Literature DB >> 26646058

Can selection for resistance to OsHV-1 infection modify susceptibility to Vibrio aestuarianus infection in Crassostrea gigas? First insights from experimental challenges using primary and successive exposures.

Patrick Azéma1, Marie-Agnès Travers2, Julien De Lorgeril3, Delphine Tourbiez4, Lionel Dégremont5.   

Abstract

Since 2008, the emergent virus OsHV-1µvar has provoked massive mortality events in Crassostrea gigas spat and juveniles in France. Since 2012, mortality driven by the pathogenic bacteria Vibrio aestuarianus has stricken market-sized adults. A hypothesis to explain the sudden increase in mortality observed in France since 2012 is that selective pressure due to recurrent viral infections could have led to a higher susceptibility of adults to Vibrio infection. In our study, two OsHV-1-resistant lines (AS and BS) and their respective controls (AC and BC) were experimentally challenged in the laboratory to determine their level of susceptibility to V. aestuarianus infection. At the juvenile stage, the selected lines exhibited lower mortality (14 and 33%) than the control lines (71 and 80%), suggesting dual-resistance to OsHV-1 and V. aestuarianus in C. gigas. Interestingly, this pattern was not observed at the adult stage, where higher mortality was detected for AS (68%) and BC (62%) than AC (39%) and BS (49%). These results were confirmed by the analysis of the expression of 31 immune-related genes in unchallenged oysters. Differential gene expression discriminated oysters according to their susceptibility to infection at both the juvenile and adult stages, suggesting that resistance to V. aestuarianus infection resulted in complex interactions between the genotype, stage of development and immunity status. Finally, survivors of the V. aestuarianus challenge at the juvenile stage still exhibited significant mortality at the adult stage during a second and third V. aestuarianus challenge, indicating that these survivors were not genetically resistant.

Entities:  

Mesh:

Year:  2015        PMID: 26646058      PMCID: PMC4673786          DOI: 10.1186/s13567-015-0282-0

Source DB:  PubMed          Journal:  Vet Res        ISSN: 0928-4249            Impact factor:   3.683


Introduction

The French oyster industry has regularly suffered from massive mortality episodes (Figure 1). In the early 1970s, the production of the Portuguese oyster Crassostrea angulata collapsed due to massive mortality related to an iridovirus [1], and the production of the flat oyster Ostrea edulis was significantly reduced due to two parasites (Martelia refringens and Bonamia ostreae) [2]. Once a disease affecting an oyster species has been introduced or detected in an area, resources to minimize its effect on oyster populations or production are very constrained. Neither large-scale drug use nor vaccination (because invertebrates have no acquired immunity) is possible in open marine areas due to the scale of the environment, and seawater or other organisms can easily convey pathogens from the reservoir to naïve stocks, thereby favoring the transmission of a disease. In this context, two main solutions have been proposed to sustain French oyster production: (1) develop a selective breeding program to enhance disease resistance using the genetic resources available in oyster populations, and more radically (2) introduce another species that is not sensitive to the disease. This second step was taken in France during the 1970s with the massive introduction of Crassostrea gigas from Japan and British Columbia to replace C. angulata during the RESOR operation (Figure 1) [3]. However, the introduction of new species is not recommended because it can lead to the introduction of new diseases in local populations [4], competition for habitats and resources, new invasive species and other constraints (regulatory rules, preliminary studies and biological barriers).
Figure 1

French oyster production of , , and since 1950. The main diseases that affected the production are indicated with red stars.

French oyster production of , , and since 1950. The main diseases that affected the production are indicated with red stars. French oyster production of C. gigas has ranged from 100 000 to 150 000 tons for several decades, but has unfortunately begun to decrease due to two diseases (Figure 1). Indeed, massive mortality events have occurred every year since 2008, with high mortality rates for spat and juveniles (over 70%). A particular OsHV-1 genotype (µvar) that was first described during a period of C. gigas mortality in 2004–2005 in Normandy [5] has been ascribed to the mortality [6]. Moreover, significant mortality has been observed in market-sized adults since 2012 [7-9], and C. gigas production is expected to decrease again (Figure 1). The main pathogenic agent found in the dying oysters harvested during these mortality episodes belonged to the species Vibrio aestuarianus. Because it would not be reasonable to introduce another oyster species to replace C. gigas, the possibility of genetic selection for disease resistance might limit the impact of diseases on wild and cultivated oysters. High mortality rates related to OsHV-1µvar have been observed in the field since 2008 [10], and it is probable that viral pressure on wild and cultivated oyster populations has been significant. Therefore, the emergence of high mortality in adults has made it legitimate to investigate whether the selection provoked by viral infection has an impact on the susceptibility of adults to bacterial infections and whether there are correlations or trade-offs between resistance to OsHV-1 and the expected resistance to V. aestuarianus. Consequently, it would be interesting to study whether the mass selection breeding program for C. gigas currently being managed at Ifremer [11] could enhance disease resistance to both OsHV-1 and V. aestuarianus. Evidence of OsHV-1 resistance was demonstrated in spat C. gigas in 2009 using oysters selected based on their higher resistance to the summer mortality phenomenon in 2001 [12-14]. More recently, OsHV-1 resistance was found to be a highly heritable trait in C. gigas spat under field and laboratory conditions [11, 15]. However, experimental selective breeding programs focused on V. aestuarianus resistance have not been described to date, and a relationship between resistance to OsHV-1 infection and V. aestuarianus infection has not been reported. One hypothesis to explain disease resistance could be linked to host defenses, such as the immune capacity. Previous works identified markers for oyster survival capacity [16-19]. These studies led to the identification of a set of genes whose expression was either up-regulated in oysters able to survive virulent Vibrio infection [16, 20] or differentially regulated in the hemocytes of oysters with a high capacity for survival [18]. The objective of this study was to investigate: (1) the resistance to V. aestuarianus infection in C. gigas at the juvenile and adult stages under laboratory-controlled conditions using two stocks of oysters and (2) to analyze the association of the survival capacity with the basal expression levels of a selection of immune-related genes. For each stock, a control line and a line selected for higher survival at the spat stage under field conditions (which was also related to higher resistance to OsHV-1 infection) were evaluated. First, experimental OsHV-1 infection was performed to confirm the level of resistance of each line to the viral infection. Then, two approaches were used to test for resistance to V. aestuarianus infection. The first approach challenged the oysters in primary exposures at the juvenile stage or the adult stage to determine the level of resistance according to the size and/or age of the oysters. The second approach used successive infections at the adult stage with the survivors of the previous experimental infections to determine whether the survivors became resistant to the bacterial infection. Finally, we evaluated the immune status of non-stimulated oysters before the onset of bacterial infection under laboratory conditions.

Materials and methods

Oysters

A mass selection to increase survival in C. gigas was performed in two stocks (named A and B) of wild oysters sampled from two sites in the Marennes-Oléron Bay (Charente Maritime, France) in 2008. For each line, a base population G0 was produced in 2009, and a sub-sample was kept in our facilities to avoid disease-related mortality and to produce the control line of the following generation (G1-C). This control allowed the assessment of the effects of changing environmental conditions during the course of the experiment to estimate the response to selection [11]. The other sub-sample of oysters was deployed in the field, where mortality outbreaks caused by OsHV-1 were routinely observed each year since 2009 [21]. Then, the survivors were spawned in 2010 to produce the selected line G1-S. The same approach was used in February 2011 and March 2012 to produce G2 and G3, respectively. Four sub-lines were produced for the selected line from G2; further details are given in [11]. The oysters used in this study were the control lines AC and BC of G3 and the selected lines AS and BS, which were the best sub-lines for survival and OsHV-1 resistance in the field. The field evaluation of the C and S lines at the spat stage during the summer of 2012 confirmed a higher mortality for the C lines (92.9%) compared with the S lines (32.0%). Nevertheless, the oysters used in our experimental infections were either kept in our inland facilities to avoid disease-related mortality or deployed to the field in October 2012 prior to their evaluation in the laboratory (Figure 2).
Figure 2

Summary of the production and exposure to by cohabitation challenges. Trials 3 and 4 were performed for the control and selected lines at either the juvenile or adult stages. Light grey boxes indicate primary-challenge and dark grey boxes indicate a second and third exposure to the bacteria.

Summary of the production and exposure to by cohabitation challenges. Trials 3 and 4 were performed for the control and selected lines at either the juvenile or adult stages. Light grey boxes indicate primary-challenge and dark grey boxes indicate a second and third exposure to the bacteria.

Viral and bacterial suspensions

The viral suspension was obtained using the protocol of Schikorski [22]. Briefly, naïve and unselected hatchery-produced oysters were infected by injecting 50 µL of a previous viral suspension after “anesthesia”. Dead oysters were dissected; the mantle and gills were removed, pooled, diluted, crushed and filtered using a 0.22-µm filter to obtain a clarified tissue homogenate. The Vibrio strain used in the bacterial challenges was the highly pathogenic strain 02/041 that was isolated during a mortality episode in adults. This strain was previously studied and was included in this study as a reference strain [23]. The Vibrio suspension was obtained from an isolate maintained at −80 °C. The bacterial strain was placed in liquid Zobell and incubated for 24 h at 20 °C with constant shaking at 20 rpm. The resulting solution was centrifuged at 3200 × g for 10 min. The supernatant was discarded, and the pellet was washed and suspended in sterile artificial sea water (SASW).

Mortality induction protocols

Two types of experimental infection protocols were used to evaluate disease resistance in C. gigas: a by-injection protocol and a by-cohabitation protocol. For all trials, the seawater was filtered, UV treated and maintained at 21 °C with adequate aeration and without the addition of food. For the large volume tanks (150 L), a recirculating system was used to optimize the horizontal transmission of the disease. The salinity ranged between 29.5 and 36.7% for all trials. For the by-injection protocol, pathogenic agents were directly injected into the adductor muscles of oysters to test their disease resistance. First, oysters were “anesthetized” in a solution containing magnesium chloride (MgCl2, 50 g/L) in a mixture of seawater and distilled water (1:4, v:v) for 4 h. Subsequently, 50 µL of the infectious solution (bacterial or viral suspension) was injected into the adductor muscle using a 1 mL micro-syringe equipped with an 18 g needle. The injected oysters were either naïve oysters of the selected or control lines or naïve unselected hatchery-produced oysters that were used as “sources” for the horizontal transmission of the disease to the selected and control lines through a by-cohabitation protocol. For the by-cohabitation components, we used the protocols previously described in [24, 25]. As described for the by-injection protocol, naïve and unselected hatchery-produced oysters were injected with a specific pathogen and then transferred into tanks for 24 h. Then, they were placed in contact with the naïve oysters of the selected and control lines to test their disease resistance. A ratio of 10 g of injected oysters (with the shell) per 10 L of sea water was used for all of the experiments. A dead oyster was defined as a moribund animal that was unable to close its valve after 5 min out of the water.

Trial 1: experimental infection by cohabitation between oysters injected with OsHV-1 and the selected and control lines

An experimental infection with OsHV-1 was performed in April 2013 to verify the higher resistance to OsHV-1 infection of the selected lines AS and BS compared with the control lines AC and BC. The oysters were 13 months old, and the mean individual weight was 22 g (Table 1). The AS, BS, AC and BC lines were evaluated throughout the cohabitation with oysters injected with a viral suspension as described above. For each line (AS, BS, AC and BC), four 5 L replicate tanks were used; each tank contained 10 oysters (Table 1). For three replicates, 4 oysters injected with the viral suspension were added to each tank for 48 h. In the fourth tank, 4 oysters injected with SASW were added for 48 h. The mortality was recorded daily for 11 days.
Table 1

Summary of the trials and sets to evaluate OsHV-1 and V. aestuarianus susceptibility.

Trial123333344
Set12345a 1b 2c
PathogenOsHV-1 Vibrio aestuarianus Vibrio aestuarianus Vibrio aestuarianus Vibrio aestuarianus Vibrio aestuarianus Vibrio aestuarianus Vibrio aestuarianus Vibrio aestuarianus
Infection protocolCohabitationInjectionCohabitationCohabitationCohabitationCohabitationCohabitationCohabitationCohabitation
Number of exposure1st infection1st infection1st infection1st infection1st infection1st infection1st infection2nd infection3rd infection
Date of challengeApr 2013Jan 2013Feb 2013Mar 2013Mar 2013May 2014Nov 2014May 2014Nov 2014
Age (months)131011121326322632
Individual weight (g)2222222222120100100170
StageJuvenileJuvenileJuvenileJuvenileJuvenileAdultAdultAdultAdult
Number of tanksf 12483382211
Tank volume (L)5515015010150150150150
Lines tank−1 114414443d
Oysters line-1 tank−1 1010252515–2024–3228–331–88e 1–30e
OsHV-1 detection in moribundsYesNoNoNoNoNoNoNoNo
V. aestuarianus detection in moribundsNoYesYesYesYesYesYesYesYes

For all trials, two unselected and control lines (AC and BC) and two lines selected for their higher resistance to OsHV-1 (AS and BS) were evaluated under controlled conditions

aOysters used were survivors from field testing

bOysters used were survivors from sets 1 to 3 of trial 3

cOysters used were survivors from set 1 of trial 4

dOne of the control line had 100% mortality before the trial

eSelected lines had at least 28 and 12 oysters in sets 4 and 5, respectively, whereas the control lines had less than 5 oysters

fThe number indicated is without the control tanks

Summary of the trials and sets to evaluate OsHV-1 and V. aestuarianus susceptibility. For all trials, two unselected and control lines (AC and BC) and two lines selected for their higher resistance to OsHV-1 (AS and BS) were evaluated under controlled conditions aOysters used were survivors from field testing bOysters used were survivors from sets 1 to 3 of trial 3 cOysters used were survivors from set 1 of trial 4 dOne of the control line had 100% mortality before the trial eSelected lines had at least 28 and 12 oysters in sets 4 and 5, respectively, whereas the control lines had less than 5 oysters fThe number indicated is without the control tanks

Trial 2: experimental infection by injection of the selected and control lines with V. aestuarianus

The design of this trial consisted of intramuscular injection of the oysters with suspensions with different bacterial concentrations. The bacterial concentration was evaluated spectrometrically at 600 nm and adjusted to an optical density (OD) = 1; then, the suspension was serially diluted to obtain theoretical ODs of 0.0002, 0.002, 0.02 and 0.2, corresponding to 104, 105, 106 and 107 bacteria per mL, respectively. The bacterial concentration and purity were verified by plating. Three 5 L tanks were used for each OD and each line; each tank contained ten oysters injected with 50 µL of V. aestuarianus (500 CFU at OD 104 and 0.5 million CFU at OD 107). For each line, an additional tank was used as a control; this tank contained 10 oysters injected with SASW. Observations for mortality were performed daily for 6 days.

Trial 3: primary infection by cohabitation between oysters injected with V. aestuarianus and the selected and control lines

Five sets of trials using a by-cohabitation protocol were used to better mimic natural infection. For each trial (with the exception of set 3), three 150 L tanks were used to challenge a larger number of larger animals at the same time. An additional tank was used for the controls, which consisted of oysters intramuscularly injected with SASW and placed as sources in contact with the four lines (Table 1). In each tank, the oysters of the four lines were randomly placed together in the same tank with 25 oysters per line with the shells individually tagged for identification. For set 3 of trial 3, two 10 L tanks were used per line; each tank contained approximately 15–20 oysters (Table 1). The five sets of trial used to evaluate the resistance of the four lines AS, AC, BS and BC to V. aestuarianus are summarized in Table 1 and Figure 2: Three sets were performed in February and March 2013. The naïve oysters were 11–13 months old and weighed 22 g (Table 1), which corresponded to the juvenile stage according to the oyster industry. All oysters were always kept in our facilities, and no mortality was recorded. The fourth set was conducted during spring 2014. The oysters were 26 months old, and the mean individual weight was 120 g (Table 1), which corresponded to the adult stage. The oysters were always kept in our facilities, and no mortality was recorded. The fifth set was conducted during the fall of 2014 with oysters kept for 2 years in the field at Agnas (Charente Maritime, France). The control and selected oyster lines experienced 70 and 34% mortality, respectively. The oysters were 32 months old, and the mean individual weight was 100 g.

Trial 4: successive infections by cohabitation of oysters injected with V. aestuarianus and the selected and control lines

All oysters that survived sets 1–3 in trial 3 were again challenged in trial 4 with two additional successive challenges in May 2014 and November 2014 (Figure 2). Between trial 3 and the first set in trial 4 and between the two sets of trial 4, the oysters were kept at the Ifremer facilities in La Tremblade. All effluent from the holding facilities was treated with chlorine. The occurrence of mortality was also recorded during these periods. In set 1 of trial 4, the oysters were 26 months old with an average weight of 100 g, whereas in set 2 of trial 4 the oysters were 32 months old with an average weight of 170 g (Table 1).

Detection of OsHV-1 and V. aestuarianus DNA

For all of the trials, moribund oysters from the selected and control lines were sampled for the detection of OsHV-1 and V. aestuarianus DNA. Total DNA was extracted from tissue fragments (mantle + gills) using the QIAgen (Hilden, Germany) QIAamp tissue mini kit combined with the QIAcube automated system according to the manufacturer’s protocol. The total DNA amount was adjusted to 5 ng/µL following Nanodrop (Thermo Scientific) measurement. A real-time PCR assay was conducted on the MX3000 and MX3005 Thermocyclers (Agilent) using the Brilliant III Ultrafast kit (Stratagene). Each reaction was run in duplicate in a final volume of 20 µL containing the DNA sample (5 µL at a 5 ng/µL concentration), 200 nM of each primer (for OsHV-1, DPF 5′ ATT GAT GATGTG GAT AAT CTG TG 3′ and DPR 5′ GGT AAA TAC CAT TGG TCT TGTTCC 3′ [26] and for V. aestuarianus, DNAj-F 5′ GTATGAAATTTTAACTGACCCACAA3′ and DNAj-R 5′ CAATTTCTTTCGAACAACCAC 3′ [27]) and 200 nM of an oligonucleotide probe (for V. aestuarianus DNAj, probe 5′ TGGTAGCGCAGACTTCGGCGAC). The real-time PCR cycling conditions were as follows: 3 min at 95 °C, followed by 40 cycles of amplification at 95 °C for 5 s and 60 °C for 20 s. For OsHV-1 DNA quantification, melting curves were also plotted (55-95 °C) to ensure that a single PCR product was amplified for each set of primers. Negative controls (without DNA) were included.

Evaluation of the immune status of the selected and control lines

The immune statuses of the oyster lines were evaluated based on the expression of immune-related genes in the AS, AC, BS and BC lines prior to trial 3 set 1 at 12 months and trial 3 set 5 at 32 months. Immune-related genes were selected based on previous studies showing their transcriptomic regulation following vibrio challenge or between oyster lines selected for their resistance/sensitivity to in situ mortality [16, 18]. Oysters were removed from their shells, and the whole soft body was immediately plunged into liquid nitrogen. Then, the oysters were pulverized in groups (three groups of 10 oysters per oyster line) with a Mixer Mill MM 400 (Retsch) under liquid nitrogen conditions. The frozen oyster powder was stored at −80 °C prior to RNA extraction for gene expression analysis. RNA extraction from the frozen oyster powder was performed with the TRIzol Reagent (Invitrogen) according to the manufacturer’s instructions. Briefly, 100 mg of oyster powder was homogenized in 1 mL of TRIzol by vortexing for 1 h at 4 °C. Next, the RNA samples were treated with 5 U of DNase I (Invitrogen) to eliminate DNA contamination according to the manufacturer’s instructions, followed by RNA precipitation to eliminate the degraded DNA (with 100% isopropyl alcohol and 3 M Na-acetate). Then, the RNA samples were dissolved in 50 µL of RNase-free water and quantified using a NanoDrop spectrophotometer (Thermo Scientific). The integrity of the total RNA was verified using 1.5% agarose gel electrophoresis. Finally, total RNA was reverse transcribed using the Moloney Murine Leukemia Virus Reverse Transcriptase (MMLV-RT) according to the manufacturer’s instructions (Invitrogen). qPCR assays were performed on the Light-Cycler 480 System (Roche) in a final volume of 5 µL containing 1× Light-Cycler 480 master mix, 0.5 μM of each primer and 1 μL of cDNA diluted 1/8 in sterile ultra-pure water. The primer pairs used to amplify the 31 immune-related genes are listed in Table 2. Primer pair efficiencies (E) were calculated by five serial dilutions of pooled cDNA ranging from 1/2 to 1/64 in sterile ultra-pure water using the slopes provided by the LightCycler software according to the equation: E = 10[−1/slope]. The qPCR program was composed of an initial denaturation step of 15 min at 95 °C, followed by amplification of the target cDNA (35 cycles of denaturation at 95 °C for 10 s, annealing at 57 °C for 20 s and extension at 72 °C for 25 s with fluorescence detection). Relative expression levels of the immune-related genes were calculated with the method described by Pfaffl [28] and normalized using the mean of values of three constitutively expressed genes (Cg-EF1 [GenBank AB122066], Cg-RPL40 [GenBank FP004478] and Cg-RPS6 [GenBank HS119070]).
Table 2

Primers and functional categories of the analyzed immune-related genes.

Gene numberFunctional categoryNameSense primerAntiSense primer
72Immune responseMetallothionein aCAGCTCACACAGTCCCTTCCATGTACAGTTACACGATGC
122Immune responseUniversal stress proteinTTGAGGTTTCCGTGAACGAGAACAATCACCGGAACTGACG
130Immune responseInterferon-induced protein 44AAGATCCAACGATGAAAGACTTGTCGACATCACTACAAAC
163Immune responseBig defensinTTCGCCTGCTTCCATACTGGGTCATGGTCACTCCTTATTC
189Immune responseC-type lectin 2 like proteinGTCATCTGACCACAATTACAGTCGATAGCAGCATTCCAGAG
220Immune responseMyD88 adaptorAGGTACCGGCTGTGATACGATTCAAACGCCACCAAGACTG
234Immune responseTumor necrosis factor ligand superfamilyGGATACGCAAGAGGAACTGCTGGACATTAACGACACGCGC
293Immune responseInterleukin 17ACTGAGGCTCGATGCAAGTGAGCCTTCTTGCTTCATGTGG
300Immune responseHeat shock protein 70GCATGTGAGCGAGCAAAACGTGGCAGCTTGAACAGCAGC
303Immune responseGalectinACGAAACGCTCTGATTGGTGTTAGTGGCATGGTAGGTCTG
304Immune responseL-rhamnose-binding lectinAGATGATTGTGAAAGCAGCGAACTGTAGCGGTCATGCTCTG
306Immune responseProline rich proteinCACCATGTTCTCTCGGAGGAGTCTGCAATGTTAACCCTCAG
307Immune responseHemocyte defensinGTTGTAGAGCGGGCTACTGTGCTTGGTCAGATTCAGACTGG
351Immune responseMetallothionein bGGAACTGTAGCTGTGGAGACCCTTCTTACAGCAGCAGTCG
399Immune responseMetallothionein cATGTCCGATCATTGTTCCTGACAGGTTTCTGGTCCGTGAC
8Cellular differentiationAngiopoietin-1 receptor aTGACGTGCTCGGCAACATGCCATTGTGTCCCCGTGAAGCC
312Cellular differentiationAngiopoietin-1 receptor bCGAAATCGTCTTACGAACGCGTTAGCAAGATCCCGTTGAG
324Cellular differentiationEarly growth response proteinCTACCTCCACAAGCGACATGACGTCGTTACTATGTGAGGG
216Cellular differentiationPlacental protein 11GCCAGATTTACCTGGAATGGATGCGGTGTAGATAGCGATG
375Cellular differentiationGTP-binding protein Di-Ras2TTGGGCGTACAGTGACAACCTCTCTGTTTCCTCGTGAACC
396Cytoskeleton reorganizationAcyl-CoA desaturaseAGATGCAGACCCACACAACGGCGTTCCAAAGTGATTCTCC
401Cytoskeleton reorganizationNeurotrypsinAAACAATGCAAGGGAGAAGCCTATTGTCAGCACAATCTGG
441Cytoskeleton reorganizationMajor vault proteinTTCAAGAGTCAAGTGGATGCACCATTGGCGGTATTGAAGG
439Cytoskeleton reorganizationMyosin essential light chainTACATAACGGGTCATGAGACCAACACTGGATTACCACCTG
348Cytoskeleton reorganizationCalcineurin subunit B isoform 1ACGGTGTATTCCTTGTGTCCTCTTCTGTACATGCAAGTGG
284Cell adhesion-communicationIntegrin beta-PSCCCACCTAGTGCCAGTCAAGGAACTTTGACTTGTGTGACGT
420Cell adhesion-communicationHemagglutinin/amebocyte aggregation factor precursorTCGTGAATGCTGAACACACCTACACCTGTCCAAACCAAGG
283Respiratory chainExtracellular superoxide dismutaseAGAGGTGAATGCTACCAGGAGGCCAAGAATTCCGTCTG
422Respiratory chainGlutathione transferase omega-1TTGGACAGGTTACCACACAGCAAACCAAGGCCATACCATG
378Pro- and anti-apoptosisCaspase 7AGGGAGACAAGCGCCGTCAGTCCTCATTTGCTCTTCGTTC
166No hitUnknown gene product 166AAGTCGTATAGGAGCACAGGGGCTGAGAACATAATCCTCC
Primers and functional categories of the analyzed immune-related genes.

Statistical analyses

Survival was analyzed with the SAS 9 software using the GLIMMIX procedure by a logistic regression for binomial data. The general model for the first trial was:where Y was the survival probability, µ was the intercept, stock represented stock A or line B, and selection represented the level of selection for OsHV-1 resistance (selected or control). For trial 2, the bacterial concentration factor and all interactions between the bacterial concentrations, the stock and the selection factors were added to the model. For the first three sets of challenges in trial 3, the set factor and its interactions were added to the model. A similar model was also used for the last two sets of challenges in trial 4. For the gene expression analysis, statistical analysis was performed using the STATISTICA software version 7.1 (StatSoft) using the Mann–Whitney U test (significant value: p < 0.05). Hierarchical clustering of the gene expression data was performed with the Multiple ArrayViewer software using the average linkage clustering with the Spearman Rank Correlation as the default distance metric.

Results

No mortality occurred in the control tanks for each line (AC, AS, BC and BS). The first mortality occurred on day 2, and a peak of mortality was observed on day 5. As expected, the selected oysters presented low mortality (3 and 7% for AS and BS, respectively), whereas the control oysters had significantly higher mortality (60 and 67% for AC and BC, respectively, p < 0.001). The mean mortality was 32 and 37% for stocks A and B, respectively. The mortality between these stocks was not significantly different. Moreover, no difference was observed for the interaction between the stocks and the level of selection for resistance to OsHV-1 infection (p > 0.05). High amounts of OsHV-1 DNA was detected in all of the moribund oyster samples analyzed (n = 31). No mortality was observed for oysters injected with SASW in the control tanks. The mortality rates of each line at each injected dose are shown in Figure 3. Very high mortality ranging from 77 to 100% was observed for all lines regardless of the infectious dose. None of the factors were significant with the exception of the bacterial concentration factor (p = 0.0003) and the interaction between the stock and level of selection (p = 0.0005) (Table 3). At the stock level, the selected line exhibited lower mortality compared to the control line for stock B at each bacterial concentration; the opposite effect was observed for stock A at the two lowest concentrations (Figure 3). The mortality at the lowest bacterial concentration was significantly lower compared to the morality at the other concentrations (p < 0.0001).
Figure 3

Mean mortality (sd between tanks) in Trial 2. Oyster lines were challenged at the juvenile stage via intramuscular injection of V. aestuarianus for the control (AC and BC) and selected lines (AS and BS) at different bacterial concentrations.

Table 3

Logit analysis of mortality in Trial 2.

EffectDFF P
Stock12.420.1207
Selection10.60.4374
Bacterial concentration36.290.0003
Stock × selection112.230.0005
Stock × bacterial concentration31.310.2708
Selection × bacterial concentration30.50.6801
Stock × selection × bacterial concentration32.060.1042

Oyster lines were challenged at the juvenile stage for primary infection by injection of V. aestuarianus for the control and selected lines of both stocks and at different doses

Mean mortality (sd between tanks) in Trial 2. Oyster lines were challenged at the juvenile stage via intramuscular injection of V. aestuarianus for the control (AC and BC) and selected lines (AS and BS) at different bacterial concentrations. Logit analysis of mortality in Trial 2. Oyster lines were challenged at the juvenile stage for primary infection by injection of V. aestuarianus for the control and selected lines of both stocks and at different doses

Trial 3: primary infection by cohabitation between oysters injected with V. aestuarianus and the selected and control lines at the juvenile and adult stages

Primary exposure with the V. aestuarianus cohabitation protocol at the juvenile stage (sets 1 to 3)

No mortality occurred in the control tanks of each set of trial 3. All moribund oysters sampled were positive for V. aestuarianus DNA (n = 45). The mortality of each line at the endpoint for the first three sets of trial 3 (corresponding to the juvenile stage) is presented in Figure 4. In contrast to the by-injection protocol, higher variability in mortality was observed among the lines, with a range from 6 to 90%. A significant interaction was found between the sets and selection (p = 0.0008) (Table 4); this interaction was explained at the selection level, with higher mortality observed in set 1 compared to set 3 for the selected lines and the highest mortality observed in the control lines in set 3 (Figure 4). The mean mortalities of the three sets were 14 and 33% for the AS and BS lines, respectively; this mortality was significantly lower than the mortality observed for the control lines (71 and 80% for AC and BC, respectively, p < 0.0001) (Table 4). To a much lesser extent, stock A had significantly lower mortality (43%) than stock B (53%) (p = 0.0065).
Figure 4

Mean mortality (sd between tanks) in Trial 3 sets 1 to 3. Oyster lines were challenged at the juvenile stage via cohabitation challenges between oysters injected with V. aestuarianus and healthy juveniles of the control (AC and BC) and selected lines (AS and BS).

Table 4

Logit analysis of mortality in Trial 3 sets 1 to 3.

EffectDFF P
Set22.410.0909
Stock17.460.0065
Selection1107.19<.0001
Set × stock20.430.6518
Set × selection27.250.0008
Stock × selection13.810.0515
Set × stock × selection20.640.8576

Oyster lines were challenged at the juvenile stage for a primary infection throughout 3 sets of cohabitation between oysters injected with V. aestuarianus and the control and selected lines of both stocks

Mean mortality (sd between tanks) in Trial 3 sets 1 to 3. Oyster lines were challenged at the juvenile stage via cohabitation challenges between oysters injected with V. aestuarianus and healthy juveniles of the control (AC and BC) and selected lines (AS and BS). Logit analysis of mortality in Trial 3 sets 1 to 3. Oyster lines were challenged at the juvenile stage for a primary infection throughout 3 sets of cohabitation between oysters injected with V. aestuarianus and the control and selected lines of both stocks

Primary exposure with the V. aestuarianus cohabitation protocol at the adult stage (sets 4 and 5)

For the fourth set of trial 3, the mortality was 87, 45, 62 and 70% for the AS, AC, BS and BC lines, respectively; the mortality decreased to 49, 32, 36 and 53%, respectively, in the fifth set of challenges in trial 3 (Figure 5). None of the factors were significant with the exception of a significantly lower mortality in the fifth set compared to the fourth set (p = 0.0002) and a significant interaction between the stocks and level of selection (p = 0.0012) (Table 5). At the stock level, the stock A control line had significantly lower mortality than the selected line, whereas the opposite trend was observed for stock B (Figure 5).
Figure 5

Mean mortality (sd within Oyster lines were challenged at the juvenile stage for the three first sets of trial 3 and at the adult stage for sets 4 and 5 of trial 3 via cohabitation challenges between oysters injected with V. aestuarianus and healthy juveniles of the control (AC and BC) and selected lines (AS and BS).

Table 5

Logit analysis of mortality in Trial 3 set 4 and 5.

EffectDFF P
Set113.850.0002
Stock10.000.9557
Selection12.230.1368
Set × stock10.400.5278
Set × selection12.390.1233
Stock × selection110.720.0012
Set × stock × selection10.820.3648

Oyster lines were challenged at the adult stage for a primary infection throughout 2 sets of cohabitations between oysters injected with V. aestuarianus and the control and selected lines of both stocks

Mean mortality (sd within Oyster lines were challenged at the juvenile stage for the three first sets of trial 3 and at the adult stage for sets 4 and 5 of trial 3 via cohabitation challenges between oysters injected with V. aestuarianus and healthy juveniles of the control (AC and BC) and selected lines (AS and BS). Logit analysis of mortality in Trial 3 set 4 and 5. Oyster lines were challenged at the adult stage for a primary infection throughout 2 sets of cohabitations between oysters injected with V. aestuarianus and the control and selected lines of both stocks

Expression levels of immune-related genes can discriminate oyster lines in terms of susceptibility/resistance to V. aestuarianus infection at the juvenile and adult stages

The hierarchical clustering of the 31 immune-related genes or only the differentially expressed genes (p < 0.05) could separate the oyster lines in terms of their resistance/sensitivity to bacterial infection at the two developmental stages analyzed (12 and 32 months, Figure 6). At 12 months of age, hierarchical clustering of the gene expression data separated the oyster lines into two major clusters of conditions: the first cluster included the AS and BS lines, while the second cluster included the AC and BC lines (Figure 6A). At 32 months of age, two major clusters of conditions were found that were similar to those observed for the 12 month old oysters, but the oyster lines did not separate in the same manner (Figure 6B): the first cluster included the AC and BS lines, whereas the second cluster included the AS and BC lines. Interestingly, these discriminations of the oyster lines were in accordance with the resistance/sensitivity to infection of the lines at 12 and 32 months of age.
Figure 6

Discrimination of oyster lines contrasted in term of susceptibility based on the expression levels of immune-related genes. A Hierarchical clustering of the relative expression levels of 31 immune-related genes in non-stimulated oysters of the AC, AS, BC and BS lines (three groups of ten oysters per line) at 12 months of age. B Hierarchical clustering of the relative expression levels of the 11 differentially expressed genes in non-stimulated oysters of the AC, AS, BC and BS lines (three groups of ten oysters per line) at 12 months of age. C Hierarchical clustering of the relative expression levels of 31 immune-related genes in non-stimulated oysters of the AC, AS, BC and BS lines (three groups of ten oysters per line) at 32 months of age. D Hierarchical clustering of the relative expression levels of the 7 differentially expressed genes in non-stimulated oysters of the AC, AS, BC and BS lines (three groups of ten oysters per line) at 32 months of age. The intensity of the color (from green to red) indicates the magnitude of differential expression (see color scale at the bottom of the image). The dendrogram at the left of the figures indicates the relationship among samples from the oyster lines, whereas the dendrogram at the top of the figures indicates the relationship among the relative expression levels of the selected genes.

Discrimination of oyster lines contrasted in term of susceptibility based on the expression levels of immune-related genes. A Hierarchical clustering of the relative expression levels of 31 immune-related genes in non-stimulated oysters of the AC, AS, BC and BS lines (three groups of ten oysters per line) at 12 months of age. B Hierarchical clustering of the relative expression levels of the 11 differentially expressed genes in non-stimulated oysters of the AC, AS, BC and BS lines (three groups of ten oysters per line) at 12 months of age. C Hierarchical clustering of the relative expression levels of 31 immune-related genes in non-stimulated oysters of the AC, AS, BC and BS lines (three groups of ten oysters per line) at 32 months of age. D Hierarchical clustering of the relative expression levels of the 7 differentially expressed genes in non-stimulated oysters of the AC, AS, BC and BS lines (three groups of ten oysters per line) at 32 months of age. The intensity of the color (from green to red) indicates the magnitude of differential expression (see color scale at the bottom of the image). The dendrogram at the left of the figures indicates the relationship among samples from the oyster lines, whereas the dendrogram at the top of the figures indicates the relationship among the relative expression levels of the selected genes. In the juveniles, 11 genes showed differential gene expression patterns, while in the adults only 7 genes showed differential expression patterns. Among these differentially expressed genes, four genes were common to juveniles and adults (306, 283, 284 and 304). These four genes showed the same patterns of expression in the juveniles and adults according to their resistance/sensitivity to infection. Thus, genes expressed at higher levels in the susceptible lines (AC and BC) vs. the resistant lines (AS and BS) in juveniles also appeared to be expressed at higher levels in the susceptible lines (AC and BS) vs. the resistant lines (AS and BC) in adults (genes 283, 284 and 304). Likewise, the gene expressed at a higher level in the resistant lines (AS and BS) vs. the susceptible lines (AC and BC) in juveniles also appeared to be expressed at a higher level in the resistant lines (AS and BC) vs. the susceptible lines (AC and BS) in adults (gene 306). Other differentially expressed genes appeared to be associated with one developmental stage: 7 genes were found to be differentially expressed only in juveniles (216, 8, 420, 401, 220, 396 and 441), and 3 genes were found to be differentially expressed only in adults (189, 234 and 378).

Trial 4: successive infections by cohabitation between oysters injected with V. aestuarianus and the selected and control lines

After the three first sets of bacterial challenges of trial 3, the final mortality was 14, 71, 33 and 80% for AS, AC, BS and BC, respectively. During the period between trials 3 and 4, the survivors were kept in a tank with filtered and UV-treated seawater enriched with microalgae. Although this period did not represent a disease challenge, the survivors still experienced significant mortality associated with the detection of V. aestuarianus DNA in the moribund oysters. Most of the mortality was observed in July 2013 after a spawning event. The mortality between trial 3 and the first set of challenges of trial 4 was 74, 90, 32 and 97% for AS, AC, BS and BC, respectively (Table 6); consequently, the cumulative mortality due to V. aestuarianus before trial 4 reached 78, 96, 54 and 99%, respectively. Although the control lines were tested in trial 4, the remaining oysters numbered less than 5. Therefore, the mortality was not compared with the selected lines. During the first set of challenges in trial 4, the mortality was 46 and 28% for AS and BS, respectively (Table 5). No significant difference in mortality (<5%) was reported between the two sets of challenges in trial 4. Finally, the survivors exhibited some mortality, with 60 and 38% mortality for AS and BS, respectively (Table 6). The cumulative mortality after three successive challenges with V. aestuarianus in trials 3 and 4 (including the mortality between trials) was 96, 99, 84 and 100% for AS, AC, BS and BC, respectively (Table 6).
Table 6

Mortality rates per line during three successive challenges.

ASACBSBC
Initial number of oysters160153165155
Mean mortality of sets 1 to 3 of trial 3 (Feb to Mar 2013) (%)14713380
Mortality between trial 3 and the first set of trial 4 (%)74903297
First set of trial 4 in Mar 2014 (%)46 40 28 100
Mortality between the two sets of trial 4 (%)<5<5 <5
Second set of trial 4 in Nov 2014 (%)60 0 38
Final oysters number remaining after three successive challenges6 1 260
Cumulated mortality after three successive challenges (%)969984100

Cumulative mortality by cohabitation between oysters injected with V. aestuarianus and the control (AC and BC) and selected lines (AS and BS) are shown from sets 1, 2, and 3 of trial 3 and sets 1 and 2 of trial 4

In italics, the number of oysters was less than 5

Mortality rates per line during three successive challenges. Cumulative mortality by cohabitation between oysters injected with V. aestuarianus and the control (AC and BC) and selected lines (AS and BS) are shown from sets 1, 2, and 3 of trial 3 and sets 1 and 2 of trial 4 In italics, the number of oysters was less than 5

Discussion

While mortality related to OsHV-1 and V. aestuarianus was reported in C. gigas in France prior to 2008 [27, 29], their impact on French oyster production became predominant due to recurrent and intense mortality in spat and adult oysters. While selective breeding to enhance resistance to OsHV-1 infection in C. gigas has been recently demonstrated [11, 15], this demonstration is under investigation for V. aestuarianus. Nevertheless, this study aimed to elucidate whether selective pressure exerted by viral infections in the field could impact the susceptibility of C. gigas to bacterial infection. In trial 1, the selected lines of both stocks exhibited much lower mortality (AS 3% and BS 7%) than the control lines (AC 60% and BC 67%). Although higher mortality was observed in the field evaluation (50 and 35% for AS and BS, respectively, and 91 and 94% for AC and BC, respectively [11]), our result was consistent with the field evaluation and supported that selection to enhance survival in C. gigas spat was effective for herpes virus infection. The lower mortality observed in our study could be explained by the use of larger (20 g versus <7 g) and older (13 months old versus <5 months old) oysters (juvenile versus spat) because OsHV-1 resistance increased with age and size [21]. However, the most important information from trial 1 was the confirmation that AS and BS had higher resistance to OsHV-1 infection than AC and BC before their evaluation of exposure to V. aestuarianus. In trial 2, the mortality of three of the lines reached 100%. The mortality for BS was >90% at higher bacterial concentrations corresponding to 5 × 104 and 5 × 105 CFU per oyster (Figure 3). Although the mortality was slightly lower at the lowest bacterial concentration (corresponding to 500 CFU per oyster and ranging from 76 to 96%; Figure 3), this finding confirmed that strain 02/041 was a highly virulent strain in C. gigas juveniles (20 g); this finding was recently demonstrated in spat weighing 1.5 g that exhibited high mortality (>75%) at doses of 102 and 107 CFU per spat [30]. Consequently, selective breeding to enhance higher resistance to OsHV-1 at the spat stage but does not confer higher resistance to V. aestuarianus infection at the juvenile stage. Injection of the bacteria directly into the adductor muscle may bypass the oysters’ natural barriers to infection by V. aestuarianus. Due to the high mortality observed for all lines when the injection method is used, the cohabitation method should be applied to evaluate the resistance to V. aestuarianus infection of the control and the selected lines because transmission of the bacteria between oysters is what is expected to occur under natural conditions. The three sets of trial 3 were performed at the juvenile stage, and all exhibited the same mortality patterns. The main finding revealed that the selected lines AS and BS had lower mortality than the control lines AC and BC (Figure 4). This result suggested that selection to increase survival at the spat stage in the field was also efficient in enhancing dual resistance to OsHV-1 infection and V. aestuarianus infection at the juvenile stage. A similar result was observed in Crassostrea virginica for dual resistance to Haplosporidium nelsoni and Perkinsus marinus [31], but most studies revealed that breeding for higher resistance to a disease did not confer a higher resistance to another disease [32]. Controversially, this pattern was not found at the adult stage, where much higher mortality was observed for both of the selected lines (particularly the AS line). Indeed, line AS exhibited 87% mortality in set 4 of trial 3, whereas the control line AC had lower mortality (45%) (Figure 5). Additionally, while the AS line had higher mortality in adults than in juveniles, the AC line had lower mortality at the adult stage (45%) than at the spat stage (71%) (Figure 5). This same pattern was observed for BS and BC to a lesser extent, except that BS had lower mortality than BC at the adult stage (Figure 5). A similar pattern was observed in set 5 of trial 3, although the mortality was lower than the mortality recorded in set 4 of trial 3. For set 5 of trial 3, it is important to note that the oysters were survivors of field mortality events that could have been related to OsHV-1 and/or V. aestuarianus and/or other pathogens. Consequently, the survivors used in set 5 were likely to be genetically more resistant than the naïve oysters used in set 4, as demonstrated for the summer mortality phenomenon in C. gigas [33]. Another hypothesis could be related to the reproductive status. Sets 4 and 5 of trial 3 occurred in May and November of 2014, which represented the pre- and post-spawning periods, respectively. Previous experiments have shown that the active gametogenesis period corresponds to higher susceptibility to vibriosis in mollusks [34-37]. Consequently, primary infection of C. gigas with V. aestuarianus by cohabitation showed a different mortality pattern according to the stage of development and the level of selection. Hence, evaluation of vibriosis resistance in C. gigas represents a complex interaction between the genotype and the stage of development, and therefore the size, reproductive status and age of the oysters as described for OsHV-1 in C. gigas [21, 33, 38]. Our study also revealed that selecting for resistance to OsHV-1 infection in spat did not confer either higher resistance or susceptibility to V. aestuarianus infection in adults, which was in agreement with similar studies in oyster species [39-41]. Experimental studies working on V. aestuarianus should replicate the oyster genotypes. The difference in mortality between the four lines used in our study also suggested a genetic basis for V. aestuarianus resistance in C. gigas, but this speculation required further investigation. Our results showed high variability in the expression of selected immune-related genes that was dependent on the animal batch and age. This variability allowed the discrimination of oyster batches and correlated with their sensitivity to bacterial infection. Interestingly, expression of this set of immune-related genes was correlated with sensitivity to vibriosis rather than the genetic background. Because sensitivity to infection evolved depending on the oyster stage tested, the clustering of oyster batches also evolved in an age-dependent manner. At the juvenile stage, the lines selected for their resistance to OsHV-1 infection that presented low sensitivity to vibriosis were clearly discriminated from the control lines that presented higher sensitivity to V. aestuarianus infection. At the adult stage, selected line A and control line B showed intermediate sensitivity to vibriosis and were discriminated from control line A and selected line B with higher sensitivity to V. aestuarianus infection. Our results showed for the first time the possibility of using gene expression analysis to discriminate between oyster lines according to the resistance/susceptibility at two different developmental stages independent of the genetic background of the oyster lines. Specifically, four genes discriminated between the oyster lines according to their resistance/susceptibility. These four genes are associated with different immune functions and suggest a complex discrimination of oyster lines through their immune status. The four genes able to discriminate oyster lines are related to antimicrobial functions (the proline rich peptide Cg-prp [42]), anti-oxidative responses (the extracellular superoxide dismutase Cg-SOD [43]), cell adhesion (the Integrin beta-PS [44]) and recognition molecules (the L-rhamnose-binding lectin [45]). These results show that it is now necessary to develop global transcriptomic approaches to clearly elucidate the transcriptomic basis of the resistance/susceptibility of oysters. Finally, trial 4 was designed to test the effect of successive challenges using survivors of a previous challenge. The survivors of an initial exposure to V. aestuarianus still exhibited significant mortality in response to the same pathogenic agent at the second exposure. Consequently, the survivors were not genetically resistant, but they were either less susceptible during the previous exposures or the infection cohabitation did not allow equal expose of the oysters to the bacteria. Thus, a first contact with V. aestuarianus is not protective. This mortality pattern was also found in the abalone Haliotis tuberculata during two successive infections by the pathogen Vibrio harveyi [46]. Our result contrasted with the results obtained for the summer mortality phenomenon and OsHV-1, for which the survivors were selected for resistance and exhibited low mortality the following year [33, 38]. Between trials 3 and 4, mortality due to V. aestuarianus was mostly observed after a spawning event, thereby reinforcing the importance of the reproductive status on the resistance to the bacteria. Post-spawning oysters were much more susceptible to the disease, as demonstrated with the mortality event due to opportunistic Vibrio sp in C. gigas [34, 37, 47] and OsHV-1 in C. gigas that occurred a couple of days after spawning [48]. Otherwise, the cumulative mortality after three successive exposures to V. aestuarianus was very high for all lines (ranging from 84 to 100%) (Table 6). These mortality rates are extremely concerning for French oyster farmers, who cannot continue to remain feasible with this level of loss of C. gigas in their oyster stocks. In conclusion, our study showed that: (1) cohabitation between injected oysters and healthy oysters seemed to be preferable for the genetic evaluation of V. aestuarianus resistance in C. gigas compared to intramuscular injection; (2) the mortality pattern for primary exposure to V. aestuarianus at the juvenile stage was similar to the pattern observed for OsHV-1 infection, with a higher resistance in selected oysters than control oysters, which suggested dual resistance at the juvenile stage; (3) differences in the mortality patterns were highlighted between juveniles and adults during primary infection, suggesting a complex interaction between the genotype and the stage of development for Vibrio sensitivity; and (4) selection of immune-related genes allowed for the discrimination of batches depending on their sensitivity to infection at the two stages tested rather than on their genotype. The differences in mortality among the lines also suggested a genetic basis for the resistance to V. aestuarianus infection. Similarly, selection to enhance OsHV-1 resistance did not confer increased susceptibility or resistance to V. aestuarianus infection. Therefore, to improve resistance to V. aestuarianus infection, a breeding program needs to use high intensities of selective pressure. Resistance to V. aestuarianus infection should be evaluated through successive exposures to the disease because the oysters remained susceptible to V. aestuarianus even if they survived one or several mortality outbreaks related to the disease. Breeding companies interested in enhancing Vibrio resistance should use oysters that were previously selected for resistance to OsHV-1 infection at the spat stage for broodstock. Then, these broodstocks should be evaluated at the adult stage to combine the resistance traits.
  23 in total

1.  A new mathematical model for relative quantification in real-time RT-PCR.

Authors:  M W Pfaffl
Journal:  Nucleic Acids Res       Date:  2001-05-01       Impact factor: 16.971

2.  Evidence in oyster of a plasma extracellular superoxide dismutase which binds LPS.

Authors:  Marcelo Gonzalez; Bernard Romestand; Julie Fievet; Arnaud Huvet; Marie-Christine Lebart; Yannick Gueguen; Evelyne Bachère
Journal:  Biochem Biophys Res Commun       Date:  2005-10-21       Impact factor: 3.575

3.  Experimental ostreid herpesvirus 1 infection of the Pacific oyster Crassostrea gigas: kinetics of virus DNA detection by q-PCR in seawater and in oyster samples.

Authors:  D Schikorski; N Faury; J F Pepin; D Saulnier; D Tourbiez; T Renault
Journal:  Virus Res       Date:  2010-08-13       Impact factor: 3.303

4.  Gene expression patterns of abalone, Haliotis tuberculata, during successive infections by the pathogen Vibrio harveyi.

Authors:  Marie-Agnès Travers; Anne-Leila Meistertzheim; Marion Cardinaud; Carolyn S Friedman; Sylvain Huchette; Dario Moraga; Christine Paillard
Journal:  J Invertebr Pathol       Date:  2010-08-06       Impact factor: 2.841

5.  Detection and description of a particular Ostreid herpesvirus 1 genotype associated with massive mortality outbreaks of Pacific oysters, Crassostrea gigas, in France in 2008.

Authors:  Amélie Segarra; Jean François Pépin; Isabelle Arzul; Benjamin Morga; Nicole Faury; Tristan Renault
Journal:  Virus Res       Date:  2010-07-16       Impact factor: 3.303

6.  A large-scale epidemiological study to identify bacteria pathogenic to Pacific oyster Crassostrea gigas and correlation between virulence and metalloprotease-like activity.

Authors:  Denis Saulnier; Sophie De Decker; Philippe Haffner; Laetitia Cobret; Maeva Robert; Céline Garcia
Journal:  Microb Ecol       Date:  2009-12-11       Impact factor: 4.552

7.  Summer immune depression associated with increased susceptibility of the European abalone, Haliotis tuberculata to Vibrio harveyi infection.

Authors:  Marie-Agnès Travers; Nelly Le Goïc; Sylvain Huchette; Marcel Koken; Christine Paillard
Journal:  Fish Shellfish Immunol       Date:  2008-08-22       Impact factor: 4.581

8.  Analysis of genes isolated from plated hemocytes of the Pacific oyster, Crassostreas gigas.

Authors:  Steven Roberts; Giles Goetz; Samuel White; Frederick Goetz
Journal:  Mar Biotechnol (NY)       Date:  2008-07-12       Impact factor: 3.619

9.  Real-time PCR assay for rapid detection and quantification of Vibrio aestuarianus in oyster and seawater: a useful tool for epidemiologic studies.

Authors:  Denis Saulnier; Sophie De Decker; Philippe Haffner
Journal:  J Microbiol Methods       Date:  2009-02-02       Impact factor: 2.363

10.  Oyster hemocytes express a proline-rich peptide displaying synergistic antimicrobial activity with a defensin.

Authors:  Yannick Gueguen; Romestand Bernard; Fievet Julie; Schmitt Paulina; Destoumieux-Garzón Delphine; Vandenbulcke Franck; Bulet Philippe; Bachère Evelyne
Journal:  Mol Immunol       Date:  2008-10-28       Impact factor: 4.407

View more
  5 in total

1.  Distinct immune responses of juvenile and adult oysters (Crassostrea gigas) to viral and bacterial infections.

Authors:  Timothy J Green; Agnes Vergnes; Caroline Montagnani; Julien de Lorgeril
Journal:  Vet Res       Date:  2016-07-21       Impact factor: 3.683

2.  Several strains, one disease: experimental investigation of Vibrio aestuarianus infection parameters in the Pacific oyster, Crassostrea gigas.

Authors:  Marie-Agnès Travers; Delphine Tourbiez; Leïla Parizadeh; Philippe Haffner; Angélique Kozic-Djellouli; Mohamed Aboubaker; Marcel Koken; Lionel Dégremont; Coralie Lupo
Journal:  Vet Res       Date:  2017-05-26       Impact factor: 3.683

3.  Genetic parameters of resistance to Vibrio aestuarianus, and OsHV-1 infections in the Pacific oyster, Crassostrea gigas, at three different life stages.

Authors:  Patrick Azéma; Jean-Baptiste Lamy; Pierre Boudry; Tristan Renault; Marie-Agnès Travers; Lionel Dégremont
Journal:  Genet Sel Evol       Date:  2017-02-15       Impact factor: 4.297

4.  Comparative Proteomics of Ostreid Herpesvirus 1 and Pacific Oyster Interactions With Two Families Exhibiting Contrasted Susceptibility to Viral Infection.

Authors:  Maxime Leprêtre; Nicole Faury; Amélie Segarra; Stéphane Claverol; Lionel Degremont; Mélissa Palos-Ladeiro; Jean Armengaud; Tristan Renault; Benjamin Morga
Journal:  Front Immunol       Date:  2021-01-18       Impact factor: 7.561

5.  Genetic variability in Ruditapes decussatus clam combined with Perkinsus infection level to support founder population selection for a breeding program.

Authors:  Andreia Cruz; Fiz da Costa; Jenyfer Fernández-Pérez; Ana Nantón; Sergio Fernández-Boo; Ana Insua; Josefina Méndez
Journal:  PeerJ       Date:  2020-10-28       Impact factor: 2.984

  5 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.