Profile of Virulence Factors in the Multi-Drug Resistant Pseudomonas aeruginosa Strains of Human Urinary Tract Infections (UTI).

BACKGROUND: Putative virulence factors are responsible for the pathogenicity of UTIs caused by Pseudomonas aeruginosa (P. aeruginosa). Resistance of P. aeruginosa to commonly used antibiotics is caused by the extreme overprescription of those antibiotics.
OBJECTIVES: The goal of the present study was to investigate the prevalence of virulence factors and the antibiotic resistance patterns of P. aeruginosa isolates in UTI cases in Iran. PATIENTS AND METHODS: Two hundred and fifty urine samples were collected from patients who suffered from UTIs. Samples were cultured immediately, and those that were P. aeruginosa-positive were analyzed for the presence of virulence genes using polymerase chain reaction (PCR) testing. Antimicrobial susceptibility testing (AST) was performed using the disk diffusion method.
RESULTS: Of the 250 urine samples analyzed, 8 samples (3.2%) were positive for P. aeruginosa. The prevalence of P. aeruginosa in male and female patients was 2.7% and 3.5%, respectively, (P = 0.035). In patients less than 10 years old, it was 4.2%, and in patients more than 55 years old, it was 4.2%. These were the most commonly infected groups. The highest levels of resistance were seen against ampicillin (87.5%), norfloxacin (62.5%), gentamycin (62.5%), amikacin (62.5%), and aztreonam (62.5%), while the lowest were seen for meropenem (0%), imipenem (12.5%), and polymyxin B (12.5%). LasB (87.5%), pclH (75%), pilB (75%), and exoS (75%) were the most commonly detected virulence factors in the P. aeruginosa isolates.
CONCLUSIONS: It is logical to first prescribe meropenem, imipenem, and polymyxin B in cases of UTIs caused by P. aeruginosa. Medical practitioners should be aware of the presence of levels of antibiotic resistance in hospitalized UTI patients in Iran.

1. Background

The kidneys are a pair of organs located in the back of the abdomen. All the blood in the human body passes through the kidneys several times each a day. The kidneys remove waste, control the body’s fluid balance, and regulate the balance of electrolytes. As the kidneys filter blood, they create urine, which collects in the renal pelvis. Infectious agents are one of the most significant causes of kidney function disorders. Infections of the kidney and the main urinary tract are called urinary tract infections (UTIs). UTIs are one of the most common bacterial infectious diseases in humans (1-3). UTIs account for more than 8 million referrals to health centers and hospitals, 1.5 million hospitalizations, and the diagnosis of 300,000 clinical syndromes annually in the United States (1, 4).

Pseudomonas aeruginosa (P. aeruginosa), a non-fermentative, aerobic, gram-negative, rod-shaped bacterium is the third most common pathogen associated with hospital-acquired UTIs (1, 5). Studies revealed that about 90% of cases of UTIs worldwide are caused by P. aeruginosa (1, 5).

Some of the most important virulence factors of P. aeruginosa are lipopolysaccharides (LPS), alginate (algD), pilus and non-pilus adhesins, flagellum, as well as exoenzymes or secretory virulence factors, such as elastase B (lasB), pyocyanin, protease, phospholipase (pclH and plcN), exoenzyme U (exoU), exoenzyme S (exoS), exotoxin A, fimbrial biogenesis protein (pilB), neuraminidase (nan1), hemolysins (rhamnolipids), and siderophores (6, 7). These genes are responsible for colonization and adhesion of bacterium in the urinary epithelium.

Treatment of urinary tract and kidney infections caused by the P. aeruginosa often requires antibiotic therapy, but the levels of antibiotic resistance in the rough strains of this bacterium have drastically increased over time (8).

2. Objectives

Due to the uncertain epidemiology and prevalence of P. aeruginosa in Iranian patients who suffer from UTIs, the present study was conducted to investigate the profile of virulence factors and antibiotic resistance patterns of the P. aeruginosa strains in Iranian cases of UTIs.

3. Patients and Methods

3.1. Ethical Considerations

Ethical committees of the educational hospitals approved the general principles and framework of the present investigation. Written informed consent was obtained from all of the study’s patients, parents, or guardians. Personal information of all patients was confidential.

3.2. Sample Collection

From September 2014 to April 2015, a total of 250 urine samples were collected from patients who suffered from UTIs. All patients were hospitalized in Iranian educational hospitals. The presence of UTIs was confirmed using the ultrasound technique (9). Midstream urine samples were collected using the suprapubic aspiration (SPA) method (10). Personal information, such as the age and sex of the patients, was recorded for each sample, and all samples were then transferred to the laboratory in an ice-packed cooler.

3.3. Pseudomonas aeruginosa Isolation

The urine samples were inoculated onto blood, MacConkey (Merck, Germany), and nutrient agar (Merck, Germany) and incubated at 37°C for 24 hours. Colonies that produced pyoverdin, pyocyanin, and pyorubin pigments were transferred to nutrient agar and subcultured more than once to obtain pure cultures. The isolates were identified using conventional biochemical tests such as motility, oxidase, catalase, citrate utilization, gelatinase liquefaction, urease production, nitrate reduction, alkaline protease production, triple sugar iron agar, oxidative-fermentative, indole, lecithinase production, and haemolysin production.

3.4. Antimicrobial Susceptibility Testing of Pseudomonas aeruginosa Isolates

The pattern of antimicrobial resistance was studied using the simple disk diffusion technique. The Mueller-Hinton agar (Merck, Germany) medium was used for this purpose. Antibiotic resistance of P. aeruginosa strains against 14 commonly used antibiotics, including norfloxacin (30 µg/disk), ampicillin (10 u/disk), imipenem (30 u/disk), gentamycin (10 µg/disk), ciprofloxacin (5 µg/disk), cefipime (30 µg/disk), cefoperazone (30 µg/disk), cotrimoxazole (30 µg/disk), polymyxin B (300 U/disk), meropenem (10 µg/disk), amikacin (30 u/disk), vancomycine (5 µg/disk), ceftazidime (30 µg/disk), aztreonam (30 µg/disk) and antibiotic agents (Oxoid, UK), were analyzed using the Clinical Laboratory Standards Institute protocol (CLSI) (11). P. aeruginosa (ATCC 27853) was used as a quality control in each reaction.

3.5. DNA Extraction From the Pseudomonas aeruginosa Isolates

Total genomic DNA was extracted from the bacterial colonies. A single colony was inoculated on 5mL of brain heart infusion broth and incubated overnight at 37ºC. Then 1.5 mL of a saturated culture was harvested by centrifugation for 5 minutes at 14,000 rpm. The cell pellet was resuspended and lysed in 200µl of lysis buffer (40 mM Tris-acetate pH 7.8, 20 mM sodium-acetate, 1 mM EDTA, and 1% SDS) by vigorous pipetting. To remove most proteins and cell debris, 66 µl of 5M sodium chloride solution was added, mixed well, and then the viscous mixture was centrifuged at 12,000 rpm for 10 minutes at 4ºC. After transferring the clear supernatant into a new Eppendorf tube, an equal volume of chloroform was added, and the tube was gently inverted at least 50 times until a milky solution was completely formed. Following centrifugation at 14,000 rpm for 5 minutes, the supernatant was then removed to another Eppendorf tube and a double volume of 100% ethanol was added. The tubes were gently inverted 5 to 6 times and then centrifuged at 10,000 rpm for 5 minutes. The supernatant was discarded and 1mL of ethanol (70%) was added to the pellet, and the tubes were centrifuged at 10,000 rpm for 5 minutes. Finally, the supernatant was discarded, and the pellet was dried for 10 minutes at room temperature. The pellet was then resuspended in 100µl H2O. The stock was kept at -20ºC until use. The DNA concentration was determined by measuring absorbance of the sample at 260 nm using a spectrophotometer (12).

3.6. PCR Amplification of Putative Virulence Factors

The PCR method was used to study the distribution of exoS, exoU, algD, pilB, nan1, lasB, and place virulence factors (13, 14). Oligonucleotide primers and the amount of products are shown in Table 1. The PCR mixture contained 200 µM of each dNTP (Fermentas, Germany), PCR buffer (10 mM Tris/HCl, 50 mM KCl, 1.5 mM MgCl2, pH 8.3), DMSO at a final concentration of 4 %, 12.5 pmol of each primer, 1 U Taq DNA polymerase (Fermentas, Germany), and 25 ng DNA template. The DNA was amplified in a programmable thermal cycler (Eppendorf Mastercycler® 5330, and Eppendorf-Netheler-Hinz GmbH PCR (Hamburg, Germany) device using the following protocol: 94ºC for 3 minutes, 25 - 30 cycles of 94ºC for 35 - 45 seconds, 53 - 62ºC for 45 - 60 seconds, 72ºC for 45 - 95 seconds, and 72ºC for 7 minutes.

Table 1.

Primer Sequence and Size of Products Used for Detection of Virulence Factors in Pseudomonas aeruginosa Isolates of Patients Who Suffered From UTIs (15,16).

Target Gene	Primer Sequence (5’ – 3’)	PCR Product, bp
pilB		826
F	ATGAACGACAGCATCCAACT
R	GGGTGTTGACGCGAAAGTCGAT
algD		1310
F	ATGCGAATCAGCATCTTTGGT
R	CTACCAGCAGATGCCCTCGGC
nan1		1317
F	ATGAATACTTATTTTGATAT
R	CTAAATCCATGCTCTGACCC
plcH		307
F	GAAGCCATGGGCTACTTCAA
R	AGAGTGACGAGGAGCGGTAG
lasB		300
F	GGAATGAACGAGGCGTTCTC
R	GGTCCAGTAGTAGCGGTTGG
exoU		428
F	GGGAATACTTTCCGGGAAGTT
R	CGATCTCGCTGCTAATGTGTT
exoS		504
F	CTTGAAGGGACTCGACAAGG
R	TTCAGGTCCGCGTAGTGAAT

3.7. Agarose Gel Electrophoresis

Fifteen microliters of PCR products were resolved in a 1.5% agarose gel containing 0.5 mg/mL of SYBR Green in Tris-borate-EDTA buffer at 90 V for 40 minutes, also using suitable molecular weight markers. The products were examined under ultraviolet light. P. aeruginosa ATCC 27853, P. aeruginosa ATCC 9027, and P. aeruginosa ATCC 10145 rough strains, purchased from the Pasteur Institute in Tehran, Iran, were used as positive controls and distilled water (DW, Merck, Germany) was used as a negative control.

3.8. Statistical Analysis

The results were transferred to a Microsoft Excel spreadsheet (Microsoft Corp., Redmond, WA) for analysis. Statistical analysis was performed using SPSS/16.0 software (SPSS Inc., Chicago, IL) to determine significant relationships among incidences of the virulence genes of P. aeruginosa which were isolated from the patients’ urine samples. The Chi-square test and Fisher’s exact 2-tailed test analyses were performed in this study. Statistical significance was found to be a P value < 0.05.

4. Results

The results of the present investigation revealed that of a total 250 urine samples analyzed in this study, 8 samples (3.2%) were infected with P. aeruginosa. Table 2 shows the total distribution of P. aeruginosa in various studied groups. The prevalence of P. aeruginosa in the male and female patients of our study was 2.7% and 3.5%, respectively (P = 0.035). Patients less than 10 years old (4.2%) and patients more than 55 years old (4.2%) were the most commonly infected of the patient groups studied. There were statistically significant differences in the prevalence of P. aeruginosa between patients less than 10 years old and patients from 10 - 25 years old (P = 0.027) and patients more than 55 years old and patients 40 - 55 years old (P = 0.035).

Table 2.

Sexual and Senile Distribution of Pseudomonas aeruginosa in the Urine Samples of Iranian Patients

Different Criteria	No. of Samples	Prevalence of P. aeruginosa (%)
Gender
Male	110	3 (2.7)
Female	140	5 (3.5)
Age, y
< 10	70	3 (4.2)
10 - 25	40	1 (2.5)
25 - 40	35
40 - 55	35	1 (2.8)
55	70	3 (4.2)
Total	250	8 (3.2)

Table 3 presents the prevalence of antibiotic resistance in the P. aeruginosa isolates of Iranian patients. P. aeruginosa strains in our investigation had the highest levels of resistance against ampicillin (87.5%), norfloxacin (62.5%), gentamycin (62.5%), amikacin (62.5%), and aztreonam (62.5%). P. aeruginosa strains did not have any resistance against meropenem. Also, the prevalence of resistance against imipenem (12.5%) and polymyxin B (12.5%) were low. There were no statistically significant differences in the prevalence of antibiotic resistance between the bacterial strains of males and females. There were significant differences between resistance to ampicillin and imipenem (P = 0.017), polymyxin B and gentamycin (P = 0.022), norfloxacin and ciprofloxacin (P = 0.035), amikacin and cefepime (P = 0.031), and aztreonam and cotrimoxazole (P = 0.037). P. aeruginosa strains in patients less than 10 years old had the lowest prevalence of antibiotic resistance, while P. aeruginosa strains in patients of 55 years old had the highest (P = 0.026).

Table 3.

Prevalence of Antibiotic Resistance in the Pseudomonas aeruginosa Isolates of Iranian Patients[a]

Criteria (No. of Isolates)	Prevalence of Antibiotic Resistance (%)
	Nor	AMP	IMP	Gen	CIP	Cef	Cefo	Cotr	Pol B	Merop	AMK	Van	Cefta	Azt
Gender
Male (3)	2 (66.6)	3 (100)		3 (100)	2 (66.6)	1 (33.3)	1 (33.3)	1 (33.3)			2 (66.6)	1 (33.3)	1 (33.3)	2 (66.6)
Female (5)	3 (60)	4 (80)		4 (80)	3 (60)	2 (40)	2 (40)	2 (40)	1 (20)		3 (60)	2 (40)	2 (40)	3 (60)
Age, y
< 10 (3)		2 (66.6)
10 - 25 (1)	1 (100)	1 (100)									1 (100)			1 (100)
40 - 55 (1)	1 (100)	1 (100)		1 (100)	1 (100)	1 (100)	1 (100)	1 (100)			1 (100)	1 (100)	1 (100)	1 (100)
> 55 (3)	3 (100)	3 (100)	1 (33.3)	2 (66.6)	2 (66.6)	2 (66.6)	2 (66.6)	2 (66.6)	1 (33.3)		3 (100)	2 (66.6)	2 (66.6)	3 (100)
Total (8)	5 (62.5)	7 (87.5)	1 (12.5)	5 (62.5)	3 (37.5)	3 (37.5)	3 (37.5)	3 (37.5)	1 (12.5)		5 (62.5)	3 (37.5)	3 (37.5)	5 (62.5)

aAbbreviations: AMK, amikacin (30 u/disk); AMP, ampicillin (10 u/disk); Azt, aztreonam (30 µg/disk); Cef, cefipime (30 µg/disk); Cefo, cefoperazone (30 µg/disk); Cefta, ceftazidime (30 µg/disk); CIP, ciprofloxacin (5 µg/disk); Cotr, cotrimoxazole (30 µg/disk); Gen, gentamycin (10 µg/disk); IMP, imipenem (30 u/disk); Merop, meropenem (10 µg/disk); Nor, norfloxacin (30 µg/disk); Pol B, polymyxin B (300 U/disk); Van, vancomycine (5 µg/disk).

Table 4 displays the prevalence of virulence factors in the P. aeruginosa isolates of Iranian patients. The most commonly detected virulence factors in the P. aeruginosa isolates of Iranian patients who suffered from UTIs were lasB (87.5%), plcH (75%), pilB (75%), and exoS (75%). The nan1 gene was the least commonly detected virulence factor (12.5%). There were no statistically significant differences for the prevalence of virulence factors between male and female patients. Patients less than 10 years old had the highest levels of virulence factors, even more than patients 55 or more years old (P = 0.037). Significant differences were seen for the prevalence of lasB and nan1 genes (P = 0.022).

Table 4.

Prevalence of Virulence Factors in the Pseudomonas aeruginosa Isolates of Iranian Patients

Criteria (No. of Isolates)	Prevalence of Virulence Factors (%)
	algD	exoS	exoU	nan1	plcH	lasB	pilB
Gender
Male (3)	2 (66.6)	3 (100)	1 (33.3)		2 (66.6)	3 (100)	3 (100)
Female (5)	3 (60)	3 (60)	2 (40)	2 (40)	4 (80)	4 (80)	3 (60)
Age, y
< 10 (3)	2 (66.6)	2 (66.6)	1 (33.3)	1 (33.3)	2 (66.6)	2 (66.6)	2 (66.6)
10 - 25 (1)	1 (100)	1 (100)	1 (100)		1 (100)	1 (100)	1 (100)
40 - 55 (1)	1 (100)	1 (100)	1 (100)		1 (100)	1 (100)	1 (100)
> 55 (3)	1 (33.3)	2 (33.3)	-	1 (33.3)	2 (66.6)	3 (100)	2 (66.6)
Total (8)	5 (62.5)	6 (75)	3 (37.5)	2 (12.5)	6 (75)	7 (87.5)	6 (75)

5. Discussion

Bacteria are the most common cause of UTIs. Normally, bacteria that enter the urinary tract are rapidly removed by the body before they cause symptoms to appear. However, bacteria sometimes overcome the body’s natural defenses and cause infection.

The present study has identified the high prevalence of virulent and resistant strains of P. aeruginosa in the urine samples of Iranian patients who suffered from UTIs. In total, 3.2% of the patients were infected with P. aeruginosa with the higher prevalence of the bacteria in females, patients less than 10 years old, and patients older than 55. Our results showed that patients 55 years of age and older had the highest levels of antibiotic resistance, while patients less than 10 years old had the highest levels of virulence factors. Possible reasons for the high distribution of P. aeruginosa recorded in our study were the low quality of health care, lack of sanitary conditions in hospitals, unnecessary use of urine catheters, surge the age of circumcision in boys, overprescription of surgical drugs, and the existence of antibiotic resistance in bacterial strains. A possible reason for the lower prevalence of antibiotic resistance in patients less than 10 years old is that these patients were not usually treated with antibiotics. Because of this, the number of diseases in these patients is much lower than those of the elderly patients. Therefore, the antibiotics are used less frequently in the younger age group. Females have a relatively short and wide urethra, so bacterial penetration is easier in females, and that is possibly the reason for their higher prevalence of P. aeruginosa. Also, host factors such as changes in normal vaginal flora may put females at higher risk for UTIs. Therefore, they may be more prone to contract UTIs. The narrow and long urethra and higher resistance of males to UTIs are probably the causes for their lower prevalence of UTIs. Comparable findings have been described by Zorc et al. (17), Bitsori et al. (5), and Nickavar and Sotoudeh (15). Several investigations that were conducted on UTIs caused by P. aeruginosa in India (16), Iran (18, 19), Kolkata (20), and Nigeria (21) revealed that the total prevalence of bacteria is about 3 - 16% which was considerable. Differences in the type of UTIs, method of sampling, number of samples collected, method of experiment, sex and age of patients, and the geographical area where the samples were collected are the main contributing factors for the differences in the prevalence of P. aeruginosa in various investigations.

P. aeruginosa strains of our research that had the lowest levels of antibiotic resistance were meropenem (0%), imipenem (12.5%), and polymyxin B (12.67%), while resistance to ampicillin (87.5%), norfloxacin (62.5%), gentamycin (62.5%), amikacin (62.5%), and aztreonam (62.5%) was high. Differences in the philosophies of medical practitioners regarding antibiotic prescription caused variations in the levels of antibiotic resistance against different antibiotics. Additionally, differences in the bactericidal activities of antibiotics and difficulty in developing resistance against various antibiotics are two reasons for differences in the levels of antibiotic resistance. However, excessive and indiscriminate prescription of ampicillin, norfloxacin, gentamycin, amikacin, and aztreonam antibiotics caused P. aeruginosa strains in our research to experience high levels of resistance. Of research conducted in this field (18, 19, 22-24), all the studies showed a high distribution of antibiotic resistance against ampicillin, gentamycin, ciprofloxacin, and amikacin. The high efficacy of imipenem for treatment of UTIs caused by P. aeruginosa strains has been previously reported in Turkey (25), Iran (18, 19), Indonesia (26), and India (27). Previous investigation (28) reported high levels of P. aeruginosa resistance against imipenem (44.1%). Other investigations have reported the high prevalence of multidrug resistance in the P. aeruginosa strains of UTIs (29-31).

Total prevalence of algD, exoS, exoU, nan1, plcH, lasB, and pilB virulence factors in the P. aeruginosa strains of our investigation were 62.5%, 75%, 37.5%, 12.5%, 75%, 87.5%, and 75%, respectively. The prevalence of the exoS factor was much higher in other types of clinical human infections as in the studies carried out by Fazeli and Momtaz (32) and Hamood et al. (33). Another study conducted on UTI cases in Iran showed that the total prevalence of exoS and nan1 genes were 46.6% and 47.7%, respectively (34). A high prevalence of lasB, exoU, and exoS genes in UTI cases was previously reported in Australia (35) and Iran (32). Bulgarian investigations (36) revealed that the total prevalence of lasB, plcH, algD, exoS, exoU, pilB, and nan1 virulence factors was 100%, 91.6%, 91.1%, 62.4%, 30.2%, 23.8% and 21.3%, respectively, which was very similar to our results. Adhesion, attachment, invasion, inducing cytoskeleton disruption, inactivate eukaryotic cell function, actin depolimerization, phospholipase activities, and disrupted eukaryotic cell membranes are the main functions of the lasB, plcH, algD, exoS, exoU, pilB, and nan1 virulence factors of P. aeruginosa (37, 38).

In conclusion, we identified a large number of virulent and resistant strains of P. aeruginosa in the urine samples of Iranian patients who suffered from UTIs. Our data indicate that resistance against ampicillin and gentamycin and plcH, lasB, pilB and exoS virulence factors were the most commonly detected features in the P. aeruginosa strains isolated from Iranian patients with UTIs. Hence, the judicious use of antibiotics by clinicians is essential. Additionally, because of the variation of the resistance patterns in each hospital, it is important for each region and every hospital to formulate their own antibiotic usage policies according to their particular resistance patterns. We recommend first prescribing meropenem, imipenem, and polymyxin B for the treatment of UTI cases in Iran.