Literature DB >> 26612680

Crystal Structure and Comparative Sequence Analysis of GmhA from Colwellia psychrerythraea Strain 34H Provides Insight into Functional Similarity with DiaA.

Hackwon Do1, Ji-Sook Yun2, Chang Woo Lee1,3, Young Jun Choi2, Hye-Yeon Kim4, Youn-Jung Kim5, Hyun Park1,3, Jeong Ho Chang2, Jun Hyuck Lee1,3.   

Abstract

The psychrophilic organism Colwellia psychrerythraea strain 34H produces extracellular polysaccharide substances to tolerate cold environments. Sedoheptulose 7-phosphate isomerase (GmhA) is essential for producing d-glycero-d-mannoheptose 7-phosphate, a key mediator in the lipopolysaccharide biosynthetic pathway. We determined the crystal structure of GmhA from C. psychrerythraea strain 34H (CpsGmhA, UniProtKB code: Q47VU0) at a resolution of 2.8 Å. The tetrameric structure is similar to that of homologous GmhA structures. Interestingly, one of the catalytic residues, glutamate, which has been reported to be critical for the activity of other homologous GmhA enzymes, is replaced by a glutamine residue in the CpsGmhA protein. We also found differences in the conformations of several other catalytic residues. Extensive structural and sequence analyses reveal that CpsGmhA shows high similarity to Escherichia coli DnaA initiator-associating protein A (DiaA). Therefore, the CpsGmhA structure reported here may provide insight into the structural and functional correlations between GmhA and DiaA among specific microorganisms.

Entities:  

Keywords:  Colwellia psychrerythraea strain 34H; CpsGmhA; DiaA; psychrophile; sedoheptulose 7-phosphate isomerase

Mesh:

Substances:

Year:  2015        PMID: 26612680      PMCID: PMC4697000          DOI: 10.14348/molcells.2015.0191

Source DB:  PubMed          Journal:  Mol Cells        ISSN: 1016-8478            Impact factor:   5.034


INTRODUCTION

Psychrophilic organisms are cold-adapted microorganisms that have overcome the constraints associated with living in permanently cold environments (Pikuta et al., 2007; Russell, 1990). Cold environments can induce molecular changes in an organism, including abnormalities such as low enzymatic activity, protein denaturation, and mis-folding of proteins (Russell, 1998). In order to overcome these deficiencies, several cold-adaptation mechanisms have been described, including cold-active enzymes, an unsaturated fatty-acid membrane, anti-freeze proteins, and sugar and/or alcohol compounds such as glycerol, trehalose, and sorbitol (Chattopadhyay, 2006; Feller, 2013; Feller and Gerday, 2003). One of the most interesting cold-adaptation mechanisms is biofilm formation using extracellular polysaccharide substances (EPSs) that are found in the O-antigen component of lipopolysaccharides (LPS) and cell-bound polysaccharides (Bazaka et al., 2011). The EPSs play important temperature-buffering and cryoprotectant roles in cold-adapted microorganisms (Bazaka et al., 2011; Krembs et al., 2002). The psychrophilic bacterium Colwellia psychrerythraea strain 34H is a well-known producer of EPSs, which function as cryoprotectants (Marx et al., 2009). Increased production of EPSs is observed when samples are frozen from −8 to −14°C, which represents a strategy similar to that used by yeasts that increase the production of cryoprotectants (polyols and/or sugar alcohol) in response to osmotic stress (Marx et al., 2009; Shen et al., 1999). Recently, the molecular structure of capsular polysaccharides synthesized from C. psychrerythraea strain 34H was determined and characterized. Interestingly, it resembles other known antifreeze (Glyco) proteins and appears to inhibit ice recrystallization (Carillo et al., 2015). C. psychrerythraea strain 34H was initially isolated from Arctic marine sediments (Huston et al., 2000). The temperature of growth ranges from −12°C to 19°C and its optimal growth temperature is 8°C to 9°C (Wells and Deming, 2006). The results of genomic sequence analyses show that many gene products of C. psychrerythraea strain 34H play a role in the production and secretion of EPSs (Methe et al., 2005). These EPSs stabilize an extracellular protease, ColAP, against thermal denaturation (Huston et al., 2004). In addition, EPSs are involved in regulating intracellular biosynthetic reactions to proceed at extremely low temperatures; however, the external conditions that activate the production of EPSs remain unknown (Junge et al., 2006). Gram-negative bacteria, including C. psychrerythraea strain 34H, contain either LPS or capsular polysaccharides (CPSs) in their outer membrane. Typical LPS is comprised of three covalently linked domains: lipid A, core oligosaccharide, and, in some bacteria, O-antigen. The core oligosaccharide is composed of inner and outer domains; the inner core contains 3-deoxy-d-manno-oct-2-ulosonic acid (Kdo), which is bound to lipid A, and L-glycero-d-manno heptose (heptose), which is linked to 3-deoxy-d-manno-oct-2-ulosonic acid (Brooke and Valvano, 1996; Nikaido, 2003; Raetz and Whitfield, 2002). Heptose is the connecting point for the variable outer-core saccharides that serve as the binding sites for O-antigen to produce complete LPS. Sedoheptulose 7-phosphate isomerase (GmhA), encoded by gmhA, catalyzes the conversion of sedoheptulose 7-phosphate (S7P) to d-glycero-d-mannoheptose 7-phosphate (M7P) in the first step of the heptose biosynthesis pathway (Kneidinger et al., 2001). Aberrant GmhA in Escherichia coli does not synthesize heptose and produces truncated LPS owing to the lack of a connecting point for more distal moieties (Brooke and Valvano, 1996). The structure and catalytic mechanisms of GmhA from various species have been characterized because GmhA is considered an important target for antibiotic development (Harmer, 2010; Kim and Shin, 2009; Seetharaman et al., 2006; Taylor et al., 2008). In this study, we determined the crystal structure of GmhA from C. psychrerythraea strain 34H (CpsGmhA), which is critical for LPS biosynthesis and activity, and is potentially maintained at low temperatures for production of polysaccharides. In addition, sequence analysis reveals that CpsGmhA has high similarity with E. coli DnaA initiator-associating protein A (DiaA). Therefore, characterization of the structure of CpsGmhA may provide insight into the structural and functional correlations between GmhA and DiaA among microorganisms; additionally, comparisons of these proteins in mesophilic and psychrophilic organisms may help to elucidate the mechanism of low temperature-adapted enzymes.

MATERIALS AND METHODS

Cloning, protein expression, and purification

The gene encoding GmhA protein (UniProtKB code: Q47VU0, amino acids 1–196) was amplified by polymerase chain reaction (PCR) from the genomic DNA of C. psychrerythraea strain 34H and subcloned into the pET 28a(+) vector (Novagen, USA). PCR amplification of the gene was performed using primers containing NdeI and XhoI restriction enzyme sites: forward primer 5′- CGATAACATATGCTAGAACAGATCAAAAAC-3′ and reverse primer 5′- CGATAACTCGAGTCATGAATCACCTTGCG GGAA-3′. E. coli BL21(DE3) cells were transformed with the cloned pET 28a(+) vector, which contains an N-terminal 6-histidine (His) tag and a thrombin cleavage site. The E. coli cells were grown at 37°C until the cultures reached an optical density of approximately 0.7 at 600 nm. Heterologous expression of the target protein was induced using 1 mM isopropyl-β-d-thiogalactopyranoside (Bioneer, Korea) at 25°C overnight, and the expressed protein was collected by centrifugation at 7000 rpm for 20 min. The cell pellet was resuspended in lysis buffer (50 mM sodium phosphate [pH 8.0], 300 mM NaCl, and 5 mM imidazole) containing phenylmethane sulfonyl fluoride and disrupted by sonication (Vibra-Cell VCX400; Sonics & Materials, Inc., USA). Ni-NTA affinity resin (Clontech, USA) pre-equilibrated with lysis buffer was used to purify of the target protein. After washing the column and matrix with a ten-column volume of washing buffer (50 mM sodium phosphate [pH 8.0], 300 mM NaCl, and 35 mM imidazole), the His-tagged protein was eluted using a solution of the same composition but with 300 mM imidazole. Once the His tag was cleaved at 4°C overnight with thrombin (Sigma-Aldrich, USA), the resulting protein has an additional GSHM sequence at the N-terminus, an artifact of the cloning. The cleaved protein was loaded onto a Superdex-200 column (GE Healthcare, USA) equilibrated with 20 mM Tris-HCl (pH 8.0), 150 mM NaCl, and 1 mM dithiothreitol (DTT). The fractions containing CpsGmhA were collected and concentrated to 25.0 mg/ml for crystallization trials.

Crystallization, data collection, and structural determination

The purified CpsGmhA was subjected to an initial crystallization screen using the commercially available crystallization solution kits MCSG I–IV (Microlytic, USA), Wizard Classic I–IV (Emerald Bio, USA), and Classics and Classics II Suite (Qiagen, Germany), following the vapor diffusion method by mixing the protein (0.8 μl) and reservoir (0.8 μl) solutions. Small crystal granules were obtained within two or three days in 0.1 M Tris-HCl (pH 8.5), 0.2 M magnesium chloride, and 30% (v/v) PEG400 or 25% (w/v) PEG3350. The optimum crystallization condition was further refined. Flat hexagonal crystals suitable for X-ray data collection were formed in a hanging drop composed of 1 μl of CpsGmhA (25.0 mg/ml), 20 mM Tris-HCl, 150 mM NaCl, and 1 mM DTT, and 1 μl of reservoir solution in 0.1 M Tris-HCl (pH 7.2), 0.2 M magnesium chloride, and 19% (v/v) PEG400 against 500 μl reservoir. N-paratone was used as a cryoprotectant based on the results of a screening experiment. A native data set was collected at 0.97951 Å at the 5C beamline of the Pohang Light Source (PLS; Korea). The data were recorded, integrated, and scaled using iMosflm software (Battye et al., 2011). In order to obtain the phase, molecular replacement (MR) was performed using the program MOLREP (Vagin and Teplyakov, 2009), using the homologous structure from E. coli DiaA (PDB databank accession number 2YVA; (Keyamura et al., 2007) as the model. A Matthews coefficient of 2.22 and 44.59% solvent indicated that one molecule was present in an asymmetric unit. After refinement up to 2.8 Å with REFMAC5 (Murshudov et al., 2011), the quality of the final structure was validated using the MOLPROBITY server (Chen et al., 2009) and SFCHECK from the CCP4 package (Vaguine et al., 1999), resulting in a final model with an R-factor of 21.0% (Rfree 28.0%). The final refinement statistics are presented in Table 1. Figures and the surface and angle data were generated and calculated using PyMOL (DeLano, 2002).
Table 1.

X- Ray data collection and refinement statistics for CpsGmhA

CpsGmhA
Data collection
  X-ray sourcePLS-5C
  Space groupC222
  Unit-cell parameters (Å)a = 73.3, b = 109.3, c = 44.3
  Wavelength (Å)0.97951
  Resolution Range (Å)44.3–2.8 (2.95–2.80)
  No. of observed reflections54978 (8311)
  No. of unique reflections4643 (671)
  Completeness (%)99.9 (100)
  Redundancy6.4 (6.5)
  Rmergea0.136 (0.315)
  I/σ13.0 (7.3)
Refinement
  Resolution range44.3–2.8 (3.53–2.80)
  Reflections: working/free4643/215
  Rcrystb0.210 (0.234)
  Rfreec0.280 (0.341)
  Ramachandran plot:
  favored/ allowed/disallowed (%) d94.8/5.2/0
  R.m.s.d. bonds (Å)0.001
  R.m.s.d. angles (°)0.381
PDB accession code5BY2

R = ∑| − I|/∑.

R = ∑ | |Fo| − |Fc| |/ ∑|Fo|.

R calculated with 5% of all reflections excluded from refinement stages using high-resolution data.

The Ramachandran plot was calculated using MolProbity (http://molprobity.biochem.duke.edu/). Values in parentheses indicate the statistics for the highest resolution shells.

Sequence analysis

The amino acid sequences of GmhA and DiaA from C. psychrerythraea strain 34H and other relevant species were obtained from the National Center for Biotechnology Information (NCBI) database (Table 2). Amino acid sequences were aligned using Clustal X (Chenna et al., 2003). Only well-aligned and conserved alignment sites were extracted from each alignment subset using Gblock (Castresana, 2000). Maximum likelihood (ML) analysis was carried out using RAxML Ver. 7.2.8 (Stamatakis, 2006). RAxML was run under the options GTRCAT and protein GAMMA, a complete random starting tree of 1000 bootstrap replicates (Pattengale et al., 2010).
Table 2.

Sequence information of the consensus cladogram

ProteinSpeciesNCBI reference sequence
GmhAColwellia psychrerythraeaQ47VU0.1
Escherichia coliNP_308276.1
Campylobacter jejuniWP_002858021.1
Pseudomonas aeruginosaWP_016253868.1
Burkholderia pseudomalleiWP_011205222.1
Vibrio choleraWP_000284054.1
Leptospira alstoniiWP_020772754.1
Helicobacter pyloriWP_042636128.1
Haemophilus influenzaWP_005663828.1
Bordetella bronchisepticaKFJ54879.1
Neisseria meningitidesWP_002242076.1
DiaAColwellia psychrerythraeaWP_033091889.1
Yersinia enterocoliticaWP_005174225.1
Pseudomonas aeruginosaWP_025299231.1
Vibrio choleraWP_032476931.1
Escherichia coliWP_004018383.1
Yersinia pestisWP_002210146.1
Franconibacter pulverisWP_024559311.1
Salmonella entericaWP_000893482.1
Pluralibacter gergoviaeWP_043080845.1
Erwinia toletanaWP_017801381.1
Ewingella americanaWP_034786756.1
Pseudomonas syringaeWP_032629664.1

Data deposition

The atomic coordinates and experimental structure have been deposited in the Protein Data Bank (accession codes 5BY2).

RESULTS

Overall structure

The GmhA from C. psychrerythraea strain 34H (CpsGmhA), including the additional serine-histidine residues located before the N-terminus as an artifact of cloning, was crystallized and the structure was determined by X-ray crystallography at a resolution of 2.8 Å. The monomeric structure is composed of five central parallel β-sheets surrounded by six α-helices (Fig. 1A). Most residues fit well in the electron density except for residues Tyr93, Gln94, Gln193, Gly194, Asp195, and Ser196. The final model was refined to R and Rfree values of 21.0% and 28.0%, respectively (Table 1). The overall topology of CpsGmhA is very similar to that of the homologous structures from various species, with an average root mean square deviation (r.m.s.d.) of 1.3 Å in monomeric Cα (Harmer, 2010; Kim and Shin, 2009; Seetharaman et al., 2006; Taylor et al., 2008). Since one molecule of CpsGmhA was observed in the asymmetric unit, we performed a size exclusion chromatographic analysis. The result indicates that CpsGmhA also exists in tetrameric form in solution, which is in agreement with the results of previous studies (Harmer, 2010; Taylor et al., 2008) (Fig. 1B).
Fig. 1.

Overall structure of CpsGmhA. (A) The overall structure of the monomeric CpsGmhA is shown as a cartoon representation. The α-helices, β-sheets, and loops are colored in green, brown, and grey, respectively. (B) Size exclusion chromatogram of CpsGmhA for the measurement of molecular weight. The estimated molecular weight is 84 kDa based on the standard (STD), whereas the calculated molecular weight of the monomer is 20.9 kDa. (C) The overall structure of tetrameric CpsGmhA viewed from the top. The four monomers are colored green, yellow, cyan, and magenta, respectively. The active sites are marked with red dotted lines. The black arrows indicate the clamp helical regions. The black dashed hexagon indicates the overall shape by interactions of the α1 helices. (D) Side view of the CpsGmhA tetramer by 90° rotation over an X-axis from Fig. 1C.

The bulk of helices (α1-α4 and α6) form a tetramer with a broad surface range. Half of the long N-terminal α1 helix interacts with the same region of the neighboring monomers via the hydrophobic residues Met1, Leu2, Ile5, Phe9, Ile13, Ile17, and Ile27, resulting in a four-helix frame around the tetramer (Figs. 1C and 1D). The four α1-helices in the tetramer form a hexagon tilted at an angle of 120°, which could be important for structural stabilization, because the four α1-helices surrounding the tetramer have broad contacting surfaces that serve as clamps on each of the two subunits (Fig. 1C). Extensive interactions with neighboring molecules support the order of the α3 helix, such that the overall shape has a closed conformation in comparison with homologous structures (see below) (Harmer, 2010; Taylor et al., 2008).

Active site

The active site of GmhA is mainly composed of four α-helices, which are each composed of two equivalent helices (α2–α6 and α2′–α6′) from two subunits. In addition, the conserved residues on the α3 helix and the three loops (β1–α2, α2–β2, and β3–α5) support the conformation of the active site (Fig. 2A). The E-Q-H residues, which are located at the α2, α6′, and α6 helices, respectively, are strongly involved in catalytic reactions. The E-QH residues are highly conserved in the GmhA family; however, the glutamate residue is replaced by glutamine at the equivalent position in CpsGmhA (Fig. 2A). Previous mutagenesis studies have shown no GmhA activity in EQ mutants (Harmer, 2010; Taylor et al., 2008), suggesting that CpsGmhA might be more closely related to DiaA this inference is supported by the bioinformatic analysis (see below).
Fig. 2.

Active site of CpsGmhA. (A) Structure-based multiple sequence alignment of CpsGmhA with other homologs. Conserved residues are presented in either orange or yellow backgrounds depending on their degree of conservation. The residues composed of the active site are indicated with red rectangles under the sequences. The catalytic residues are marked with open circles. The secondary structure was generated based on the structure of CpsGmhA. Sequences were aligned using Clustal X 2.1 (Chenna et al., 2003) and photographs were generated using the program ESPript (Gouet et al., 1999). (B) Overlay of the catalytic residues of CpsGmhA with those of BpGmhA (PDB id: 2X3Y) and CjGmhA (PDB id: 1TK9). The colors of CpsGmhA are the same as those described for Fig. 1C. BpGmhA and CjGmhA are colored in yellow and grey, respectively. The yellow sphere indicates the zinc ion present in the BpGmhA structure. Oxygen and nitrogen atoms are shown in red and blue, respectively. (C) Overlay of the catalytic residues of CpsGmhA with EcGmhA (PDB id: 2I2W), which is shown in grey.

The tetrameric structures of GmhA can be classified into two distinct conformations, open or closed, depending on whether an additional α3′ helix is present in the central region. The closed conformation may allow for the ingress and egress of a substrate and product in solution due to the extension of the solvent accessible area of the active site (Harmer, 2010). Since the conformation of CpsGmhA is closed, we compared the positions of the catalytic residues to those in other GmhAs with closed conformation from Burkholderia pseudomallei and Campylobacter jejuni (Fig. 2B). Most residues are oriented in a similar manner, except for the Glu63 residue of C. jejuni GmhA (CjGmhA), which is equivalent to the Gln62 residue in CpsGmhA. However, in comparison with those of the E. coli GmhA (EcGmhA), conformations of the catalytic residues are not well overlaid (Fig. 2C). In particular, the conformation of the Asp94 residue, which is equivalent to Asp92 in CpsGmhA, is quite different in that it faces the opposite side to Asp92. In addition, the positions of the Glu65 and Gln172 residues (equivalent to Gln62 and Gln172 of CpsGmhA, respectively) are different. Therefore, the conformations of the catalytic residues are affected by whether or not the overall structure is an open or closed conformation.

Comparison with homologous GmhA structures

Conformational differences between the open and closed may be because of the binding of the product to the active site. For example, the open-conformation structure of PaGmhA is converted to a closed structure by M7P binding (Taylor et al., 2008) (Fig. 3A). M7P binding drives the α4 helix to move away from the central cavity, resulting in a disordered α3 helix as a result of its interaction with the α2 of the other subunit. However, the B. pseudomallei and E. coli GmhA structures are not changed upon product or substrate binding (Harmer, 2010; Taylor et al., 2008) (Figs. 3B and 3C). In addition, the open conformations of EcGmhA and PaGmhA are slightly different in that the α2 and α6 helices in EcGmhA are tilted outwards at 25° and 15°, respectively (Fig. 3D). Therefore, the two pairs of subunits in EcGmhA are not symmetric, and the three different GmhA structures exist in two open states and one closed state (Fig. 3D). Taken together, no correlations are currently evident between the open and closed conformation and the structures.
Fig. 3.

Comparison of GmhA homologous structures. (A) Overlay of the apo and M7P product-bound GmhA structures from P. aeruginosa. The PaGmhA-M7P complex (PDB id: 1X92) and apo PaGmhA (PDB id: 3BJZ) are shown in pink and grey, respectively. The M7P molecules are shown in black with the phosphorous and oxygen atoms in yellow and red, respectively. (B) Overlay of the apo and M7P product-bound GmhA structures from B. pseudomallei. The BpGmhA-M7P complex (PDB id: 2XBL) and apo BpGmhA (PDB id: 2X3Y) are shown in blue and grey, respectively. (C) Overlay of the apo and substrate S7P-bound GmhA structures from E. coli. The EcGmhA-S7P complex (PDB id: 2I22) and apo EcGmhA (PDB id: 2I2W) are shown in orange and grey, respectively. The S7P molecules are shown in blue. (D) Overlay of the apo structures of CpsGmhA (green), PaGmhA (pink) and EcGmhA (orange). The tilted α2 and α6 helices of EcGmhA are presented in the black squares.

Similarity between CpsGmhA and EcDiaA

We searched for structural homologs of CpsGmhA using the DALI server system and found that DiaA from E. coil (EcDiaA) has high similarity to GmhA, with a Z-score of 32.7 (Holm and Rosenstrom, 2010). DiaA is essential for the accurate initiation and precise timing of chromosomal replication during the cell cycle (Ishida et al., 2004). Thus, DiaA directly and specifically interacts with DnaA independent of nucleotides or DNA (Ishida et al., 2004; Keyamura et al., 2007). Moreover, the structure of DiaA shows similarity with the DnaA-binding protein HobA from Helicobacter pylori (HpHobA) (Natrajan et al., 2007). Based on this structural information, we compared the protein sequences and found that the catalytic glutamate residues are variable, with Gln (CpsGmhA), Ser (EcDiaA), and Asn (HpHobA) being observed at catalytic sites (Fig. 4A). In addition, the other catalytic residues are varied and HobA has no identical residues. Given the difference in the catalytic residues of HpHobA, we compared the conformations of the catalytic residues among CpsGmhA, EcGmhA, and EcDiaA (Fig. 4B). The conformation of the catalytic residues between CpsGmhA and EcDiaA is much more similar than that of other pairs of compared proteins because the two residues Glu65 and Gln172 are differently oriented. This result indicates that CpsGmhA and EcDiaA are closely related.
Fig. 4.

Comparison of GmhA and DiaA structures. (A) Multiple sequence alignment of CpsGmhA, CpsDiaA, EcGmhA, EcDiaA, and HpHobA. Conserved residues are presented in either orange or yellow background according to the degree of conservation. The catalytic residues are indicated in red. The residues known to be involved in DnaA binding are presented in blue. (B) Overlay of the catalytic residues of CpsGmhA (green), EcGmhA (yellow), and EcDiaA (pink). Each of the residue numbers are indicated by their corresponding colors. (C) Overlay of the overall structures of CpsGmhA and EcDiaA. CpsGmhA and EcDiaA are shown in green and pink, respectively.

Next, we compared the structural similarity among the four structures. Structural comparisons show that CpsGmhA has higher similarity to EcDiaA with a r.m.s.d of 0.7 Å, but relatively low similarity to both EcGmhA and HpHobA with an r.m.s.d of 1.7 Å and 3.7 Å, respectively. Thus, the overall tetrameric structures of CpsGmhA and EcDiaA are completely overlaid (Fig. 4C). To investigate the sequence-based relationship between CpsGmhA and CpsDiaA, we performed a phylogenetic analysis of GmhA and DiaA (Fig. 5). GmhA and DiaA could be divided into two distinct groups. However, we found that GmhA and DiaA from C. psychrerythraea and Pseudomonas aeruginosa are not clearly separated. Indeed, GmhA and DiaA from the two species showed over 98% similarity because they differ in only two or three residues. This result indicates that PaDiaA could be classified as an isotype of PaGmhA and CpsGmhA as an isotype of CpsDiaA. Taken together, the structural and sequence similarities of CpsGmhA, CpsDiaA and EcDiaA may provide insight into the functional role of GmhA as an isotype of DiaA in C. psychrerythraea.
Fig. 5.

Phylogenetic analysis of GmhA and DiaA. Phylogenetic relationships of DiaA and GmhA based on their amino acids. The consensus cladogram inferred from the amino acid sequence data of DiaA and GmhA using maximum likelihood (ML) analysis under GTRCAT and protein GAMMA models. The group of DiaA is highlighted in red color. The paired GmhA and DiaA from C. psychrerythraea and P. aeruginosa are highlighted in sky blue. The numbers above the branches indicate bootstrap percentages.

DISCUSSION

To date, eight crystal structures of GmhA have been reported from various mesophilic species (Harmer, 2010; Kim and Shin, 2009; Seetharaman et al., 2006; Taylor et al., 2008). The overall structures are divided into two forms: open and closed. The conformations of the apo-structures are also variable in that the GmhAs of E. coli, Vibrio cholera, and P. aeruginosa are open, whereas those of B. pseudomallei, C. jejuni, and C. psychrerythraea are closed. The overall structure of psychrophilic CpsGmhA is very similar to the homologous structures of the closed forms. Previous studies of GmhA crystal structures demonstrate that either two or four molecules are contained in the asymmetric unit. However, only one molecule of CpsGmhA was found in the asymmetric unit. The biologically reliable tetrameric structure was revealed by the C222 symmetry operation. Additional analysis of oligomerization using the program PDBePISA (v1.47) further indicated that biological assembly of the protein results in a tetramer (Krissinel and Henrick, 2007). The reaction mechanisms of GmhA have been proposed by complex structures with either product or substrate (Harmer, 2010; Taylor et al., 2008). To date, there have been three GmhA complex structures reported in either substrate form or product-bound form. The substrate S7P is only present in the EcGmhA structure as an open conformation, and the product M7P is found bound in closed structures from P. aeruginosa and B. pseudomallei (Harmer, 2010; Taylor et al., 2008). Moreover, only one subunit of the tetrameric EcGmhA contains the substrate S7P, whereas BpGmhA and PaGmhA both have M7P products in each of the four subunits (Fig. 4C). Thus, the two subunits are not symmetrical about the vertical axis, as is the case with other GmhA structures. This may indicate that a local conformational change occurs upon substrate binding. However, there was no difference in symmetry between the protein and its apo-structure. On the other hand, it is also likely that a change in only one molecule of the substrate would not induce an overall conformational change. As shown in the previous section, only CpsGmhA contains a catalytic glutamine, rather than a glutamate residue at the equivalent position (Gln62) in the active site. Therefore, CpsGmhA may not have isomerase activity, based on mutagenesis data reported previously (Harmer, 2010; Taylor et al., 2008). Furthermore, based on sequence identity, CpsGmhA is more closely related to EcDiaA (62.2% identical) than to EcGmhA (37% identical) or HpHobA (13.9% identical). Interestingly, CpsGmhA has the two signature residues, Leu190 and Phe191, in common with those of EcDiaA, which are critical for DnaA binding, whereas EcGmhA does not contain these residues (Fig. 5A) (Keyamura et al., 2007). In addition, there are only three residue discrepancies between CpsGmhA and CpsDiaA, and therefore no significant functional differences would be expected. Since a functional study of CpsGmhA has not yet been done, we propose that the CpsGmhA protein could be a putative isotype of CpsDiaA. Taken together, further investigation of CpsGmhA is required to confirm the functional similarity with CpsDiaA.
  37 in total

1.  Selection of conserved blocks from multiple alignments for their use in phylogenetic analysis.

Authors:  J Castresana
Journal:  Mol Biol Evol       Date:  2000-04       Impact factor: 16.240

2.  SFCHECK: a unified set of procedures for evaluating the quality of macromolecular structure-factor data and their agreement with the atomic model.

Authors:  A A Vaguine; J Richelle; S J Wodak
Journal:  Acta Crystallogr D Biol Crystallogr       Date:  1999-01-01

3.  Biosynthesis of nucleotide-activated D-glycero-D-manno-heptose.

Authors:  B Kneidinger; M Graninger; M Puchberger; P Kosma; P Messner
Journal:  J Biol Chem       Date:  2001-03-28       Impact factor: 5.157

Review 4.  Molecular basis of bacterial outer membrane permeability revisited.

Authors:  Hiroshi Nikaido
Journal:  Microbiol Mol Biol Rev       Date:  2003-12       Impact factor: 11.056

5.  RAxML-VI-HPC: maximum likelihood-based phylogenetic analyses with thousands of taxa and mixed models.

Authors:  Alexandros Stamatakis
Journal:  Bioinformatics       Date:  2006-08-23       Impact factor: 6.937

Review 6.  Molecular adaptations in psychrophilic bacteria: potential for biotechnological applications.

Authors:  N J Russell
Journal:  Adv Biochem Eng Biotechnol       Date:  1998       Impact factor: 2.635

7.  iMOSFLM: a new graphical interface for diffraction-image processing with MOSFLM.

Authors:  T Geoff G Battye; Luke Kontogiannis; Owen Johnson; Harold R Powell; Andrew G W Leslie
Journal:  Acta Crystallogr D Biol Crystallogr       Date:  2011-03-18

Review 8.  Cold adaptation of microorganisms.

Authors:  N J Russell
Journal:  Philos Trans R Soc Lond B Biol Sci       Date:  1990-01-30       Impact factor: 6.237

9.  MolProbity: all-atom structure validation for macromolecular crystallography.

Authors:  Vincent B Chen; W Bryan Arendall; Jeffrey J Headd; Daniel A Keedy; Robert M Immormino; Gary J Kapral; Laura W Murray; Jane S Richardson; David C Richardson
Journal:  Acta Crystallogr D Biol Crystallogr       Date:  2009-12-21

Review 10.  Psychrophilic enzymes: from folding to function and biotechnology.

Authors:  Georges Feller
Journal:  Scientifica (Cairo)       Date:  2013-01-17
View more
  6 in total

Review 1.  Discovery, Molecular Mechanisms, and Industrial Applications of Cold-Active Enzymes.

Authors:  Margarita Santiago; César A Ramírez-Sarmiento; Ricardo A Zamora; Loreto P Parra
Journal:  Front Microbiol       Date:  2016-09-09       Impact factor: 5.640

2.  A half-site multimeric enzyme achieves its cooperativity without conformational changes.

Authors:  Mirella Vivoli; Jiayun Pang; Nicholas J Harmer
Journal:  Sci Rep       Date:  2017-11-28       Impact factor: 4.379

3.  Functional and structural studies on the Neisseria gonorrhoeae GmhA, the first enzyme in the glycero-manno-heptose biosynthesis pathways, demonstrate a critical role in lipooligosaccharide synthesis and gonococcal viability.

Authors:  Igor H Wierzbicki; Ryszard A Zielke; Konstantin V Korotkov; Aleksandra E Sikora
Journal:  Microbiologyopen       Date:  2017-01-07       Impact factor: 3.139

4.  Structural basis of small RNA hydrolysis by oligoribonuclease (CpsORN) from Colwellia psychrerythraea strain 34H.

Authors:  Chang Woo Lee; Sun-Ha Park; Chang-Sook Jeong; Sun-Shin Cha; Hyun Park; Jun Hyuck Lee
Journal:  Sci Rep       Date:  2019-02-25       Impact factor: 4.379

5.  Structural and functional characterization of M. tuberculosis sedoheptulose- 7-phosphate isomerase, a critical enzyme involved in lipopolysaccharide biosynthetic pathway.

Authors:  Sumita Karan; Bhanu Pratap; Shiv Pratap Yadav; Fnu Ashish; Ajay K Saxena
Journal:  Sci Rep       Date:  2020-11-30       Impact factor: 4.379

Review 6.  Enzymes from Marine Polar Regions and Their Biotechnological Applications.

Authors:  Stefano Bruno; Daniela Coppola; Guido di Prisco; Daniela Giordano; Cinzia Verde
Journal:  Mar Drugs       Date:  2019-09-23       Impact factor: 5.118

  6 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.