Literature DB >> 26649265

Genetic variation at microsatellite loci in the tropical herb Aphelandra aurantiaca (Acanthaceae).

Pilar Suárez-Montes1, Rosalinda Tapia-López1, Juan Núñez-Farfán1.   

Abstract

PREMISE OF THE STUDY: To assess the effect of forest fragmentation on genetic variation and population structure of Aphelandra aurantiaca (Acanthaceae), a tropical and ornamental herbaceous perennial plant, we developed the first microsatellite primers for the species. METHODS AND
RESULTS: Fourteen microsatellite markers were isolated and characterized from A. aurantiaca genomic libraries enriched for di-, tri-, and tetranucleotide repeat motifs. Polymorphism was evaluated in 107 individuals from four natural populations. Twelve out of 14 genetic markers were polymorphic. The number of alleles per locus ranged from two to 12, and the observed and expected heterozygosities ranged from 0.22 to 0.96 and from 0.20 to 0.87, respectively. Fixation indices ranged from -0.41 to 0.44.
CONCLUSIONS: These newly developed microsatellite markers for A. aurantiaca will be useful for future population genetic studies, specifically to detect the possible loss of genetic diversity due to habitat fragmentation.

Entities:  

Keywords:  Acanthaceae; Aphelandra aurantiaca; Los Tuxtlas tropical rainforest; gene flow; genetic structure; outcrossing rate

Year:  2015        PMID: 26649265      PMCID: PMC4651629          DOI: 10.3732/apps.1500058

Source DB:  PubMed          Journal:  Appl Plant Sci        ISSN: 2168-0450            Impact factor:   1.936


Aphelandra R. Br. is one of the largest genera of Acanthaceae, comprising ca. 175 species of perennial herbs, shrubs, and small trees restricted to the Neotropics (Wasshausen, 1975; Daniel, 1991). Species in this genus have colored flowering spikes (Wasshausen, 1975), and the genus is well known to horticulturists because some species are cultivated for ornamental purposes (Daniel, 1991). However, until now, no studies of molecular genetic diversity in this genus have been carried out. We focus on the understory herb A. aurantiaca (Scheidw.) Lindl., distributed from southern Mexico through Central and South America (Daniel, 1991). In Mexico, its distribution is restricted to regions with abundant rainfall such as Los Tuxtlas rainforest (Daniel, 1991), where it is one of the dominant understory species (Calvo-Irabién, 1997). The region of Los Tuxtlas, considered the northernmost limit of rainforests in the Americas, has been heavily impacted by deforestation and fragmentation (Dirzo and Miranda, 1991; Dirzo and García, 1992). Because fragmentation produces isolation between populations, it could impact their genetic structure (Chávez-Pesqueira et al., 2014), reducing genetic variation and gene flow, and increasing genetic divergence and inbreeding (Young et al., 1996). Aphelandra aurantiaca is a suitable model to study the genetic consequences of rainforest fragmentation due to the life history characteristics of the species. For example, it has a relatively short life span, which means that some generations have passed since the onset of fragmentation, and it depends on canopy cover, which is usually reduced in forest fragments. Furthermore, because A. aurantiaca’s attractive, nectar-producing flowers are pollinated by birds (Calvo-Irabién, 1997), its mating system can be affected by habitat fragmentation if this reduces species richness and abundance of pollinators (Aguilar et al., 2006). To date, little is known about its genetic structure, particularly in the context of rainforest fragmentation. Therefore, we aimed to develop variable genetic markers to elucidate the genetic diversity and structure of A. aurantiaca.

METHODS AND RESULTS

Using the DNeasy Plant Mini Kit (QIAGEN, Valencia, California, USA), we extracted genomic DNA from a single individual of A. aurantiaca for use in the isolation of microsatellite loci. A paired-end library was prepared by shearing 1 μg of genomic DNA following the standard protocol of the Illumina TruSeq DNA Library Kit (Illumina, San Diego, California, USA). Illumina sequencing was conducted on the HiSeq (Illumina) with 100-bp paired-end reads. Ten million of the resulting sequences were analyzed with the program PAL_FINDER_v0.02.03 (Castoe et al., 2012), extracting positive reads that contained di-, tri-, tetra-, penta-, and hexanucleotide microsatellites and sending to the program Primer3 (version 2.0.0; Rozen and Skaletsky, 1999) for primer design. To avoid duplicated loci, data were filtered and only primers that occurred one or two times were included; 24 loci out of 1722 that met this criterion were chosen. Primer pairs were tested for amplification and polymorphism using DNA obtained from five different individuals from the four Los Tuxtlas populations sampled (Appendix 1), and amplified PCR products were then separated on 4% Metaphor agarose gels (Lonza, Rockland, Maine, USA). After excluding loci that did not amplify, we selected 14 potential polymorphic loci and marked these with fluorescent labels (Table 1). The PCR amplification was carried out in a 20-μL reaction containing 2 μL of 10× PCR buffer (KCl 500 mM, Tris-HCL pH 8.3, gelatin 100 μg/mL, 1% triton, bovine serum albumin [BSA] 1.5 mg/mL), 1 μL of MgCl2 (30 mM), 2 μL of dNTPs (0.2 mM), 2 μL of DNA, 0.5 μL of each of the two primers (10 mM), 0.5 μL of Taq DNA polymerase (5 U/μL), and 12 μL of water (BIOTECMOL, Mexico City, Mexico), performed on a Thermo Scientific Hybaid Px2 thermal cycler (Thermo Scientific, Waltham, Massachusetts, USA) using the following conditions: 94°C for 10 min; followed by 35 cycles of 94°C for 1 min, at temperatures between 55–61°C for 1 min, and 72°C for 1 min; and a final extension step of 72°C for 7 min.
Table 1.

Characteristics of 14 microsatellite loci developed in Aphelandra aurantiaca.

LocusPrimer sequences (5′–3′)Allele size range (bp)Fluorescent labelRepeat motifGenBank accession no.
0432aF: AGGCTGAAGAGATTTGCAGG113–124NED(AGCC)24SRR1816885
R: AAGACAGGCTGATGCAGTCG
1233aF: GTTGCATTTGAGGCATGAGG116–126PET(AT)22SRR1514097
R: TGTAATTGAACTAGGTCTTGTACTCGC
4343aF: TGTAAAGGAAAGTTGAAGAAATAAGGG150–1726-FAM(ATT)27SRR1817142
R: TGATTCGTTGGAGACACATGC
4914aF: AGGAATTGTCCGGTCTTCCC130–152VIC(AT)22SRR1817143
R: CCGGCTGATTCTGCTTCC
5490aF: GGTGTACGTAGCCCACAACG174–184NED(ATGC)24SRR1816884
R: TGAAGAAGTTGTTCCAAGGTACG
1810bF: TGGCACTTATAGCCACATCCC194–207PET(AC)26SRR1817168
R: GAACCAGTGTTGCGTGTCC
4378b*F: GAGAATATAGAGGCCACCGGG216VIC(TTC)18SRR1817171
R: TCCGGTACATGCTCCAAAGG
1721c*F: TCCTCCTCTCTCATTACAAGTGG180PET(TC)20SRR1817170
R: TGTTCTTTAGTTTGCACACGC
4483cF: GATGGAGGCAGTGGAGATAGC206–229NED(TC)30SRR1817184
R: GCAGAATCTTCTGGAACCACC
5250cF: TTCCTTCTTGTTGTTATTCTTGGC208–2936-FAM(TC)28SRR1817169
R: GGAACAAAGAGTCATGATTGAAGC
1071dF: TTGTATTTGAATTGAACCCTTTCG272–304PET(AT)26SRR1817193
R: CGAATTGAAGTCCAATGTGGC
1808dF: TGCGTGTCTTTGTTGTACTATCTGG294–318NED(AGT)30SRR1817198
R: AATGCTCAAGGCATGCACC
4536dF: AAGAATTGTAATCCTTGAAAGCCC187–1936-FAM(TGC)21SRR1817191
R: GGAAATTTATATGGAATGCCGC
5441dF: CAAAGACCTGTAATAGATATAAGGAAGCC200–300VIC(TC)30SRR1817260
R: AACTTAATGGACCATGTCGGC

Note: Annealing temperature was the same for all primers (Ta = 57°C). For genotyping, we used: (a) one quintuplex reaction (loci 0432, 1233, 4343, 4914, and 5490), (b) one duplex reaction (loci 1810 and 4378), (c) one triplex reaction (loci 1721, 4483, and 5250), and (d) one quadruplex reaction (loci 1071, 1808, 4536, and 5441).

*Monomorphic locus.

Characteristics of 14 microsatellite loci developed in Aphelandra aurantiaca. Note: Annealing temperature was the same for all primers (Ta = 57°C). For genotyping, we used: (a) one quintuplex reaction (loci 0432, 1233, 4343, 4914, and 5490), (b) one duplex reaction (loci 1810 and 4378), (c) one triplex reaction (loci 1721, 4483, and 5250), and (d) one quadruplex reaction (loci 1071, 1808, 4536, and 5441). *Monomorphic locus. To encompass the most genetic diversity of A. aurantiaca in the Los Tuxtlas rainforest, we collected leaf tissue of 107 individuals from four populations (Appendix 1). Genomic DNA was extracted following the cetyltrimethylammonium bromide (CTAB) MiniPrep protocol (Doyle and Doyle, 1987). We selected a subset of loci to function well together in four multiplex reactions (QIAGEN Multiplex PCR Kit) with labeled primers (Applied Biosystems, Foster City, California, USA) (Table 1). Each multiplex PCR mixture (10 μL) contained 2 μL of DNA template (20 ng), 0.2 μL of each fluorescent-labeled forward primer (0.2 μM), 0.2 μL of each reverse primer (0.2 μM), 5 μL of QIAGEN Reaction Mix (1×), and 2.6 μL of RNase/DNase-free water (the volume of water varied depending on the number of primers in each multiplex reaction) (QIAGEN). Multiplexed reactions were carried out on a Hybaid Px2 thermal cycler (Thermo Scientific) and a Veriti 96-Well Thermal Cycler (Applied Biosystems). PCRs were performed through touchdown reactions, starting with initial heat activation at 95°C for 10 min, followed by 31 cycles with denaturation of 94°C for 60 s, annealing for 60 s, and 60 s of extension at 72°C. Annealing cycling temperature began at 57°C and decreased 1°C every cycle for six cycles (to 51°C), followed by two stages of 12 cycles each (with annealing temperatures of 55°C and 54°C). To check amplification, 5 μL of the PCR products were subjected to electrophoresis in a 1.5% agarose gel with 1× TBE buffer and stained with ethidium bromide. The remaining PCR products (5 μL) were diluted in 10 μL of water. One or two microliters of these PCR products (20–50 ng) were run on ABI Prism 310 and ABI 3730xl (Applied Biosystems) automated capillary sequencers; allele sizes were scored manually using GeneScan 500 LIZ Size Standard (Applied Biosystems) in GeneMarker version 2.4.0 (SoftGenetics LLC, State College, Pennsylvania, USA). Of the 14 primers tested, 12 were polymorphic and two were monomorphic with high-quality amplification (Table 2). For each polymorphic locus, we calculated the number of alleles (A), observed heterozygosity (Ho), and expected heterozygosity (He); tests of deviations from Hardy–Weinberg equilibrium (HWE) and linkage disequilibrium (LD) were performed using the software Arlequin version 3.5.1.3 (Excoffier and Lischer, 2010). Fixation indices (FIS) were estimated by GenAlEx version 6.5 (Peakall and Smouse, 2006). The probability of null alleles was estimated using MICRO-CHECKER software (van Oosterhout et al., 2004). We detected higher probabilities of null alleles between two loci (5250 and 1071) as suggested by the general excess of homozygotes (Table 2). There was LD at 10 of 90 paired loci comparisons, and significant departure from HWE was inferred at six loci, although this figure varied depending on the studied population (Table 2). A ranged from two to 12 across the studied populations. Ho and He ranged from 0.22 to 0.96 and from 0.20 to 0.87, respectively, and FIS ranged from −0.41 to 0.44.
Table 2.

Genetic properties of the newly developed polymorphic microsatellite loci of Aphelandra aurantiaca.

LocusF1 (n = 27)Selva 1 (n = 21)Selva 2 (n = 31)Bambú (n = 28)FISb
AHoHeAHoHeAHoHeAHoHe
043240.740.7240.330.5140.610.6430.460.590.14
123370.660.6350.660.6850.610.6590.600.730.04
434350.620.7370.610.6470.740.7270.460.750.12
491440.590.5140.520.5540.480.6070.570.650.05
540930.960.54*40.420.4730.510.5430.460.59−0.12
181070.920.62*40.850.6050.960.6740.850.68−0.41
4483100.700.86*70.760.7490.580.7370.420.590.14
525070.510.76*60.380.4870.630.7470.390.760.28
107170.480.7380.450.84100.460.85*60.310.730.44
180860.400.5970.570.6690.450.6170.460.500.18
453640.220.2750.350.54*20.220.2030.440.410.11
544170.810.80110.730.87110.870.82120.670.830.05

Note: A = number of alleles; FIS = fixation index; He = expected heterozygosity; Ho = observed heterozygosity.

All values are based on 107 samples representing Los Tuxtlas rainforest located in southern Mexico. See Appendix 1 for locality and voucher information.

Fixation index of each locus across populations.

*Loci that were not in Hardy–Weinberg equilibrium (P < 0.001).

‡Null alleles.

Genetic properties of the newly developed polymorphic microsatellite loci of Aphelandra aurantiaca. Note: A = number of alleles; FIS = fixation index; He = expected heterozygosity; Ho = observed heterozygosity. All values are based on 107 samples representing Los Tuxtlas rainforest located in southern Mexico. See Appendix 1 for locality and voucher information. Fixation index of each locus across populations. *Loci that were not in Hardy–Weinberg equilibrium (P < 0.001). ‡Null alleles.

CONCLUSIONS

We developed and characterized 12 polymorphic and two monomorphic novel microsatellite markers for the herb A. aurantiaca. The primers will be useful for assessing population genetic structure and mating system of A. aurantiaca in both preserved and fragmented rainforest. Likewise, we expect these microsatellite loci could be useful for other Aphelandra species.
Appendix 1.

Geographic location and voucher information of populations of Aphelandra aurantiaca from Los Tuxtlas tropical rainforest. A voucher was collected only at the largest forest fragment (ca. 700 ha).

SpeciesNo. of individualsVoucher specimenaCollection localityGeographic coordinates
A. aurantiaca27Site F118°34.648′N, 95°4.105′W
A. aurantiaca21TUXsno3239Site Selva 118°35.153′N, 95°4.609′W
A. aurantiaca31Site Selva 218°35.269′N, 95°6.023′W
A. aurantiaca28Site Bambú18°36.607′N, 95°8.363′W

Voucher specimen is deposited at the herbarium of the Instituto de Biología, Universidad Nacional Autónoma de México (MEXU); subcollection of Los Tuxtlas herbarium.

  7 in total

1.  Primer3 on the WWW for general users and for biologist programmers.

Authors:  S Rozen; H Skaletsky
Journal:  Methods Mol Biol       Date:  2000

Review 2.  Plant reproductive susceptibility to habitat fragmentation: review and synthesis through a meta-analysis.

Authors:  Ramiro Aguilar; Lorena Ashworth; Leonardo Galetto; Marcelo Adrián Aizen
Journal:  Ecol Lett       Date:  2006-08       Impact factor: 9.492

3.  The population genetic consequences of habitat fragmentation for plants.

Authors:  A Young; T Boyle; T Brown
Journal:  Trends Ecol Evol       Date:  1996-10       Impact factor: 17.712

4.  Arlequin suite ver 3.5: a new series of programs to perform population genetics analyses under Linux and Windows.

Authors:  Laurent Excoffier; Heidi E L Lischer
Journal:  Mol Ecol Resour       Date:  2010-03-01       Impact factor: 7.090

5.  Habitat fragmentation threatens wild populations of Carica papaya (Caricaceae) in a lowland rainforest.

Authors:  Mariana Chávez-Pesqueira; Pilar Suárez-Montes; Guillermo Castillo; Juan Núñez-Farfán
Journal:  Am J Bot       Date:  2014-07-11       Impact factor: 3.844

6.  GenAlEx 6.5: genetic analysis in Excel. Population genetic software for teaching and research--an update.

Authors:  Rod Peakall; Peter E Smouse
Journal:  Bioinformatics       Date:  2012-07-20       Impact factor: 6.937

7.  Rapid microsatellite identification from Illumina paired-end genomic sequencing in two birds and a snake.

Authors:  Todd A Castoe; Alexander W Poole; A P Jason de Koning; Kenneth L Jones; Diana F Tomback; Sara J Oyler-McCance; Jennifer A Fike; Stacey L Lance; Jeffrey W Streicher; Eric N Smith; David D Pollock
Journal:  PLoS One       Date:  2012-02-14       Impact factor: 3.240

  7 in total
  1 in total

1.  Life history and past demography maintain genetic structure, outcrossing rate, contemporary pollen gene flow of an understory herb in a highly fragmented rainforest.

Authors:  Pilar Suárez-Montes; Mariana Chávez-Pesqueira; Juan Núñez-Farfán
Journal:  PeerJ       Date:  2016-12-22       Impact factor: 3.061

  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.