning.
  8 in total

1.  Characterization and expression analysis of Staphylococcus aureus pathogenicity island 3. Implications for the evolution of staphylococcal pathogenicity islands.

Authors:  Jeremy M Yarwood; John K McCormick; Michael L Paustian; Paul M Orwin; Vivek Kapur; Patrick M Schlievert
Journal:  J Biol Chem       Date:  2002-01-30       Impact factor: 5.157

Review 2.  Functional effects of Japanese style fermented soy sauce (shoyu) and its components.

Authors:  Shigehiro Kataoka
Journal:  J Biosci Bioeng       Date:  2005-09       Impact factor: 2.894

3.  Antibiotic resistance and pathogenicity factors in Staphylococcus aureus isolated from mastitic Sahiwal cattle.

Authors:  Ravinder Kumar; B R Yadav; R S Singh
Journal:  J Biosci       Date:  2011-03       Impact factor: 1.826

4.  Sensory characteristics and cross-cultural consumer acceptability of Bulgogi (Korean traditional barbecued beef).

Authors:  J H Hong; E K Yoon; S J Chung; L Chung; S M Cha; M O'Mahony; Z Vickers; K O Kim
Journal:  J Food Sci       Date:  2011-04-27       Impact factor: 3.167

5.  Pattern of enterotoxin genes seg, seh, sei and sej positive Staphylococcus aureus isolated from bovine mastitis.

Authors:  M Zschöck; Bärbel Kloppert; W Wolter; H P Hamann; Ch Lämmler
Journal:  Vet Microbiol       Date:  2005-07-01       Impact factor: 3.293

6.  Characterization for enterotoxin production, virulence factors, and antibiotic susceptibility of Staphylococcus aureus isolates from various foods in Portugal.

Authors:  V Pereira; C Lopes; A Castro; J Silva; P Gibbs; P Teixeira
Journal:  Food Microbiol       Date:  2009-01-07       Impact factor: 5.516

Review 7.  Multiple roles of Staphylococcus aureus enterotoxins: pathogenicity, superantigenic activity, and correlation to antibiotic resistance.

Authors:  Elena Ortega; Hikmate Abriouel; Rosario Lucas; Antonio Gálvez
Journal:  Toxins (Basel)       Date:  2010-08-10       Impact factor: 4.546

Review 8.  Food poisoning and Staphylococcus aureus enterotoxins.

Authors:  María Ángeles Argudín; María Carmen Mendoza; María Rosario Rodicio
Journal:  Toxins (Basel)       Date:  2010-07-05       Impact factor: 4.546

  8 in total
  1 in total

1.  Nitroso-hemoglobin Increased the Color Stability and Inhibited the Pathogenic Bacteria in a Minced Beef Model: A Combined Low-field NMR Study.

Authors:  Hammad Hhm; Meihu Ma; Guofeng Jin; Yongguo Jin; Ibrahim Khalifa; Qi Zeng; Yuanyuan Liu
Journal:  Food Sci Anim Resour       Date:  2019-10-31
  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.