Nicotine has practical applications relating to smoking cessation devices and alternative nicotine products. Genetic manipulation for increasing nicotine content in cultivated tobacco (Nicotiana tabacum L.) may be of value for industrial purposes, including the possibility of enhancing the efficiency of nicotine extraction. Biotechnological approaches have been evaluated in connection with this objective, but field-based results are few. Here, we report characterization of two genes encoding basic-helix-loop-helix (bHLH) transcription factors (TFs), NtMYC2a and NtMYC2b from tobacco. Overexpression of NtMYC2a increased leaf nicotine levels in T1 transgenic lines approximately 2.3-fold in greenhouse-grown plants of tobacco cultivar 'NC 95'. Subsequent field testing of T2 and T3 generations of transgenic NtMYC2a overexpression lines showed nicotine concentrations were 76% and 58% higher than control lines, respectively. These results demonstrated that the increased nicotine trait was stably inherited to the T2 and T3 generations, indicating the important role that NtMYC2a plays in regulating nicotine accumulation in N. tabacum and the great potential of NtMYC2a overexpression in tobacco plants for industrial nicotine production. Collected data in this study also indicated a negative feedback inhibition of nicotine biosynthesis. Further enhancement of nicotine accumulation in tobacco leaf may require modification of the processes of nicotine transport and deposition.
Nicotine has practical applications relating to smoking cessation devices and alternative nicotine products. Genetic manipulation for increasing nicotine content in cultivated tobacco (Nicotiana tabacum L.) may be of value for industrial purposes, including the possibility of enhancing the efficiency of nicotine extraction. Biotechnological approaches have been evaluated in connection with this objective, but field-based results are few. Here, we report characterization of two genes encoding basic-helix-loop-helix (bHLH) transcription factors (TFs), NtMYC2a and NtMYC2b from tobacco. Overexpression of NtMYC2a increased leaf nicotine levels in T1 transgenic lines approximately 2.3-fold in greenhouse-grown plants of tobacco cultivar 'NC 95'. Subsequent field testing of T2 and T3 generations of transgenic NtMYC2a overexpression lines showed nicotine concentrations were 76% and 58% higher than control lines, respectively. These results demonstrated that the increased nicotine trait was stably inherited to the T2 and T3 generations, indicating the important role that NtMYC2a plays in regulating nicotine accumulation in N. tabacum and the great potential of NtMYC2a overexpression in tobacco plants for industrial nicotine production. Collected data in this study also indicated a negative feedback inhibition of nicotine biosynthesis. Further enhancement of nicotine accumulation in tobacco leaf may require modification of the processes of nicotine transport and deposition.
Nicotine, as a bioactive natural phytochemical, has practical applications. It is the key component of smoking cessation devices and alternative nicotine products, such as electronic cigarette1. Nicotine may also play a role in treatments to ameliorate symptoms from Parkinson’s disease23. Although nicotine can be chemically synthesized, this is not currently a cost-effective approach for producing nicotine relative to chemical extraction from tobacco4. Tobacco plants with enhanced capacity to accumulate nicotine might be of value for commercial nicotine extraction operations.In commercial tobacco cultivars, nicotine represents 90–95% of the total alkaloid pool and is synthesized exclusively in tobacco roots, transported to leaves, and stored in leaf cell vacuoles by a multidrug and toxic compound extrusion (MATE) transporter56. Various factors control nicotine biosynthesis and accumulation, including plant genetics, environment conditions, insect predation, mechanical injury and agronomical management measures, such as topping (decapitation of the apical meristem at the early stage of flowering) and suckering (removing the axillary buds of plants activated by topping)78.Nicotine has two ring moieties, a pyrrolidine ring and a pyridine ring, derived from two branch pathways (Supplementary Fig. S1). The pyrrolidine ring is formed from arginine or ornithine via putrescine and methylputrescine. The first committed enzyme, putrescine methyltransferase (PMT), is under more stringent control than other enzymes of this branch pathway910. There are several other enzymes involved in the pyrrolidine branch route: arginine decarboxylase (ADC) which catalyzes the decarboxylation of arginine; ornithine decarboxylase (ODC) which catalyzes the decarboxylation of ornithine; and methylputrescine oxidase (MPO) which catalyzes the deamination of methylputrescine. The pyridine ring is derived from nicotinic acid, an intermediate of the pyridine nucleotide cycle that is regulated by an entry enzyme of the cycle, quinolinic acid phosphoribosyltransferase (QPT)11. The nicotine synthase (NS), which catalyzes the final condensation step between nicotinic acid and methylpyrrolinium cation to form nicotine, has not been elucidated, although two candidate genes (A622 and NtBBL) had been identified1012.Several attempts have been made to increase nicotine levels in tobacco plants using biotechnological methods. Because of the central role that PMT plays in nicotine biosynthesis13, NtPMT1a was the first nicotinesynthetic gene to be overexpressed in N. sylvestris, a progenitor species of tobacco, under control of the CaMV 35S promoter. Overexpression in greenhouse-grown plants was found to increase PMT transcripts levels 4 to 8 fold, with nicotine levels increased by about 40%14. In a separate report, overexpression of NtPMT1a or NtQPT2 individually or simultaneously was shown to enhance leaf nicotine levels in T0 transgenic presumably greenhouse-grown plants of N. tabacum cv. K32615. Wang16 obtained contradictory results in field-grown tobacco plants, however, and failed to observe increased nicotine contents in transgenic plants overexpressing NtPMT1a and/or NtQPT2. Recently, genes encoding for transcription factors were shown to positively regulate nicotine levels. NbbHLH1 and NbbHLH2 were the first two MYC2 related transcription factors characterized in the genus Nicotiana. Overexpression of either gene significantly increased nicotine levels in N. benthamiana, a small wild Nicotiana species. However, the reported nicotine level in fresh leaf of NbbHLH2 overexpression plants was only about 0.025% (0.25 mg/g)17, which is roughly ten times lower than nicotine levels typically observed for field-grown tobacco cultivars. In addition, several ERFs (ethylene response factors), another important class of transcription factors, were shown to positively regulate nicotine biosynthesis1819, but their effects on enhancement of nicotine content in cultivated tobacco plants have not been demonstrated.In another approach, overexpression of the allene oxide cyclase gene, a gene controlling a key step in jasmonate formation, was reported to cause a 4.8 fold increase in nicotine content in transgenic greenhouse-grown T0
N. tabacum cv. Petit Havana20, an early-flowering tobacco type with very low leaf number21.Here, we describe two NtMYC2 genes, NtMYC2a and NtMYC2b, isolated from a yeast one hybrid library screening using the promoter of NtQPT2 as bait and demonstrate that overexpression of either gene can effectively increase nicotine accumulation in greenhouse-grown T0 and T1 generation tobacco plants of a standard tobacco cultivar. We further demonstrate stable transmission of the increased nicotine trait through the T2 and T3 generations of NtMYC2a overexpression lines. Results from field tests of NtMYC2a overexpression lines suggests that transgenic overexpression of this transcription factor may be useful as a novel source to increase the nicotine content in cultivated tobacco. In addition, we observed evidence of a negative feedback loop of nicotine to regulate expression of its synthetic genes in tobacco root. Strategies to further increase nicotine levels in tobacco are discussed.
Results
Cloning of NtMYC2a and NtMYC2b genes from tobacco
The yeast one-hybrid technique was used in this study to identify transcription factors that bind to the promoter sequence of NtQPT2. A total of 1.6 million yeast clones were screened. Analysis of sequencing data revealed that a single clone carried a cDNA encoding a bHLH transcription factor, but the 5′ terminal sequence was missing. The full length cDNA sequence was obtained using the Rapid Amplification of cDNA Ends (RACE) technique. During the process, another highly homologous bHLH transcription factor was also identified.The full-lengths of the two cDNAs were found to be 2214 and 2391 bp encoding for proteins of 659 and 658 amino acids, respectively. The two cDNAs shared 95% identity to each other at the nucleotide sequence level, and BLAST analysis to the NCBI database showed these two transcription factors to be 99.9% (1979/1980 nt) and 100% (1977/1977 nt) identical to the coding sequences of NtMYC2a (GenBank No. GQ859160) and NtMYC2b (GenBank No. GQ859161). The single nucleotide difference in NtMYC2a could be caused by error in sequencing or PCR, or by cultivar difference. The two isolated TF genes were thus designated as NtMYC2a and NtMYC2b.A phylogenetic tree based upon amino acid sequences was constructed using the maximum likelihood method in MEGA5.2 22 to infer the evolutionary relationships of both NtMYC2a and NtMYC2b with other bHLH transcription factors. Several closely related transcription factors from the BLAST result were also included. As expected, NtMYC2a and NtMYC2b are closely related to each other, most closely related to NbbHLH2 and NaMYC2, and more distant to NtMYC1a, NtMYC1b, NbbHLH1 and StMYC217232425 (Fig. 1).
Figure 1
Phylogenetic tree of NtMYC2a, NtMYC2b and 14 other bHLH transcription factors.
The tree was constructed using the neighbor-joining method in MEGA5.2 22 with 1000 bootstrap replications. The proteins included in this analysis with accession number in parentheses are: NtMYC2a (ADH04269); NtMYC2b (ADH04270); NaMYC2 (AGL98100); NbbHLH2 (ADH04263); StMYC10 (CAF74711); NtMYC1b (ADH04268); NtMYC1a (ADH04267); NaMYC2-like (AGL98101); StMYC2 (CAF74710); NbbHLH1 (ADH04262); CrMYC2 (AAQ14332); RcMYC2 (XP_002519841); TcbHLH (EOY23994); GhbHLH (ACO53628); MdbHLH (ADL36595); AtMYC2 (NP_174541).
NtMYC2a and NtMYC2b differentially enhanced nicotine levels and affected expression of nicotine synthetic genes
To investigate the effect of the NtMYC2a and NtMYC2b TF genes on the biosynthesis of nicotine, we evaluated transgenic tobacco plants over-expressing these genes. The coding sequences of NtMYC2a and NtMYC2b were placed under the control of the CaMV 35S promoter to enhance the expression of the genes. In total, seven 35S:NtMYC2a and nine 35S:NtMYC2b T0 plants were generated and initially tested.Northern analysis was performed to test the expression levels of NtMYC2a/b in T0 greenhouse-grown plants. The results indicated that two NtMYC2a transgenic plants (AOE-3 and AOE-6) and six NtMYC2b transgenic plants (BOE-10, 11, 13, 14, 16 and 17) clearly exhibited increased expression of these genes compared to the wild type and vector control plants (Fig. 2). Leaf nicotine levels of these plants were quantified. Three 35S:NtMYC2b plants (BOE-10, 16 and 17) accumulated higher nicotine levels (approximately 40% over the vector control) while the other three plants (BOE-11, 13 and 14) produced nicotine levels that were similar to, or lower than, the controls. Two 35S:NtMYC2a T0 plants (AOE-3 and AOE-6) exhibited much higher nicotine levels as compared to the controls (123% and 150% higher, respectively, than the vector control) (Fig. 3). Based on this initial data, we selected two 35S:NtMYC2a and two 35S:NtMYC2b overexpression plants (AOE-3, AOE-6, BOE-16 and BOE-17) to study the effects of overexpression of these two TFs on the expression of genes associated with the nicotine biosynthetic pathway using quantitative real-time reverse transcription-PCR (qRT-PCR). Overexpression of NtMYC2b did not substantially alter the mRNA levels of the nicotinesynthetic genes except for a moderate reduction in the expression of the NtPMT, NtA622 and NtBBL genes (Fig. 4a). However, the expression of all the evaluated nicotinesynthetic genes was remarkably reduced by overexpression of NtMYC2a. We extended the transcript quantification of the seven nicotinesynthetic genes to plants of T1 generation of those overexpressing lines. Two plants from each line and a total of four plants for each NtMYC2 gene construct were analyzed. The results largely confirmed observations for the T0 plants. The expression of the nicotinesynthetic genes was much suppressed in NtMYC2a overexpression lines as compared to vector control (Fig. 4b). No obvious growth or developmental differences were noted between the transgenic and wild-type plants.
Figure 2
Northern hybridization showing NtMYC2 mRNA levels in roots of T0 transgenic plants before flowering.
The bottom panel shows the 25S ribosomal RNA in gel stained with EtBr as an RNA loading reference. AOE: NtMYC2a overexpression; BOE: NtMYC2b overexpression.
Figure 3
Leaf nicotine levels of T0 overexpression individuals.
Expression patterns of nicotine synthetic genes measured by qRT-PCR.
(a) The average expression level of T0 plants is shown. Two T0 plants from each construct that affects the nicotine level most were analyzed (AOE-3, AOE-6 for NtMYC2a and BOE-16, BOE-17 for NtMYC2b). (b) The average expression levels of nicotine synthetic genes in T1 plants are shown. Two transgene positive plants of each T1 line and thus total four plants for each construct were analyzed. The expression level in the vector control was set to 1, and expression of nicotine synthetic genes in T0 and T1 transgenic plants is shown relative to this level, the error bars indicate standard errors. AOE: NtMYC2a overexpression; BOE: NtMYC2b overexpression.
Inheritance of high nicotine content in T1
NtMYC2a and NtMYC2b overexpression lines
To further confirm the functions of both NtMYC2 genes and to determine the potential of inheritance of the elevated nicotine trait, T1 generation families were produced by self-pollination of AOE-3, AOE-6, BOE-16, BOE-17 and vector control T0 plants. T1 plants were grown in greenhouse for approximately two months and PCR was used to identify transgenic segregants. Leaf nicotine levels were determined in non-topped plants and plants ten days after topping. The results (Fig. 5) showed that non-topped NtMYC2a overexpression (AOE-3 and AOE-6) T1 generation plants had nicotine levels that were 134% higher than that of the vector control, while NtMYC2b overexpression plants (BOE-16 and BOE-17) exhibited 35% increase in nicotine content. Similar increases were observed in the topping treatment. Results were highly consistent with those observed in the T0 plants (Fig. 3), indicating inheritance of high-nicotine trait in these transgenic plants.
Figure 5
Leaf nicotine levels in T1 transgenic plants under non-topping or topping treatment.
DW%: dry weight percentage. Values are average of T1 transgenic plants (PCR positive, n = 15–30) with standard errors. Different letters indicate significant difference within each category (t-test, P < 0.05). VC: Vector Control; AOE: NtMYC2a overexpression; BOE: NtMYC2b overexpression.
In both the topped and non-topped treatments, nicotine levels of NtMYC2a overexpression plants were shown to be significantly greater than those of NtMYC2b overexpression plants (Student’s t-test, P < 0.0001), indicating these two closely-related paralogs function differentially to affect nicotine biosynthesis in tobacco.
Field performance of T2 and T3
NtMYC2 overexpression transgenic lines
To determine the effect of NtMYC2a and NtMYC2b overexpression on nicotine accumulation under field conditions, and to evaluate the possible effects of overexpression of these genes on overall plant performance, we carried out field experiments to compare vector control, two non-segregating NtMYC2a overexpression T2 lines (AOE-3–19, AOE-6-6) and two non-segregating NtMYC2b overexpression T2 lines (BOE-16-37, BOE-17-12). The field-grown transgenic lines exhibited no obvious phenotypic differences from vector control parental line, even though nicotine levels in AOE-3-19 and AOE-6-6 were significantly greater than the vector control (76% and 48% higher, for lines AOE-3-19 and AOE-6-6, respectively) (Student’s t-test, P < 0.05). The two NtMYC2b overexpression lines did not exhibit a significant increase in nicotine levels (Fig. 6).
Figure 6
Leaf nicotine levels of T2
NtMYC2 overexpression lines after topping in field.
Because the 35S:NtMYC2a construct exhibited a much greater impact on nicotine levels, we continued to evaluate the T3 generation of these NtMYC2a overexpression lines in the field. Again, very significant increases in nicotine levels were observed (Fig. 7) (58% and 56% higher, for lines AOE-3-19 and AOE-6-6, respectively). However, the cured leaf yields of these lines were reduced by 23% and 26%, respectively, as compared to the control. Although yields were decreased by about one fourth in both lines, the total nicotine production per hectare for the overexpression lines was still increased by 22% and 14%, respectively.
Figure 7
Leaf nicotine levels and yields of T3
NtMYC2a overexpression lines after topping in field.
DW%: dry weight percentage. Different letters indicate significant difference within each category (t-test, P < 0.05). VC: Vector Control; AOE: NtMYC2a overexpression.
The expression of nicotine synthetic genes was inhibited by nicotine
Previous studies showed that high levels of nicotine can be toxic to tobacconicotine-producing root cells, and maintenance of a relatively low cytoplasmic nicotine concentration is necessary for normal root cell functions2627. Since the expression of most nicotinesynthetic genes in NtMYC2a overexpression lines was down regulated, we further tested whether nicotine has a role in regulating the expression of its own synthetic genes. qRT-PCR results showed that the expression levels of all nicotinesynthetic genes were repressed to about one-half two hours after root treatment of tobacco seedlings with 0.4 mM exogenously applied nicotine (Fig. 8).
Figure 8
Expression of nicotine synthetic genes affected by exogenously supplied nicotine.
The expression level at 0 h was set to 1 and expression at other time points is shown relative to this level. Values are average of three replicates. The error bars indicate standard errors.
Discussion
Previous reports have indicated that expression of the major genes involved in nicotine biosynthesis was coordinately regulated to some extent by MeJA treatment282930. These findings prompted us to hypothesize that a major or master transcription factor related to the MeJA signaling pathway might exist to co-regulate the nicotinesynthetic genes for nicotine formation. Since overexpression of two key genes in the nicotine biosynthesis pathway (NtPMT1a and NtQPT2), individually or simultaneously, did not increase the nicotine content in cultivated tobacco, this leads to the suggestion that other key gene(s) might exist in the pathway and their expression might also need to be altered to substantially increase the nicotine accumulation in the tobacco plant16. In the current study, we attempted to identify a putative master transcription factor with the hope that this master transcription factor would regulate all the nicotinesynthetic genes, and that manipulation of the expression of this gene would help us achieve the goal of generating transgenic tobacco plants with elevated leaf nicotine accumulation.Although some transcription factors have been reported to positively regulate nicotine biosynthesis, none of them has been reported to increase the nicotine level in a field-grown, cultivated tobacco variety171924313233.To use a plant-based system for secondary metabolite production, greenhouse experiments can provide valuable initial information. Field testing is necessary, however, to determine the effect of a given technology because this is where crop plants are ultimately grown. Positive results in greenhouse environments may not always translate into similar results in actual field growing environments. In this study, we used tobacco cultivar NC95 to evaluate the potential of overexpression of NtMYC2a or NtMYC2b gene to increase the nicotine accumulation in field-grown tobacco.Constitutive overexpression of NtMYC2a and NtMYC2b was shown to significantly increase leaf nicotine levels in N. tabacum in T0 and T1 generation non-topped or topped greenhouse-grown plants (Figs 3 and 5). Consistent with these results, the T2 and T3 generations of the NtMYC2a overexpression lines exhibited increased nicotine concentrations in field testing, indicating that the high nicotine trait can be stably inherited (Figs 6 and 7). Results from the current study clearly show that NtMYC2a is more effective for increasing nicotine content than NtMYC2b.From an industrial perspective, both nicotine concentration and leaf yield are important for nicotine production. In the present study, we observed that the leaf yield of both T3
NtMYC2a overexpression lines decreased by approximately one-fourth. Indeed, there are reports of negative genetic correlations between yield and nicotine content in non-transgenic populations of N. tabacum34. The negative correlation could be caused by competition for plant resources necessary for both nicotine biosynthesis and tobacco plant growth such as nitrogen. If this is the case, increased nitrogen fertilizer application might partially alleviate the decreases in leaf yields. In our experiments, although leaf yields were decreased, the total nicotine yield per hectare in an AOE3 line was still 22% higher than would have otherwise been achieved using the non-transgenic tobacco control line.It was expected that the transcript levels of nicotinesynthetic genes would increase in the NtMYC2b and NtMYC2a overexpression T0 or T1 plants since nicotine levels were significantly increased. Our results indicated, however, that overexpression of NtMYC2b in transgenic tobacco plants did not lead to obvious increases in transcript levels of nicotinesynthetic genes in root tissues and the expression of all nicotinesynthetic genes was remarkably suppressed in NtMYC2a overexpression lines (Fig. 4). These observations are similar to a previous report that overexpression of NbbHLH2 reduced the transcript levels of most nicotinesynthetic genes while the nicotine levels were significantly increased in MeJA-treated transgenic plants17. Since nicotine was shown to retard tobacco root growth and so to be toxic to the tobacco root cell at relative high concentration26, and exogenously supplied nicotine reduced the activity of PMT in tobacco root at the time of decapitation35, we speculated that high level of nicotine may inhibit the expression of its own synthetic gene(s) to maintain it a reasonable level in tobacco root to ensure normal root cellular functions. To gain more insights, we performed a nicotine feeding experiment and the data (Fig. 8) showed that nicotine did down regulate the expression of its biosynthetic genes. Thus, a plausible explanation of down regulation of nicotinesynthetic genes’ expression in NtMYC2a overexpression plants is that, high levels of nicotine produced in the roots of transgenic plants may trigger negative feedback regulation on the expression of its synthetic genes. In a similar case, flavonol-dependent feedback inhibition of transcription of several flavonolsynthetic genes appears to prevent the accumulation of toxic non-glycosylated flavonols in Arabidopsis thaliana36.To achieve further increases in nicotine accumulation in tobacco leaves, strategies might be pursued to target the process of uploading of nicotine into the xylem and/or translocation and accumulation to leaf vacuoles. Recent research has revealed two vacuole-localized transporters responsible for the sequestering of nicotine into the vacuole of root and leaf (MATE1/2, NtJAT1) and one plasma membrane transporter (NUP1) responsible for importing nicotine from the apoplast into the cytoplasm of tobacco root cells52637. However, transporters responsible for loading of nicotine into the xylem in the root, root to shoot transportation, and unloading of nicotine into leaf cells remain unknown. Characterization of those transporters might be helpful to further enhance nicotine levels in tobacco leaves.In summary, we isolated two bHLH transcription factor genes, NtMYC2a and NtMYC2b, in this study. Overexpression of NtMYC2a was shown to substantially increase nicotine accumulation in the cultivated tobacco variety NC95. The high nicotine trait was stably inherited to the T1, T2 and T3 generations, and field tests showed that nicotine concentrations reached as high as 6.74% and 5.23% dry weight in tobacco leaves in the T2 and T3 generations of NtMYC2a overexpression lines, levels that were significantly higher than the controls. Together with the leaf yield data of T3 lines, as high as a 22% increase in total nicotine production per hectare was achieved in NtMYC2a overexpression lines, thus indicating a great potential of NtMYC2a overexpression in tobacco plants for industrial nicotine production.
Methods
Yeast one-hybrid experiments for cloning transcription factors
A yeast one-hybrid system, MatchmakerTM One-Hybrid Library Construction and Screening Kit (Clontech, Mountain View, CA, USA), was employed to screen for transcription factors that bind to the promoter of the tobaccoNtQPT2 gene. The promoter, 1034 bp in length, was cleaved from construct pTobRD2-PMTOX provided by 22nd Century, LLC (Buffalo, NY, USA), and inserted upstream of the GAL4 minimal promoter in vector pHIS2.1 to form the bait construct pTobHis.Total RNA was extracted from roots of two-month-old greenhouse-grown tobacco plants (cv. NC95) 0.5 h after topping and was used for cDNA preparation. Screening of positive colonies was performed according to the kit manual. Sequences of the cDNA inserts of positive colonies were used for BLAST analysis with the NCBI GenBank database to identify transcription factors.
Recovery of full-length cDNAs of the TFs
A GeneRacer kit (Invitrogen, Carlsbad, CA, USA) was used to obtain the missing 5′ sequences of the cDNAs following manufacturer’s instructions. The gene-specific primer used in RACE for NtMYC2 wasNtMYC2GSP: 5′-ACACATTTGGTACAACAGCTCTAAGTGC-3′.The primers designed to obtain the full-length coding sequences of NtMYC2a and NtMYC2b are listed in Supplementary Table S1.All PCR reactions were performed using high-fidelity Taq DNA polymerase (Phusion, Finnzymes, Espoo, Finland). PCR products were cloned into pCR-BluntII-TOPO or pCR4-TOPO vector (Invitrogen) for sequencing analysis.
Generation of transgenic tobacco plants for overexpression of the NtMYC2 genes
Binary vector pBI12138 was used as the backbone to produce NtMYC2a or NtMYC2b overexpression constructs. The coding sequences of the NtMYC2 genes were cleaved from their cloning vectors (pCR-BluntII-TOPO or pCR4-TOPO) and inserted into pBI121 to replace the GUS gene.Transgenic plants were produced from cv. NC95 by using standard Agrobacterium tumefaciens-based leaf disc transformation39. Initial primary transformants (T0) plants were grown in the greenhouse. T0 plants were self-pollinated to produce T1 generation plants that were tested the presence of transgene using vector specific 5′primer (GTGGCTCCTACAAATGCCATCA) and gene-specific 3′ primers (CAAACACAAGTTGCTTACTGG for NtMYC2a and CAAACACAAGTTGCTTACTAC for NtMYC2b). T1 plants were self-pollinated to produce the T2 generation, and non-segregating T2 lines were selected on MS medium containing 100 mg/L kanamycin (total 60 seeds, all germinated into healthy seedlings). Plants from non-segregating T2 lines were self-pollinated to produce T3 generation plants.For T0 and transgenic T1 plants grown in greenhouse without topping, leaf samples were collected just before flowering. For transgenic T1 plants with topping, leaf samples were collected ten days after topping (plants were topped immediately prior to flowering). From each plant, all leaves were collected, dried at 60 °C for three days and ground for nicotine quantification.
Tobacco seedlings treated with nicotine
The roots of tobacco plants (cv. Yunyan 87) at the four-leaf stage were immersed in a solution of 0.4 mM nicotine. Roots tissues were collected to investigate expression levels of genes involved in the nicotine biosynthesis pathway (NtPMT, NtQPT, NtMPO, NtA622, NtBBL, NtADC and NtODC) at the time points of 0 h, 0.5 h, 1 h, 2 h, 4 h and 6 h post-treatment.
Northern analysis of NtMYC2a/b expression in T0 plants
T0 tobacco plants were grown in greenhouse for about two months until just before flowering. Around 700 mg root tissue from each plant was used for RNA isolation. Total RNA was extracted by TRIzol (Invitrogen) according to the manufacturer’s manual. The extracted RNA was dissolved in DEPC treated water and quantified by Nanodrop (ND-1000, Thermo Fisher Scientific, Waltham, MA, USA). Ten μg RNA was separated on 1% agarose gel in MOPS buffer. The gel was stained with EtBr and the image was taken under UV. Separated RNA on the gel was blotted onto the Hybond-N+ nylon membrane (Amersham, Arlington Heights, IL, USA).The primers designed from the coding sequence of NtMYC2b for generating the probes for northern hybridization were:NtMYC2a/bNOR F: 5′-GAAGTAACGGATACTGAATGG-3′NtMYC2a/bNOR R: 5′-ATCCTTGTGTTTGCTGAGAAT-3′The probe is a 505 bp fragment which shares 94% nt identity to the corresponding region of NtMYC2a and thus used to test the transcript level of both NtMYC2 genes (NtMYC2a/b).
qRT-PCR analysis of nicotine synthetic genes expression
Root tissue was collected from T0 and T1 transgenic plants just before flowering. RNA was isolated from root tissue using TRIzol reagent (Invitrogen) according to the manufacturer’s manual and first strand cDNA was synthesized using SuperScript™ III Reverse Transcriptase (Invitrogen) with an oligo (dT) primer. qRT-PCR was performed using FastStart Universal SYBR Green Master (Rox) (Roche, Mannheim, Germany) on ABI7900 (Applied Biosystems, Foster City, CA, USA). The N. tabacum actin gene was used as a control for normalization. Three technical replicates were performed using the following PCR program: 50 °C for 1 min; 95 °C for 15 sec; 40 cycles of 95 °C for 15 sec followed by 63 °C for 1 min using the primers for nicotinesynthetic genes listed in Supplementary Table S2. For T0 plants, two transformation events per gene construct were analyzed. For T1 plants, two transgene positive plants from each T1 line and total four plants for each NtMYC2 gene overexpression construct were analyzed. For nicotine-treated tobacco seedlings, three plants from each time point were analyzed. The means and standard errors are presented.
Field tests of T2 and T3 generations of the NtMYC2 overexpression lines
Two NtMYC2a and two NtMYC2b non-segregating overexpression lines (T2 generation) were compared for nicotine levels in a field experiment relative to a vector control. The experimental design was a randomized complete block design with three replications and each plot consisting of 15 plants. Plants were topped immediately prior to flowering. Ten days after topping, the first priming was harvested. The following priming was harvested ten days after the previous one. All the leaves at the stalk position #10 (from the top to the bottom) from the second priming from each replicate were dried, ground, and analyzed for nicotine contents using methodologies described below.Similar field tests were performed to examine the performance of two T3
NtMYC2a overexpression lines in a replicated experiment using a randomized complete block design with four replications. Plots consisted of single 20-plant rows. Leaves were harvested in three separate harvests (primings) and flue-cured. Each priming was weighed to generate yield data. Fifty-gram cured leaf samples were prepared for each plot by compositing cured leaf from each priming on a weighted-mean basis for nicotine quantification.
Quantification of nicotine
Each sample was prepared by placing 0.2000 ± 0.0010 g of dried ground tobacco leaves into a 50 mL Erlenmeyer flask, and 2 mL of 2NNaOH solution was added to each flask and swirled to moisten the tobacco. After 15 min of rest, 10 mL of methyl tertiary butyl ether (MTBE) containing 0.1062 g/mL of quinoline was added to the flask. The flasks were placed on a shaker for 2.5 hrs. After shaking the flasks were allowed to sit overnight to separate. Approximately 1 mL of the top MTBE layer was transferred into a vial. GC analysis was conducted using a split injection (40:1) on an Agilent HP 6890 GC-FID (Agilent Technologies, Santa Clara, CA) using a 30 meter DB-5 MS column (0.53 mm ID and 1.5 μm film thickness). The carrier gas was helium at a linear velocity of approximately 38 cm/sec. The injector and detector were both set at 250 °C. The analysis consists of a temperature program from 110 °C initially held for 0.5 min followed by a ramp to 280 °C at a rate of 25 °C/min where the final temperature was held for 20 min. Data were collected and analyzed using Agilent Chemstation software. A multipoint internal standard calibration table was constructed for nicotine.
Statistical analysis
Two-tailed Student’s t-tests were performed for comparisons of any two groups within each experiment. Probability values of <0.05 were considered statistically significant.
Additional Information
How to cite this article: Wang, B. et al. Genetic Factors for Enhancement of Nicotine Levels in Cultivated Tobacco. Sci. Rep. 5, 17360; doi: 10.1038/srep17360 (2015).
Authors: Marta T Sears; Hongbo Zhang; Paul J Rushton; Martin Wu; Shengcheng Han; Anthony J Spano; Michael P Timko Journal: Plant Mol Biol Date: 2013-08-11 Impact factor: 4.076
Authors: Melkamu G Woldemariam; Son Truong Dinh; Youngjoo Oh; Emmanuel Gaquerel; Ian T Baldwin; Ivan Galis Journal: BMC Plant Biol Date: 2013-05-01 Impact factor: 4.215