Literature DB >> 26753612

Mechanism of 2,3-butanediol stereoisomers formation in a newly isolated Serratia sp. T241.

Liaoyuan Zhang1, Zewang Guo1, Jiebo Chen1, Quanming Xu1, Hui Lin1, Kaihui Hu1, Xiong Guan1, Yaling Shen2.   

Abstract

Serratia sp. T241, a newly isolated xylose-utilizing strain, produced three 2,3-butanediol (2,3-BD) stereoisomers. In this study, three 2,3-butanediol dehydrogenases (BDH1-3) and one glycerol dehydrogenase (GDH) involved in 2,3-BD isomers formation by Serratia sp. T241 were identified. In vitro conversion showed BDH1 and BDH2 could catalyzed (3S)-acetoin and (3R)-acetoin into (2S,3S)-2,3-BD and meso-2,3-BD, while BDH3 and GDH exhibited the activities from (3S)-acetoin and (3R)-acetoin to meso-2,3-BD and (2R,3R)-2,3-BD. Four encoding genes were assembled into E. coli with budA (acetolactate decarboxylase) and budB (acetolactate synthase), responsible for converting pyruvate into acetoin. E. coli expressing budAB-bdh1/2 produced meso-2,3-BD and (2S,3S)-2,3-BD. Correspondingly, (2R,3R)-2,3-BD and meso-2,3-BD were obtained by E. coli expressing budAB-bdh3/gdh. These results suggested four enzymes might contribute to 2,3-BD isomers formation. Mutants of four genes were developed in Serratia sp. T241. Δbdh1 led to reduced concentration of meso-2,3-BD and (2S,3S)-2,3-BD by 97.7% and 87.9%. (2R,3R)-2,3-BD with a loss of 73.3% was produced by Δbdh3. Enzyme activity assays showed the decrease of 98.4% and 22.4% by Δbdh1 and Δbdh3 compared with the wild strain. It suggested BDH1 and BDH3 played important roles in 2,3-BD formation, BDH2 and GDH have small effects on 2,3-BD production by Serratia sp. T241.

Entities:  

Mesh:

Substances:

Year:  2016        PMID: 26753612      PMCID: PMC4709696          DOI: 10.1038/srep19257

Source DB:  PubMed          Journal:  Sci Rep        ISSN: 2045-2322            Impact factor:   4.379


2,3-butanediol (2,3-BD) and its dehydrogenation product, acetoin (AC), are important biobased chemicals that can be produced by biotechnological routes12. 2,3-BD have potential applications in the manufacture of printing inks, perfumes, fumigants, moistening and softening agents, plasticizers, and as a carrier for pharmaceuticals34567. While AC is a natural flavor applied widely in food, cosmetics, pharmacy and chemicals synthesis8910. 2,3-BD contains two stereo centers, resulting in three stereo isomers including (2R,3R)-, meso- and (2S,3S)-forms, and AC exists in two stereoisomeric forms: (3R)-acetoin and (3S)-acetoin, which are important potential pharmaceutical intermediates111213. All of the isomers of AC and 2,3-BD can be produced by natural strains. However, the stereoisomeric composition of AC and 2,3-BD formed by bacteria differs among strains, such as P. polymyxa produced (2R,3R)-2,3-BD and (3S/3R)-AC with a small amount of meso-2,3-BD14, and (2S,3S)-2,3-BD/meso-2,3-BD with (3S/3R)-AC could be obtained by K. pneumoniae, K. oxytoca and S. marcescens515. In previous studies, two models were proposed for explaining 2,3-BD stereoisomers formation. The model proposed by Voloch et al. postulates the presence of an acetoin racemase and two acetoin reductases in K. pneumoniae. Two acetoin reductases catalyze the reduction of (3S)-AC to (2S,3S)-2,3-BD and (3R)-AC to meso-2,3-BD, respectively, whereas acetoin racemase is responsible for catalyzing the interconversion between (3S)-AC and (3R)-AC16. Ui et al. have proposed another model for the formation of 2,3-BD stereoisomers in K. pneumoniae which is involved in three butanediol dehydrogenases: meso-butanediol dehydrogenase (R-acetoin forming), meso-butanediol dehydrogenase (S-acetoin forming) and (2S,3S)-2,3-butanediol dehydrogenase. The authors separated the butanediol dehydrogenases individually and determined their stereospecificities. However, the presence of acetoin or butanediol racemase was not confirmed in their experiments17. Recent studies show that three key enzymes including α-acetolactate synthase (ALS), α-acetolactate decarboxylase (ALDC), and 2,3-butanediol dehydrogenase (BDH, also called AC/diacetyl reducatse, AR) are involved in the formation of AC and 2,3-BD stereoisomers from pyruvate18192021. First, two molecules of pyruvate condense to yield α-acetolactate and release one molecule of CO2 by ALS, then α-acetolactate is decarboxylated into (3R)-AC by ALDC2223. Meanwhile, α-acetolactate is also readily to undergo nonenzymatic oxidative decarboxylation and form diacetyl (DA) under oxygen supply conditions24. Finally, (3R)-AC and DA are reduced into 2,3-BD with the corresponding configurations by different BDHs. In addition, reports have shown that glycerol dehydrogenases (GDH) play an important role in the formation of 2,3-BD stereoisomers. A new model have been proposed for the formation of 2,3-BD stereoisomers in K. pneumoniae which includes two enzymes (meso-BDH and GDH). The meso-BDH enzyme catalyzes the stereospecific conversion of (3R)-AC to meso-2,3-BD and DA to (2S,3S)-2,3-BD via (3S)-AC as an intermediate, whereas GDH shows the abilities in the conversion from (3R)-AC to (2R,3R)-2,3-BD and DA to meso-2,3-BD via (3S)-AC as an intermediate. The two enzymes contribute to the formation of three 2,3-BD isomers in K. pneumoniae25. Therefore, the existence of multiple stereospecific dehydrogenase in natural strains is regarded as key factor for the mixed formation of AC and 2,3-BD stereoisomers1126. Several BDHs and GDHs involved in AC and 2,3-BD isomers formation have been identified and characterized in recent studies. In summary, BDHs can be divided into three classes: meso-BDH, (2S,3S)-BDH and (2R,3R)-BDH. The meso-BDHs from K. pneumoniae and S. marcescens belonged to the short-chain dehydrogenase/reductase (SDR) superfamily and contributed to meso-2,3-BD and (2S,3S)-2,3-BD production from (3R)-AC and (3S)-AC respectively1127. While the (2R,3R)-BDHs from P. polymyxa and Bacillus subtilis belonged to the medium-chain dehydrogenase/reductase (MDR) superfamily and converted (3R)-AC and (3S)-AC into (2R,3R)-2,3-BD and meso-2,3-BD1428. In addition, two (2S,3S)-BDHs from Rhodococcus erythropolis and Brevibacterium saccharolyticum were reported to possess absolute substrate stereospecificity in the reduction of DA to (2S,3S)-2,3-BD via (3S)-AC293031. Recent studies showed that GDHs in K. pneumoniae, Bacillus licheniformis and S. marcescens played a dual role in glycerol metabolism and 2,3-BD formation43233. In vitro conversion showed that GDH could catalyze the conversion from (3R)-AC and (3S)-AC to (2R,3R)-2,3-BD and meso-2,3-BD, which is similar to (2R,3R)-BDH. During sugar fermentation process, K. pneumoniae produced a mixture of meso-2,3-BD and (2S,3S)-BD. However, three isomers of 2,3-BD were formed simultaneously when glycerol was used as carbon source, which suggested that the formation of 2,3-BD isomers also was influenced by culture conditions2533. Serratia sp. T241, a newly isolated 2,3-BD producing strain in our lab, could utilize xylose and glucose as carbon sources to produce 2,3-BD, exhibiting a potential for 2,3-BD production based on lignocellulose-derived sugars. Interestingly, this strain T241 could produce three isomers of 2,3-BD simultaneously during the sugar fermentation process. Usually natural microorganisms produce a mixture of (2S,3S)-2,3-BD/meso-2,3-BD or (2R,3R)-2,3-BD/meso-2,3-BD. It suggested that there might be some differences for the mechanism of AC and 2,3-BD stereoisomers formation between strain T241 and other reported 2,3-BD producing strains. To clarify the differences of 2,3-BD isomers formation between Serratia sp. T241 and other 2,3-BD producing strains, a blast search based on Serratia sp. genome sequence was carried out using known functional BDHs (meso-BDH, (2S,3S)-BDH and (2R,3R)-BDH) and GDHs sequences. The obtained putative BDH/GDH genes were selected to perform in vitro and in vivo experiments. Heterogenous expression and pathway assembly in E. coli along with budA (acetolactate decarboxylase) and budB (acetolactate synthase), responsible for converting pyruvate into acetoin, confirmed that the putative BDH/GDH enzymes showed the abilities in the interconversion between AC and 2,3-BD, which contributed to all the AC and 2,3-BD isomers formation. Furthermore, gene deletion and enzyme assay verified the roles of the genes for AC and 2,3-BD isomers formation in Serratia sp. T241.

Results

Identification of putative Serratia sp. T241 BDH/GDH genes

A search of the literature resulted in identification of three meso-BDH genes, three (2S,3S)-BDH genes, three (2R,3R)-BDH genes and three GDH genes that were experimentally linked to their corresponding 2,3-BD dehydrogenase/AC reductase activities: meso-BDH genes from S. marcescens H3011, K. pneumoniae XJ-Li34 and K. oxytoca E71818; (2S,3S)-BDH genes from R. erythropolis29, B. saccharolyticum30 and K. pneumoniae ATCC20072135; (2R,3R)-BDH genes from P. polymyxa ATCC1232114, B. subtilis 16836 and Saccharomyces cerevisiae37; GDH genes from S. marcescens H3032, K. pneumoniae CGMCC1.636633 and B. licheniformis 10-1-A4. The 16s rDNA sequence of strain T241 shared a high identity of 99% with Serratia sp. AS12. So these gene resources were used to search the Serratia sp. AS12 protein database by BioEditor local BLASTp function. Four similar genes (GenBank number: AEF50077, AEF51363, AEF51265 and AEF52434) from Serratia sp. AS12 were found, and their deduced amino sequences shared high identities of 95%, 64%, 68% and 91% with meso-BDH from S. marcescens H30, (2S,3S)-BDH from R. erythropolis, (2R,3R)-BDH from B. subtilis 168 and GDH from S. marcescens H30. Therefore, these obtained similar genes designated as bdh1, bdh2, bdh3, and gdh might play important roles in 2,3-BD isomers formation in Serratia sp. T241.

Stereospecific characteristics of BDH1, BDH2, BDH3 and GDH enzymes

Four BDH/GDH genes were cloned, expressed and purified as described in “Materials and methods” (Fig. S1). The purified enzymes were used to determine the kinetic parameters using AC and 2,3-BD as substrates under their optimal pH conditions. The comparative data of apparent Km and Kcat values for BDH1-3 and GDH from Serratia sp. T241 were given in Table 1. BDH1 and BDH2 showed the activities for (3S/3R)-AC, meso-2,3-BD and (2S,3S)-2,3-BD as substrates. No activity for BDH1 and BDH2 could be measured when (2R,3R)-2,3-BD was used as a substrate. The Km and Kcat values of BDH1 were 6.64 mM and 35.25 s−1 for meso-2,3-BD, and 8.25 mM and 0.34 s−1 for (2S,3S)-2,3-BD, respectively. While the Km and Kcat values of BDH2 were 8.84 mM and 2.8 s−1 for meso-2,3-BD, and 0.39 mM and 17.10 s−1 for (2S,3S)-2,3-BD, respectively. Therefore, BDH1 and BDH2 could be categorized as meso-BDH and (2S,3S)-BDH. Correspondingly, BDH3 and GDH exhibited similar catalytic properties of (2R,3R)-BDHs and GDHs from other reported 2,3-BD producing strains in the presence of AC and 2,3-BD isomers as substrates. (3S/3R)-AC, meso-2,3-BD and (2R,3R)-2,3-BD could be reduced or oxidized by BDH3 and GDH with NADH/NAD+ as coenzymes. (2S,3S)-2,3-BD was not a substrate for BDH3 and GDH at all. In addition, GDH also exhibited high catalytic efficiency for glycerol as a substrate (data no shown). So BDH3 and GDH from Serratia sp. T241 should be categorized as (2R,3R)-BDH and GDH.
Table 1

Kinetic parameters of BDH1, BDH2, BDH3 and GDH from Serratia sp. T241 for (3S/3R)-AC, meso-2,3-BD, (2R,3R)-2,3-BD, and (2S,3S)-2,3-BDa.

Enzymes/substrates(3S/3R)-ACmeso-2,3-BD(2R,3R)-2,3-BD(2S,3S)-2,3-BD
BDH1Km (mM)3.95 ± 0.216.64 ± 0.14NDb8.25 ± 0.11
 Kcat (s−1)228.19 ± 8.0735.25 ± 1.91ND0.34 ± 0.01
BDH2Km (mM)0.30 ± 0.038.84 ± 0.17ND0.39 ± 0.03
 Kcat (s−1)80.22 ± 3.152.80 ± 0.04ND17.10 ± 0.45
BDH3Km (mM)0.18 ± 0.010.30 ± 0.020.21 ± 0.01ND
 Kcat (s−1)18.84 ± 0.782.44 ± 0.112.91 ± 0.10ND
GDHKm (mM)0.29 ± 0.025.70 ± 0.1579.85 ± 1.34ND
 Kcat (s−1)1.34 ± 0.050.33 ± 0.020.15 ± 0.01ND

aAssay conditions: the reduction reactions were prepared with 50 mM potassium phosphate buffer (pH 5.0 for BDH1, pH 8.0 for BDH2, BDH3 and GDH) and 0.2 mM NADH, the oxidation reactions were prepared with 50 mM potassium phosphate buffer (pH 8.0) and 0.2 mM NAD+. Various concentration of (3S/3R)-AC, meso-2,3-BD, (2R,3R)-2,3-BD, and (2S,3S)-2,3-BD range from 10 μM to 20 mM at 40 °C. The Km and Kcat values were obtained by non-linear fitting with the Michaelis-Menten equation.

bND: not detected.

± represents standard deviation from the mean (n = 3).

The stereospecific characteristics of the four enzymes were investigated by catalytic reactions using DA, (3S/3R)-AC and 2,3-BD as substrates. The products in these reaction systems were extracted by ethyl acetate and then used to check the enzyme stereospecificity using a GC chromatograph system. Meanwhile, the concentration of the products was determined by calibration curves. Fig. 1 and Fig. S2 demonstrated the four enzymes stereospecificity in the oxidation-reduction processes of the 2,3-BD/AC/DA interconversion. In 2,3-BD oxidation reactions, when (2S,3S)-2,3-BD and meso-2,3-BD were used as the substrates with BDH1 and BDH2, (3S)-AC and (3R)-AC could be produced respectively (Fig. 1c,d,g,h), whereas BDH3 and GDH showed the abilities in the conversion from (2R,3R)-2,3-BD and meso-2,3-BD to (3R)-AC and (3S)-AC (Fig. 1k,l,o,p). In reduction reactions, when DA was used as the substrate, (3S)-AC and (2S,3S)-2,3-BD were obtained from DA by BDH1 and BDH2 (Fig. 1a,e). Similar to BDH1 and BDH2, GDH could converted DA into (3S)-AC with NADH as coenzyme (Fig. 1m). However, the (3S)-AC product from DA by GDH could be further transformed into meso-2,3-BD (Fig. 1m). Among the four enzymes, only BDH3 could catalyze DA into (3R)-AC, which was further converted into (2R,3R)-2,3-BD (Fig. 1i). For a racemic mixture of (3S/3R)-AC reduction reaction, meso-2,3-BD and (2S,3S)-2,3-BD could be formed from (3S/3R)-AC by BDH1 and BDH2 (Fig. 1b,f). BDH3 and GDH from Serratia sp. T241 exhibited high (R)-enantioselectivity and catalyzed (3S/3R)-AC into meso-2,3-BD and (2R,3R)-2,3-BD (Fig. 1j,n).
Figure 1

Catalysis reactions of BDH1 (A–D), BDH2 (E-H), BDH3 (I–L) and GDH (M–P) enzymes from Serratia sp. T241 using DA, AC and 2,3-BD as substrates. DA (empty square), (3S)-AC (empty circle), (3R)-AC (filled circle), (2S,3S)-2,3-BD (upright triangle), (2R,3R)-2,3-BD (inverted triangle), meso-2,3-BD (filled square). Error bars represents standard deviation from the mean (n = 3).

Assembly of the BDH/GDH genes with AC operon in E. coli

The roles of BDH1, BDH2, BDH3 and GDH were investigated for the production of AC and 2,3-BD using E. coli BL21(DE3) as the host, which has no native AC and 2,3-BD production metabolism. As illustrated in Fig. 2, four genes encoding BDH1, BDH2, BDH3 and GDH from Serratia sp. T241 were cloned and assembled along with AC operon from S. marcescens H30 into pET28a vector, to generate the plasmids pET-budRAB-bdh1, pET-budRAB-bdh2, pET-budRAB-bdh3 and pET-budRAB-gdh. All of the plasmids harbored the AC operon (budRAB), which is used to produce acetoin from pyruvate. The genes bdh1, bdh2, bdh3 and gdh were expressed for evaluating the conversion of AC to 2,3-BD. The recombinant E. coli strains were subjected to batch fermentation using LB medium with 10 g/l glucose and E. coli carrying pET-budRAB was used as control. The results were given in Fig. 3. The control strain mainly produced 3.46 g/l of (3R)-AC and 0.11 g/l of (3S)-AC (Fig. 3a). In addition, a trace amount of (2R,3R)-2,3-BD and meso-2,3-BD could be detected in the broth by the control strain. As shown in Fig. 3b–e, all the strains carrying pET-budRAB-bdh1, pET-budRAB-bdh2, pET-budRAB-bdh3 and pET-budRAB-gdh produced (3R)-AC in high amounts. meso-2,3-BD was also produced by all the strains but in much lower amounts for the strains containing bdh3 and gdh genes. The strains containing bdh1 and bdh2 genes formed (2S,3S)-2,3BD which was absent from the strains containing bdh3 and gdh genes. Instead the strains containing bdh3 and gdh genes produced high amounts of (2R,3R)-2,3BD, which was totally absent in the other two strains.
Figure 2

Construction of expression plasmids containing synthetic 2,3-BD operon.

The budR, budA and budB from S. marcescens H30 encode the transcriptional activator, α-acetolactate decarboxylase and α-acetolactate synthase, respectively. The bdh1, bdh2, bdh3 and gdh genes from Serratia sp. T241 encode the putative 2,3-butanediol dehydrogenase or glycerol dehydrogenase.

Figure 3

Batch fermentations using recombinant E.coli expressing budRAB (A), budRAB-bdh1 (B), budRAB-bdh2 (C), budRAB-bdh3 (D) and budRAB-gdh (E). Error bars represents standard deviation from the mean (n = 3).

Metabolic characteristics of Serratia sp. T241 Δbdh1, Δbdh2, Δbdh3 and Δgdh

Serratia sp. T241 Δbdh1, Serratia sp. T241 Δbdh2, Serratia sp. T241 Δbdh3 and Serratia sp. T241 Δgdh were constructed as described in “Materials and methods”. In vitro conversion showed that BDH1, BDH2, BDH3 and GDH have the abilities in the interconversion between AC and 2,3-BD. However, the roles of the four genes for 2,3-BD isomers formation in Serratia sp. T241 still remained unclear. Whether all the four enzymes regulated AC and 2,3-BD isomers formation by Serratia sp. T241 or not was unknown. So the four mutants and the wild strain were cultured in fermentation medium to investigate their metabolic characteristics. The cultures were carried out in 250 ml flask with 50 ml fresh fermentation medium, and the products in the broth were analyzed and quantified by GC system. The results were shown in Fig. 4. The wild strain mainly produced meso-2,3-BD of 38.43 g/l with the dry cell weight (DCW) of 10.25 g/l at 30 h. Low levels of (3S)-AC, (3R)-AC, (2S,3S)-2,3-BD and (2R,3R)-2,3-BD were produced at concentrations of 1.73, 3.45, 2.14 and 3.67 g/l respectively (Fig. 4a–c). The cell growth of Serratia sp. T241 Δbdh1 was slower than that of the wild strain, and the DCW of 7.7 g/l was obtained at 30h. Deletion of bdh1 gene in Serratia sp. T241 resulted in significant decrease of meso-2,3-BD, (3S)-AC and (2S,3S)-2,3-BD, only 0.87 g/l meso-2,3-BD, 0.61 g/l (3S)-AC and 0.26 g/l (2S,3S)-2,3-BD was obtained by Serratia sp. T241 Δbdh1 at 30 h (Fig. 4d–f). In contrast, higher concentrations of (3R)-AC (25.50 g/l) and (2R,3R)-2,3-BD (5.02 g/l) was accumulated by Serratia sp. T241 Δbdh1 (Fig. 4e,f). Serratia sp. T241 Δbdh2, Serratia sp. T241 Δbdh3 and Serratia sp. T241 Δgdh still produced a large amount of meso-2,3-BD at concentration of 32.64, 33.72 and 35.17 g/l respectively (Fig. 4g,j,m). A similar growth curve of Serratia sp. T241 Δbdh2, Serratia sp. T241 Δbdh3, Serratia sp. T241 Δgdh and the wild strain was observed (Fig. 4a,d,g,j,m). For Serratia sp. T241 Δbdh2, the concentrations of (3S)-AC, (3R)-AC and (2R,3R)-2,3-BD were 2.64, 5.38 and 4.03 g/l (Fig. 4h,i), which were higher in comparison to those of the wild strain. While the concentration of (2S,3S)-2,3-BD with 1.43 g/l showed somewhat lower than that of the wild strain (Fig. 4i). During the batch fermentation process, bdh3 gene deletion led to accumulation of (3R)-AC (6.60 g/l) and decrease of (2R,3R)-2,3-BD (0.98 g/l) obviously (Fig. 4k,l). Similar to Serratia sp. T241 Δbdh3, 6.01 g/l of (3R)-AC could be produced by Serratia sp. T241 Δgdh (Fig. 4n). However, Serratia sp. T241 Δgdh still produced 4.40 g/l of (2R,3R)-2,3-BD (Fig. 4o). Correspondingly, the enzyme activities of the four mutants and the wild strain during the fermentation process also were measured, and the results were shown in Table 2. The wild strain exhibited higher activity of 15.61 U/mg for (3S/3R)-AC as a substrate. The activities in Serratia sp. T241 Δbdh2, Serratia sp. T241 Δbdh3 and Serratia sp. T241 Δgdh were 13.54, 12.11 and 13.43 U/mg, which still remained relatively high activities, whereas the enzyme activity of only 0.25 U/mg in Serratia sp. T241 Δbdh1 was observed.
Figure 4

Batch fermentations using Serratia sp.

T241 (A–C) and its mutants including Δbdh1 (D–F), Δbdh2 (G–I), Δbdh3 (J–L) and Δgdh (M–O). DCW (empty square), meso-2,3-BD (filled square), (3S)-AC (empty circle), (3R)-AC (filled circle), (2S,3S)-2,3-BD (empty triangle) and (2R,3R)-2,3-BD (filled triangle). Error bars represents standard deviation from the mean (n = 3).

Table 2

Enzyme activity assays of the four gene mutants and the wild straina.

StrainsEnzyme activity (U/mg)Loss of enzyme activity (%)
Serratia sp. T24115.61 ± 0.270
Serratia sp. T241 Δbdh10.25 ± 0.0198.4
Serratia sp. T241 Δbdh213.54 ± 0.4313.3
Serratia sp. T241 Δbdh312.11 ± 0.0722.4
Serratia sp. T241 Δgdh13.43 ± 0.1514.0

aAssay conditions: 50 mM potassium phosphate buffer (pH 7.0), 50 mM (3S/3R)-AC, 0.2 mM NADH at 40 °C.

± represents standard deviation from the mean (n = 3).

Discussion

2,3-BD and its dehydrogenation product, AC, could be produced by several natural strains such as K. pneumoniae9, K. oxytoca10, S. marcescens511 and B. polymyxa12. However, these natural strains produce a mixture of 2,3-BD and AC, which limits their applications. So elucidation of the mechanism for 2,3-BD isomers formation and development of engineered strains for single configuration production of 2,3-BD are required. Previous studies showed that (3R)-AC as main intermediate product was produced from pyruvate by ALS and ALDC enzymes, whereas low level of (3S)-AC was obtained from DA, which was formed by a nonenzymatic oxidative decarboxylation of α-acetolactate19. BDH is a reversible enzyme involved in the last step from AC to 2,3-BD14. Recent studies showed that multiple dehdyrogenases could carry out the conversion from AC to 2,3-BD such as (2S,3S)-BDH, (2R,3R)-BDH, meso-BDH and GDH, which resulted in different configuration formation of 2,3-BD41326. Therefore, the catalytic efficiency of dehydrogenases and the existence of multiple dehydrogenases in 2,3-BD producing strain were regarded as the key factors for 2,3-BD isomers formation. Serratia sp. T241, a newly isolated xylose-utlizing strain, could produce high concentration of 2,3-BD with three configurations. In this study, four genes (bdh1, bdh2, bdh3 and gdh) involved in AC and 2,3-BD isomers formation in Serratia sp. T241 were identified. This is the first report that four enzymes played roles in 2,3-BD isomers production in one strain. The sequencing results showed the bdh1, bdh2, bdh3 and gdh genes from Serratia sp. T241 shared high identities of 88%, 64%, 64% and 86% with meso-BDH from S. marcescens H30, (2S,3S)-BDH from R. erythropolis, (2R,3R)-BDH from B. subtilis 168 and GDH from S. marcescens H30, implying that the four enzymes might contribute to 2,3-BD isomers formation in Serratia sp. T241. The four genes encoding the BDH1, BDH2, BDH3 and GDH enzymes was cloned and expressed in E. coli BL21(DE3), purified and characterized. All the four purified enzymes exhibited the activities for AC and 2,3-BD as substrates. The main differences occurred in 2,3-BD oxidation reaction. (2S,3S)-2,3-BD and meso-2,3-BD were the substrates of BDH1 and BDH2, which showed no activity for (2R,3R)-2,3-BD. While BDH3 and GDH showed the activities for (2R,3R)-2,3-BD and meso-2,3-BD as substrates, (2S,3S)-2,3-BD was not the substrate for BDH3 and GDH at all. According to their Km and Kcat values, the four enzymes (BDH1, BDH2, BDH3 and GDH) should be categorized as meso-BDH, (2S,3S)-BDH, (2R,3R)-BDH and GDH. BDH3 was the first reported (2R,3R)-BDH from Gram-negative strain. Furthermore, in vitro conversion and in vivo assemble of 2,3-BD pathway in E. coli revealed that the four enzymes contributed to meso-2,3-BD production in Serratia sp. T241. (2S,3S)-2,3-BD was obtained from (3S)-AC by BDH1 and BDH2, whereas BDH3 and GDH led to (2R,3R)-2,3-BD formation from (3R)-AC. The detailed model of AC and 2,3-BD isomers formation by Serratia sp. T241 could be inferred from the data of stereospecificity in catalytic reaction by the four purified enzymes (Fig. 1 and Fig. S2). As shown in Fig. 5, (3R)-AC was produced from pyruvate via α-acetolacetate by ALS and ALDC, and DA was formed by a non-enzymatic oxidation decarboxylation of α-acetolactate. In Serratia sp. T241, (3S)-AC production from DA was afforded by BDH1, BDH2 and GDH. The features of BDH1 and BDH2 were similar to reported meso-BDH and (2S,3S)-BDH from K. pneumoniae and R. erythropolis respectively2729. However, the GDH enzymes in previous studies showed no activity using DA as a substrate except that GDH from S. marcescens H30 which could converted DA into (3S)-AC and exhibited the same catalytic property with the GDH from Serratia sp. T2412532. DA also was converted into (3R)-AC due to the existence of BDH3 in Serratia sp. T241. BDH1 and BDH2 exhibited high (S)-enantioselectivity for AC as substrate and catalyzed (3S)-AC and (3R)-AC into (2S,3S)-2,3-BD and meso-2,3-BD, respectively. In contrast, high (R)-enantioselectivity of BDH3 and GDH led to (2R,3R)-2,3-BD and meso-2,3-BD production from (3R)-AC and (3S)-AC. Similar to reported BDH/GDH from other strains, the four enzymes showed the abilities in the conversion from 2,3-BD to AC, and the corresponding configuration of AC could be obtained. It suggested that BDH1, BDH2, BDH3 and GDH were four reversible enzymes for the interconversion between AC and 2,3-BD. In addition, no DA could be detected from any form of 2,3-BD and AC, which showed that the conversions in catalytic reactions by the four enzymes were irreversible between DA and AC. In previous studies, the model of 2,3-BD stereoisomers formation in K. pneumoniae has been revealed25. In this model, two enzymes meso-BDH and GDH were identified, and contributed to three configurations of 2,3-BD production. The GDH enzyme in K. pneumoniae was responsible for (2R,3R)-2,3-BD and meso-2,3-BD formation from (3R)-AC and (3S)-AC, while (2S,3S)-2,3-BD and meso-2,3-BD were produced from (3S)-AC and (3R)-AC by meso-BDH. K. pneumoniae deficient in one of the two enzymes only produced two configuration of 2,3-BD2533. For Serratia sp. T241, four enzymes including meso-BDH, (2S,3S)-BDH, (2R,3R)-BDH and GDH were identified and contributed to three configuration of 2,3-BD formation, which showed that the model of 2,3-BD stereoisomers formation in Serratia sp. T241 was more complicated than that of K. pneumoniae. According the catalytic properties of four enzymes, inactivating one of the genes encoding the four enzymes in Serratia sp. T241 still forms three configuration of 2,3-BD. The significance of such a complicated mechanism for physiological metabolism of Serratia sp. T241 still remain unknown, which needs further study in future.
Figure 5

2,3-Butanediol biosynthesis pathway and mechanism of 2,3-butanediol stereoisomer formation in Serratia sp.

T241. ALS (acetolactate synthase), ALDC (acetolactate decarboxylase), BDH1 (meso-2,3-butanediol dehydrogenase), BDH2, ((2S,3S)-2,3-butanediol dehydrogenase), BDH3 ((2R,3R)-2,3-butanediol dehydrogenase), GDH (glycerol dehydrogenase).

Though in vitro conversion and in vivo assemble of 2,3-BD pathway in E. coli exhibited the catalytic properties and stereospecificity of four enzymes for DA, AC and 2,3-BD isomers as substrates, the expression level of four enzymes in Serratia sp. T241 during the fermentation process might be quite different. Therefore, four mutants deficient in BDH1, BDH2, BDH3 and GDH were constructed for investigating their roles in 2,3-BD isomers formation by Serratia sp. T241. As shown in Table 2, the enzyme activity loss of 98.4% could be observed in Serratia sp. T241 Δbdh1, resulting in an obvious decrease of 2,3-BD yield, especially meso-2,3-BD with the loss of 97.7% when compared with the wild strain. A higher concentration of (3R)-AC (25.50 g/l) could be accumulated due to the deficiency of BDH1. In addition, deletion of bdh1 gene also led to low level of (2S,3S)-2,3-BD with the loss of 87.9%. So BDH1 played a vital role in 2,3-BD production in Serratia sp. T241. In contrast, slightly decrease of the enzyme activities was detected in the mutants of Δbdh2, Δbdh3 and Δgdh, which still produced a large amount of meso-2,3-BD. However, the yields of meso-2,3-BD by the three mutants were slightly less than that of the wild strain, implying that BDH2, BDH3 and GDH might also contributed to meso-2,3-BD formation. During the fermentation process, low level of (2R,3R)-2,3-BD with the decrease of 73.3% was produced by Serratia sp. T241 Δbdh3. Therefore, BDH3 might played an important role in (2R,3R)-2,3-BD production in Serratia sp. T241. Low concentration of (2R,3R)-2,3-BD in Serratia sp. T241 Δbdh3 was produced partially due to the contribution of GDH. Similarly, BDH2 also contributed to (2S,3S)-2,3-BD production since a small amount of (2S,3S)-2,3-BD could be detected in Serratia sp. T241 Δbdh1. These results showed that the four enzymes contributed to AC and 2,3-BD stereoisomers formation in Serratia sp. T241 during the fermentation process. The ratio of AC and 2,3-BD stereoisomers in the broth by Serratia sp. T241 partially depended on the catalytic efficiencies and expression level of the four enzymes. Considering the discovery of the four enzymes from the blast search based on the reported gene sequences, other dehydrogenase in Serratia sp. catalyzing the conversion from AC to 2,3-BD remained unknown. So it is necessary that development of the mutant deficient in all the four genes in future confirm 2,3-BD accumulation or not. In a conclusion, four genes involved in 2,3-BD isomers formation by Serratia sp. T241 were identified. BDH1, BDH2, BDH3 and GDH encoded by the four genes were categorized as meso-2,3-BD dehydrogenase, (2S,3S)-2,3-BD dehydrogenase, (2R,3R)-2,3-BD dehydrogenase and glycerol dehydrogenase, and contributed to 2,3-BD isomers formation. During the fermentation process, BDH1 and BDH3 played main roles in 2,3-BD production, while BDH2 and GDH only had small effect on 2,3-BD production in Serratia sp. T241.

Methods

Enzyme and chemicals

Restriction enzymes and DNA Polymerase High Fidelity were obtained from TaKaRa Biotech (Dalian, China). T4 DNA ligase was obtained from New England Biolabs (Beijing, China). DNA and protein marker were purchased from Tiangen Biotech (Shanghai, China). Bacterial Genomic DNA Miniprep Kit was purchased from BIODEV Corp. (Beijing, China). The primers were synthesized in SBSbio (Shanghai, China) and listed in Table 3. (3S/3R)-AC, (2S,3S)-2,3-BD (97.0%), (2R,3R)-2,3-BD (97.0%), meso-2,3-BD (99.0%) were obtained from Sigma-Aldrich (Shanghai, China). All other chemicals were of analytical grade and commercially available.
Table 3

The primers used in this study.

PrimersSequence (5′-3′) 
Primers for genes expression
 BDH1F1CGGAATTCATGCGTTTCGACAATAAAGTGGTEcoRI
 BDH1R1GACAAGCTTTCAAACGATCTTCGGTTGACCHindIII
 BDH2F1TCCGAATTCATGTCGACAGGTTTGAACGGEcoRI
 BDH2R1GACAAGCTTTTAGCGATAAACCAGCCCGCHindIII
 BDH3F1TCCGAATTCATGGTTAATTTCAAGGGGEcoRI
 BDH3R1GACAAGCTTCCTGCGGGACATTTTACTHindIII
 GDHF1CGGAATTCATGTTGAGAATCATCCAGTCEcoRI
 GDHR1GACAAGCTTTCAGCGTTGGTGTTGTTGCAGHindIII
Primers for 2,3-BD pathway
 budRABFCGGAATTCTTACCCCCAACTGGGCGGCTEcoRI
 BudRABRCATATGTATATCCTCCTTATTAAATCATCTGGCTGAAGTRBS squence
 BDH1F2GATTTAATAAGGAGGATATACATATGCGTTTCGACAATAAAGTRBS squence
 BDH1R2GACAAGCTTTCAAACGATCTTCGGTTGACCHindIII
 BDH2F2GATTTAATAAGGAGGATATACATATGTCGACAGGTTTGAACGGRBS squence
 BDH2R2GACAAGCTTTTAGCGATAAACCAGCCCGCHindIII
 BDH3F2GATTTAATAAGGAGGATATACATATGGTTAATTTCAAGGGGRBS squence
 BDH3R2GACAAGCTTCCTGCGGGACATTTTACTHindIII
 GDHF2GATTTAATAAGGAGGATATACATATGTTGAGAATCATCCAGTCRBS squence
 GDHR2GACAAGCTTTCAGCGTTGGTGTTGTTGCAGHindIII
Primers for gene deletion
 BDH1UFGGGGTACCAGCCGAAGTGTAACCTGAAKpnI
 BDH1URTTTCACCAGGCTCGGGCACAGGGCAAGAGCCAGTCAA 
 BDH1DFTTGACTGGCTCTTGCCCTGTGCCCGAGCCTGGTGAAA 
 BDH1DRGTGAGTACTGGTGAAGGCTCGCTATGTGScaI
 BDH2UFGGGGTACCCGCCAGCCTCTACAACGATCKpnI
 BDH2URCGGTTGAGTAAGCACCTAAATCCCGTATTGTCCTACTGAT 
 BDH2DFATCAGTAGGACAATACGGGATTTAGGTGCTTACTCAACCG 
 BDH2DRGTGAGTACTTCCTGCAAAGGTGGTCAGTTScaI
 BDH3UFGGGGTACCCTCCTTTCCATACCGCAATCKpnI
 BDH3URTCATACCTGCGGGACATTTGCGAGGTATTCGTGCAGGTC 
 BDH3DFGACCTGCACGAATACCTCGCAAATGTCCCGCAGGTATGA 
 BDH3DRGTGAGTACTCCCGCCTTCTATGAGTGGScaI
 GDHUFGGGGTACCTCGCTCATGGAAGGGTTAGTKpnI
 GDHURATGTTGTGGATGGTTTCGCCTCGGTGGAAGCAATGGTGGG 
 GDHDFCCCACCATTGCTTCCACCGAGGCGAAACCATCCACAACAT 
 GDHDRGTGAGTACTCCCTTGATTGTTGATCCTATScaI

Bacterial strains, plasmids and bacterial growth condition

The strains and plasmids used in this study are listed in Table 4. Escherichia coli DH5α and BL21(DE3) as the cloning and expression hosts were grown at 37 °C. The pET28a vector was used for enzyme expression and the suicide vector pUTKm1 was used for gene knockout in Serratia sp. T241. Luria-Bertani (LB) medium was used for cultivation of E. coli and Serratia sp. T241. LB medium with 10 g/l glucose was used to cultivate E. coli containing the recombinant 2,3-BD pathway. Antibiotics were added in the following amounts (per ml) if necessary: 50 μg kanamycin or 50 μg ampicillin.
Table 4

Bacterial strains and plasmids used in this study.

Strain or plasmidRelevant genotype and descriptionReference or source
Strains
E. coli DH5αHost of plasmid for cloningLab stock
E. coli BL21(DE3)Host of plasmid for expression, F-, ompT, hsdSB(rB-mB-), gal(λ c I 857, ind1, Sam7, nin5, lacUV-T7 gene1), dcm(DE3)Lab stock
Serratia sp. T2412,3-BD producer, wild-typeLab isolation
Serratia sp. T241 Δbdh1bdh1 gene deletion mutant of Serratia sp. T241This study
Serratia sp. T241 Δbdh2bdh2 gene deletion mutant of Serratia sp. T241This study
Serratia sp. T241 Δbdh3bdh3 gene deletion mutant of Serratia sp. T241This study
Serratia sp. T241 Δgdhgdh gene deletion mutant of Serratia sp. T241This study
E. coli S17-1 λpirrecA pro hsdR RP4-2-Tc::Mu-Km::Tn7, conjugative strain able to host λ-pir-dependent plasmidsLab stock
Plasmids
 pET28aExpression vector, KmRNovagen
 pET-bdh1pET28a carries bdh1 geneThis study
 pET-bdh2pET28a carries bdh2 geneThis study
 pET-bdh3pET28a carries bdh3 geneThis study
 pET-gdhpET28a carries gdh geneThis study
 pET-budRABpET28a carries budRAB genesThis study
 pET-budRAB-bdh1pET28a carries budRAB and bdh1 genesThis study
 pET-budRAB-bdh2pET28a carries budRAB and bdh2 genesThis study
 pET-budRAB-bdh3pET28a carries budRAB and bdh3 genesThis study
 pET-budRAB-gdhpET28a carries budRAB and gdh genesThis study
 pUTKm1ApR KmR oriR6K oriTRP4Lab stock
 pUT-bdh1Plasmid used to delete bdh1 geneThis study
 pUT-bdh2Plasmid used to delete bdh2 geneThis study
 pUT-bdh3Plasmid used to delete bdh3 geneThis study
 pUT-gdhPlasmid used to delete gdh geneThis study
Serratia sp. T241 was maintained on agar slants in LB medium. The slants were incubated at 30 °C, and fully grown slants were stored at 4 °C. For seed preparation, a full loop of cells from a fully grown slant was inoculated into 30 ml of the seed medium in 250 ml flasks and incubated on a rotary shaker for 12 h at 30 °C and 180 rpm. The seed medium5 contained the following (per liter) at pH 7.2: glucose 10 g, yeast extract 1 g, peptone 2 g, (NH4)2SO4 6 g, KH2PO4 10 g, NaCl 0.5 g, MgSO4 0.5 g. Subsequently, seed culture (5%, v/v) was inoculated into the fermentation medium which consisted of (per liter): glucose 90 g, yeast extract 15 g, sodium acetate 4 g, NH4H2PO4 1 g, MgSO4 0.3 g, and MnSO4 0.1 g at pH 7.2. The fermentation experiments were conducted in 250 ml flasks containing 50 ml fresh fermentation medium for 30 h at 30 °C and 180 rpm. All flask experiments were performed in parallel triplicate tests. The data shown are the average of three fermentation runs with standard deviation. Blast searches of Serratia sp. AS12 local protein database developed by BioEditor software were carried out using known functional BDHs and GDHs. meso-BDH and GDH sequences are from S. marcescens H301132, while (2S,3S)-BDH and (2R,3R)-BDH sequences are from R. erythropolis29 and B. subtilis36 respectively. The putative genes with high scores were collected as candidate genes for further experiments.

Construction of E. coli BL21(DE3)/BDH and E. coli BL21(DE3)/GDH

The encoding sequences of the putative BDH and GDH genes were amplified by PCR with the genomic DNA of Serratia sp. T241 as template using the primers (Table 3), which contained the EcoRI and HindIII restriction sites respectively. The amplified products were ligated into the vector pET-28a at EcoRI and HindIII sites to generate the recombinant plasmids. The recombinant plasmids were transformed into E. coli BL21(DE3) for commercial sequencing and protein expression.

Enzyme preparation, assay, and enzymatic reactions

The recombinant strains were cultured at 37 °C in a 250-ml flask containing 50 ml LB medium with kanamycin (50 μg/ml), and expression was induced at a 2.5 h culture (about 0.6 OD600) with 0.5 mM isopropyl-beta-D-thiogalactopyranoside (IPTG). Cells were harvested by centrifugation after 6 h, and cell lysate was prepared by sonication in an ice bath. The homogenate was centrifuged at 13,000 × g for 10 min to remove the debris11. The soluble fraction was subjected to purification under non-denaturing conditions with Ni-affinity chromatography using a Histrap HP column according the purification protocol (GE Healthcare, USA). The eluate from the column was pooled and desalted by a Hitrap desalting column (GE Healthcare, USA). Enzyme activity was determined spectrophotometrically by measuring the changes in absorbance at 340 nm and 40 °C corresponding to the oxidation of NADH or the reduction of NAD+. The reaction mixtures containing 50 mM potassium phosphate buffer, 0.2 mM NAD+ for the oxidation reactions or 50 mM potassium phosphate buffer, 0.2 mM NADH for the reduction reactions were incubated at 40 °C for 5 min. After adding 10 μl of approximately diluted purified enzyme solution, the reaction was started by the addition of the substrates. One unit of BDH activity was defined as the amount of enzyme required to reduce 1 μmol of NAD(H) in one minute11. All enzyme activities were determined in triplicate. The protein concentrations of all samples were determined using the Bradford method, and bovine serum albumin served as the standard protein. The enzymatic reactions were carried out similar to the assay method, except that the substrate and coenzyme concentrations were high. For the oxidation processes, a mixture containing 50 mM meso-2,3-BD/(2S,3S)-2,3-BD/(2R,3R)-2,3-BD, 4 mM NAD+, 50 mM potassium phosphate buffer and 20 μg of purified enzyme in a final volume of 1 ml was incubated at 40 °C for 1 h. The reduction processes were carried out in 1 ml reaction system containing 50 mM DA or 100 mM (3S/3R)-AC, 4 mM NADH, 50 mM of potassium phosphate buffer and 20 μg of purified enzyme at 40 °C for 1 h. The products in these reaction systems were extracted by ethyl acetate and then used to check the enzyme stereospecificity using a GC chromatograph system32.

Assembly of the putative BDH/GDH genes with AC operon in E. coli

The putative BDH/GDH genes involved in 2,3-BD synthesis in Serratia sp. T241 and AC operon (budRAB) from S. marcescens H30 were amplified using the primers listed in Table 3, and assembled as illustrated in Fig. 2. First, the putative genes from Serratia sp. T241 and AC operon from S. marcescens H30 were amplified by PCR using the genomic DNA of strain T241 and H30 as templates. The PCR products of the putative genes with RBS sequences were assembly into the downstream region of AC operon respectively by overlap extension PCR using the corresponding primers (Table 3). These overlapping PCR fragments were cloned into pET28a vector between the EcoRI and HindIII sites to generate the recombinant 2,3-BD pathway in E. coli18.

Development of Serratia sp. mutant strains

Two DNA fragments (about 800 bp) from upstream sequence and downstream sequence of the putative gene with overlapping ends were amplified from Serratia sp. T241 using the primers listed in Table 3. The two fragments are then combined by overlapping PCR, generating an in-frame deletion construct of the putative gene. The overlapping PCR fragment was digested and cloned into the suicide vector pUTKm1 and transformed into E. coli S17-1 λpir for conjugation with Serratia sp. T241. LB medium agar plate containing 50 μg/ml kanamycin was used to screen the single crossover strains. The obtained single crossover strains were confirmed by PCR method. Then, one single crossover strain was grown in LB broth overnight, and plated onto LB medium agar plate. The double crossover strains were screened through kanamycin resistance phenotype38. The kanamycin-sensitive colonies were verified by PCR using the primers listed in Table 3. The other putative genes mutants of Serratia sp. T241 were constructed using the same method. The obtained mutants of Serratia sp. T241 were stored in a glycerol suspension at −80 °C for further experiments.

Analytical methods

The biomass concentration was determined by the optical density (OD) measured at 600 nm in a spectrophotometer (UV-1800, MAPADA) and correlated with dry cell weight (DCW)11. The products in the broth were extracted by ethyl acetate with the addition of isopropanol as internal standard and then quantified using a gas chromatograph system (Agilent GC9860) with equipped with a chiral column (Supelco β-DEX™ 120, 30-m length, 0.25-mm inner diameter). The operation conditions were as follows: N2 was used as the carrier gas at flow rate of 1.2 ml/min; the injector temperature and the detector temperature were 215 and 245 °C, respectively; and the column temperature was maintained at 50 °C for 1.5 min, then raised to 180 °C at a rate of 15 °C/min. The concentration of the products was determined by calibration curves1132.

Additional Information

How to cite this article: Zhang, L. et al. Mechanism of 2,3-butanediol stereoisomers formation in a newly isolated Serratia sp. T241. Sci. Rep. 6, 19257; doi: 10.1038/srep19257 (2016).
  34 in total

1.  Characterization and regulation of the 2,3-butanediol pathway in Serratia marcescens.

Authors:  Ben Rao; Liao Yuan Zhang; Jian'an Sun; Gang Su; Dongzhi Wei; Ju Chu; Jiawen Zhu; Yaling Shen
Journal:  Appl Microbiol Biotechnol       Date:  2011-10-09       Impact factor: 4.813

2.  Enhanced acetoin production by Serratia marcescens H32 with expression of a water-forming NADH oxidase.

Authors:  Jian-An Sun; Liao-Yuan Zhang; Ben Rao; Ya-Ling Shen; Dong-Zhi Wei
Journal:  Bioresour Technol       Date:  2012-05-30       Impact factor: 9.642

Review 3.  Biotechnological production of 2,3-butanediol--current state and prospects.

Authors:  E Celińska; W Grajek
Journal:  Biotechnol Adv       Date:  2009-05-13       Impact factor: 14.227

4.  Reduction of acetoin to 2,3-butanediol in Klebsiella pneumoniae: a new model.

Authors:  M Voloch; M R Ladisch; V W Rodwell; G T Tsao
Journal:  Biotechnol Bioeng       Date:  1983-01       Impact factor: 4.530

5.  Microbial production of 2,3-butanediol by a mutagenized strain of Serratia marcescens H30.

Authors:  Liaoyuan Zhang; Yunlong Yang; Jian'an Sun; Yaling Shen; Dongzhi Wei; Jiawen Zhu; Ju Chu
Journal:  Bioresour Technol       Date:  2009-11-20       Impact factor: 9.642

6.  Identification and characterization of a short-chain acyl dehydrogenase from Klebsiella pneumoniae and its application for high-level production of L-2,3-butanediol.

Authors:  Jang Min Park; Won-Kyung Hong; Sung-Mok Lee; Sun-Yeon Heo; You Ree Jung; In Yeong Kang; Baek-Rock Oh; Jeong-Woo Seo; Chul Ho Kim
Journal:  J Ind Microbiol Biotechnol       Date:  2014-07-19       Impact factor: 3.346

7.  Characterization of a stereospecific acetoin(diacetyl) reductase from Rhodococcus erythropolis WZ010 and its application for the synthesis of (2S,3S)-2,3-butanediol.

Authors:  Zhao Wang; Qingqing Song; Meilan Yu; Yifang Wang; Bin Xiong; Yinjun Zhang; Jianyong Zheng; Xiangxian Ying
Journal:  Appl Microbiol Biotechnol       Date:  2013-04-09       Impact factor: 4.813

8.  Mechanism of 2,3-butanediol stereoisomer formation in Klebsiella pneumoniae.

Authors:  Chuan Chen; Dong Wei; Jiping Shi; Min Wang; Jian Hao
Journal:  Appl Microbiol Biotechnol       Date:  2014-02-18       Impact factor: 4.813

9.  Metabolic engineering of Escherichia coli for production of (2S,3S)-butane-2,3-diol from glucose.

Authors:  Haipei Chu; Bo Xin; Peihai Liu; Yu Wang; Lixiang Li; Xiuxiu Liu; Xuan Zhang; Cuiqing Ma; Ping Xu; Chao Gao
Journal:  Biotechnol Biofuels       Date:  2015-09-15       Impact factor: 6.040

10.  Production of diacetyl by metabolically engineered Enterobacter cloacae.

Authors:  Lijie Zhang; Yingxin Zhang; Qiuyuan Liu; Liying Meng; Mandong Hu; Min Lv; Kun Li; Chao Gao; Ping Xu; Cuiqing Ma
Journal:  Sci Rep       Date:  2015-03-12       Impact factor: 4.379

View more
  9 in total

1.  Metabolic engineering of Zymomonas mobilis for 2,3-butanediol production from lignocellulosic biomass sugars.

Authors:  Shihui Yang; Ali Mohagheghi; Mary Ann Franden; Yat-Chen Chou; Xiaowen Chen; Nancy Dowe; Michael E Himmel; Min Zhang
Journal:  Biotechnol Biofuels       Date:  2016-09-02       Impact factor: 6.040

2.  Synthesis of (3R)-acetoin and 2,3-butanediol isomers by metabolically engineered Lactococcus lactis.

Authors:  Vijayalakshmi Kandasamy; Jianming Liu; Shruti Harnal Dantoft; Christian Solem; Peter Ruhdal Jensen
Journal:  Sci Rep       Date:  2016-11-18       Impact factor: 4.379

3.  The metabolic flux regulation of Klebsiella pneumoniae based on quorum sensing system.

Authors:  Shujing Sun; Haiyang Zhang; Shuyi Lu; Chunfen Lai; Huijun Liu; Hu Zhu
Journal:  Sci Rep       Date:  2016-12-07       Impact factor: 4.379

4.  Complete genome analysis of Serratia marcescens RSC-14: A plant growth-promoting bacterium that alleviates cadmium stress in host plants.

Authors:  Abdur Rahim Khan; Gun-Seok Park; Sajjad Asaf; Sung-Jun Hong; Byung Kwon Jung; Jae-Ho Shin
Journal:  PLoS One       Date:  2017-02-10       Impact factor: 3.240

5.  Efficient (3S)-Acetoin and (2S,3S)-2,3-Butanediol Production from meso-2,3-Butanediol Using Whole-Cell Biocatalysis.

Authors:  Yuanzhi He; Feixue Chen; Meijing Sun; Huifang Gao; Zewang Guo; Hui Lin; Jiebo Chen; Wensong Jin; Yunlong Yang; Liaoyuan Zhang; Jun Yuan
Journal:  Molecules       Date:  2018-03-19       Impact factor: 4.411

6.  Metabolic characterization of the chitinolytic bacterium Serratia marcescens using a genome-scale metabolic model.

Authors:  Qiang Yan; Seth Robert; J Paul Brooks; Stephen S Fong
Journal:  BMC Bioinformatics       Date:  2019-05-06       Impact factor: 3.169

7.  Microbial 2-butanol production with Lactobacillus diolivorans.

Authors:  Hannes Russmayer; Hans Marx; Michael Sauer
Journal:  Biotechnol Biofuels       Date:  2019-11-06       Impact factor: 6.040

8.  The current strategies and parameters for the enhanced microbial production of 2,3-butanediol.

Authors:  Olivier Hakizimana; Emmanuel Matabaro; Byong H Lee
Journal:  Biotechnol Rep (Amst)       Date:  2019-11-13

9.  Treatment of wild-type mice with 2,3-butanediol, a urinary biomarker of Fmo5 -/- mice, decreases plasma cholesterol and epididymal fat deposition.

Authors:  Sunil Veeravalli; Dorsa Varshavi; Flora H Scott; Dorna Varshavi; Frank S Pullen; Kirill Veselkov; Ian R Phillips; Jeremy R Everett; Elizabeth A Shephard
Journal:  Front Physiol       Date:  2022-08-08       Impact factor: 4.755

  9 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.