| Literature DB >> 26668150 |
Hong-Yang Wang, Ya-Li Zhao, Qiong Liu, Hu Yuan, Yun Gao, Lan Lan, Lan Yu, Da-Yong Wang, Jing Guan, Qiu-Ju Wang1.
Abstract
BACKGROUND: There are more than 300 genetic loci that have been found to be related to hereditary hearing impairment (HHI), including 92 causative genes for nonsyndromic hearing loss, among which 34 genes are related to autosomal dominant nonsyndromic HHI (ADNSHHI). Traditional linkage analysis and candidate gene sequencing are not effective at detecting the ADNSHHI, especially for the unconditional families that may have more than one pathogenic cause. This study identified two disease-causing genes TJP2 and GJB2 in a Chinese family with unconditional ADNSHHI.Entities:
Mesh:
Substances:
Year: 2015 PMID: 26668150 PMCID: PMC4797511 DOI: 10.4103/0366-6999.171440
Source DB: PubMed Journal: Chin Med J (Engl) ISSN: 0366-6999 Impact factor: 2.628
Figure 1Pedigrees and haplotype analysis of family 686. (a) Pedigrees of family 686. Filled symbols for males (squares) and female (circles) represent affected individuals, and empty represent unaffected individuals. (b) Single nucleotide polymorphism haplotype analysis in family 686. A total of four recombination events were observed in Family 686, including two recombination events in III7 between D9S259 and D9S169, D9S1874 and D9S1777 respectively, one recombination event in IV4 in which the exchange was between D9S169 and D9S1853, and one significant recombination in V5 in which the exchange occurred at D9S205. V5 carried the disease-causing allele from her affected mother at D9S205. D9S205 was excluded because V5 had normal hearing. (c) Construction of the genetics map. Figure shows the cytogenetic chromosome bands and regional distribution from the 9p13.2 to the 9p13.3 region. Black mark column on the right of the chromosomal region is the positioning region of 686 lines, locating between 9p13.2 and 9p13.3. Distance between markers is the genetic distance. The red box shows the distance positioning segment.
Primer sequences of AQP3
| Exon | Product length (bp) | TM (°C) | Primer sequences (5’–3’) | |
|---|---|---|---|---|
| Exon 1 | 513 | 70–65 | F | AGGCCACCCGTCCCTCAAAGCTCCT |
| R | GCGGTTAAGCGTGGGGGTCACAGCT | |||
| Exon 2 | 300 | 57 | F | GCATGTTGCTGGCTTCAC |
| R | CTGTGACCTGCCCTTAGGAA | |||
| Exon 3 | 300 | 57 | F | CTCTCTGCACCCCTTCTCAG |
| R | TGCCCAACTTGTTTCTTTCC | |||
| Exon 4 | 500 | 59 | F | CCTCTGCCTGCTGCAATAC |
| R | CTTGCCACCATGTTCTGATG | |||
| Exon 5 and 6 | 600 | 59 | F | AGCACCATTGCTTTCAGGAG |
| R | CCCTTGGACAGTCAGTGGAT | |||
Targeted captured genes list
| Gene name |
|---|
| ABR |
| ACAN |
| ACTG1 |
| AIFM1 |
| AKAP12 |
| ALDH1A2 |
| ALMS1 |
| AP3D1 |
| APAF1 |
| APOA1 |
| AQP4 |
| ATF2 |
| ATOH1 |
| ATP2B2 |
| ATP8B1 |
| AXIN1 |
| BARHL1 |
| BBS1 |
| BBS4 |
| BCR |
| BDNF |
| BMP4 |
| BSN |
| BSND |
| C17orf48 |
| C1orf125 |
| CACNA1D |
| CACNB2 |
| CACNG2 |
| CASP3 |
| CCDC50 |
| CD36 |
| CDH23 |
| CDKN1B |
| CDKN2D |
| CEACAM16 |
| CELSR1 |
| CHD7 |
| chrM |
| CHRNA9 |
| CKB |
| CLDN11 |
| CLDN14 |
| CLDN9 |
| CLIC5 |
| CLRN1 |
| COCH |
| COL11A1 |
| COL11A2 |
| COL2A1 |
| COL4A3 |
| COL4A4 |
| COL4A5 |
| COL9A1 |
| COL9A2 |
| CPLX1 |
| CRYM |
| DBH |
| DDR1 |
| DFNA5 |
| DFNB31 |
| DFNB59 |
| DIABLO |
| DIAPH 1 |
| DIAPH 3 |
| DIO2 |
| DIO3 |
| DLX2 |
| DLX5 |
| DMD |
| DNAH7 |
| DNAH9 |
| DPYS |
| DSPP |
| DVL1 |
| DVL2 |
| DVL3 |
| EDN3 |
| EDNRB |
| EGFLAM |
| EPHB1 |
| EPHB2 |
| EPHB3 |
| ERBB4 |
| ESPN |
| ESR2 |
| ESRRB |
| EYA1 |
| EYA4 |
| FABP4 |
| FAS |
| FBXO2 |
| FGF20 |
| FGF3 |
| FGFR1 |
| FGFR2 |
| FGFR3 |
| FIGN |
| FOXG1 |
| FOXI1 |
| FXN |
| FZD3 |
| FZD6 |
| GAS7 |
| GATA3 |
| GBX2 |
| GFI1 |
| GIPC3 |
| GJA1 |
| GJB1 |
| GJB2 |
| GJB3 |
| GJB6 |
| GLI3 |
| GOT1L1 |
| GPR98 |
| GPSM2 |
| GPX1 |
| GRHL2 |
| GRID1 |
| GRXCR1 |
| GUSB |
| HAL |
| HES1 |
| HES5 |
| HGF |
| HMX2 |
| HMX3 |
| HOXA1 |
| HOXA2 |
| HOXB1 |
| HS6ST2 |
| IFT88 |
| IGF1 |
| ILDR1 |
| ITGA8 |
| JAG1 |
| JAG2 |
| KCNE1 |
| KCNJ10 |
| KCNMA1 |
| KCNQ1 |
| KCNQ4 |
| KIT |
| KITLG |
| LAMA2 |
| LARGE |
| LFNG |
| LHFPL5 |
| LMO4 |
| LMX1A |
| LOXHD1 |
| LRIG3 |
| LRP2 |
| LRTOMT |
| MAFB |
| MAP1A |
| MARVELD2 |
| MCOLN3 |
| MGAT4B |
| MIR182 |
| MIR183 |
| MIR96 |
| MITF |
| MKKS |
| MON2 |
| MOS |
| MPV17 |
| MPZ |
| MSRB3 |
| MSX2 |
| MTAP |
| MUC4 |
| MUC6 |
| MUTED |
| MYH1 |
| MYH13 |
| MYH14 |
| MYH2 |
| MYH3 |
| MYH4 |
| MYH8 |
| MYH9 |
| MYO15A |
| MYO1A |
| MYO3A |
| MYO6 |
| MYO7A |
| NAV2 |
| NAV3 |
| NDP |
| NDRG1 |
| NEFL |
| NEU1 |
| NEURL |
| NEUROD1 |
| NEUROG1 |
| NF1 |
| NOTCH1 |
| NOX3 |
| NOXO1 |
| NR4A3 |
| NTF3 |
| NTN1 |
| NTRK2 |
| NTRK3 |
| OC90 |
| OPA1 |
| OR2T4 |
| OTOA |
| OTOF |
| OTOG |
| OTOP1 |
| OTX1 |
| OTX2 |
| PAX2 |
| PAX3 |
| PCDH15 |
| PDE8B |
| PDSS1 |
| PDZD7 |
| PHEX |
| PLDN |
| PMP22 |
| PNOC |
| POU1F1 |
| POU3F4 |
| POU4F3 |
| PROP1 |
| PRPS1 |
| PRRX1 |
| PRRX2 |
| PTK7 |
| PTPRQ |
| RARA |
| RARB |
| RARG |
| RASA1 |
| RDX |
| S1PR2 |
| SCARB2 |
| SCO1 |
| SCRIB |
| SEMA3E |
| SERAC1 |
| SERPINB6 |
| SFTPC |
| SIX1 |
| SIX5 |
| SLC12A2 |
| SLC12A6 |
| SLC12A7 |
| SLC17A8 |
| SLC19A2 |
| SLC1A3 |
| SLC26A4 |
| SLC26A5 |
| SLC30A4 |
| SLC4A11 |
| SLC4A7 |
| SLC9A1 |
| SLCO2B1 |
| SMAD4 |
| SMPX |
| SMS |
| SNAI2 |
| SOBP |
| SOD1 |
| SORBS1 |
| SOX10 |
| SOX2 |
| SOX9 |
| SPRY2 |
| ST3GAL5 |
| STRC |
| TAF10 |
| TBX1 |
| TBX10 |
| TCOF1 |
| TECTA |
| TGFA |
| TGFB2 |
| THRA |
| THRB |
| TIMM8A |
| TJP2 |
| TMC1 |
| TMEM126A |
| TMEM220 |
| TMIE |
| TMPRSS13 |
| TMPRSS3 |
| TNC |
| TNFRSF11B |
| TPRN |
| TRIOBP |
| TRPV4 |
| TSHR |
| TUB |
| TYRP1 |
| UCN |
| USH1C |
| USH1G |
| USH2A |
| USP15 |
| VANGL2 |
| WFS1 |
| YME1L1 |
ABR: Auditory brainstem responses.
Summary of clinical data for hearing impaired members in family 686
| Subject | Gender | Age of test (years) | Age of onset (years) | PTA (dB HL)* | Hearing impairment† | Audiogram | Tinnitus |
|---|---|---|---|---|---|---|---|
| III: 2 | Female | 72 | 68 | Left: 57.50 | Moderate | Downslope | Left: Durative |
| Right: 66.25 | Moderate | Downslope | Right: Durative | ||||
| III: 4 | Female | 68 | 48 | Left: 72.50 | Severe | Downslope | Left: Durative |
| Right: 93.75 | Severe | Downslope | Right: Durative | ||||
| III: 5 | Male | 62 | 55 | Left: 90.00 | Severe | Downslope | Left: Durative |
| Right: 90.00 | Severe | Downslope | Right: Durative | ||||
| III: 7 | Male | 46 | 42 | Left: 30.00 | Mild | Irregular | Left: Occasional |
| Right: 36.50 | Mild | Irregular | Right: Occasional | ||||
| IV: 4 | Male | 50 | 45 | Left: 45.00 | Moderate | Downslope | Left: Durative |
| Right: 42.50 | Moderate | Downslope | Right: Durative | ||||
| IV: 13 | Female | 34 | 31 | Left: 50.00 | Moderate | Downslope | Left: Occasional |
| Right: 52.50 | Moderate | Downslope | Right: Occasional | ||||
| IV: 22 | Male | 30 | 21 | Left: 45.00 | Moderate | Downslope | Left: Occasional |
| Right: 40.00 | Moderate | Downslope | Right: Occasional | ||||
| IV: 26 | Male | 35 | 32 | Left: 78.75 | Severe | Flat | Left: Durative |
| Right: 71.25 | Severe | Flat | Right: Durative |
*PTA: Pure-tone air-conduction averages (0.5, 1, 2 and 4 kHz) for the better-hearing ear of affected subjects in family 727; †Diagnosed at the time of test. The severity of hearing impairment was defined as mild (26–40 dB HL), moderate (41–55 dB HL), moderately severe (56–70 dB HL), severe (71–90 dB HL) and profound (>90 dB HL). HL: Hearing level.
Figure 2Audiograms of both ears from affected subjects in family 686. Symbols “o” and “x” denote air conduction pure-tone thresholds at different frequencies in the right and left ear, respectively. dB: decibels; Hz: Hertz.
Two-point LOD scores between 9q microsatellite markers for family 686
| Markers | LOD score AT | |||||||
|---|---|---|---|---|---|---|---|---|
| 0.0 | 0.1 | 0.2 | 0.3 | 0.4 | 0.5 | |||
| D9s259 | −1.74 | 1.23 | 0.96 | 0.59 | 0.25 | 0.00 | 1.25 | 0.0790 |
| D9s169 | 0.31 | 2.46 | 1.95 | 1.28 | 0.57 | 0.00 | 2.55 | 0.0570 |
| D9s161 | 1.21 | 0.88 | 0.58 | 0.33 | 0.13 | 0.00 | 1.21 | 0.0000 |
| D9s1853 | −5.82 | −0.59 | −0.06 | 0.09 | 0.09 | 0.00 | 0.10 | 0.3480 |
| D9s205 | 0.06 | 0.09 | 0.04 | −0.01 | −0.03 | 0.00 | 0.09 | 0.0670 |
| D9s165 | −2.10 | 0.60 | 0.58 | 0.40 | 0.19 | 0.00 | 0.63 | 0.1370 |
| D9s1817 | 3.25 | 2.58 | 1.89 | 1.19 | 0.53 | 0.00 | 3.25 | 0.0000 |
| D9s1874 | −5.82 | 0.43 | 0.84 | 0.76 | 0.43 | 0.00 | 0.85 | 0.2220 |
| D9s1777 | −2.17 | 0.69 | 0.55 | 0.35 | 0.16 | 0.00 | 0.69 | 0.0940 |
| D9s273 | 0.80 | 0.67 | 0.45 | 0.24 | 0.09 | 0.00 | 0.80 | 0.0000 |
| D9s1822 | −5.23 | 0.56 | 0.56 | 0.34 | 0.12 | 0.00 | 0.61 | 0.1440 |
LOD: Log odds score, the LOD scores were computed under an autosomal dominant mode of inheritance.