Literature DB >> 26611338

Hyaluronate lyase activity of Streptococcus suis serotype 2 and modulatory effects of hyaluronic acid on the bacterium's virulence properties.

Bruno Haas1, Katy Vaillancourt2, Laetitia Bonifait3, Marcelo Gottschalk4,5, Daniel Grenier6,7.   

Abstract

BACKGROUND: Streptococcus suis serotype 2 is a major swine pathogen and zoonotic agent worldwide causing mainly meningitis and septicemia. Hyaluronate lyases are enzymes that degrade hyaluronic acid, a major constituent of animal tissues, and have been reported as virulence factors in various bacterial species. Since the hyaluronate lyase of S. suis has been considered ambiguously as a virulence factor, we screened 50 isolates from the three major clonal complexes found in North America (sequence type [ST] 1, ST25, and ST28) known to differ in their degree of virulence in order to link the presence or absence of this activity with the degree of virulence. Moreover, the effect of exogenous hyaluronic acid on S. suis virulence factor gene expression and the pro-inflammatory response of brain macrovascular endothelial cells (BMEC) was also investigated.
RESULTS: We found that all but one ST1 isolates (high virulence) were devoid of hyaluronate lyase activity whereas all ST25 (intermediate virulence) and ST28 (low virulence) isolates possessed the activity. A 2 bp insertion was responsible for the lack of activity in ST1 strains. Since the most virulent isolates did not degrade hyaluronic acid, this tissue component may be found during the infectious process. Therefore, we investigated its effect on S. suis and host cells. Hyaluronic acid was found to modulate S. suis adhesion to BMEC, to increase S. suis virulence factor expression, and to enhance pro-inflammatory cytokine secretion by BMEC.
CONCLUSIONS: These findings suggest that S. suis hyaluronate lyase does not represent a critical virulence factor in its active form. However, exogenous hyaluronic acid that is likely to interact with S. suis and host cells during the course of infection appears to modulate several virulence determinants of the bacterium, in addition to promote inflammation.

Entities:  

Mesh:

Substances:

Year:  2015        PMID: 26611338      PMCID: PMC4662036          DOI: 10.1186/s13104-015-1692-9

Source DB:  PubMed          Journal:  BMC Res Notes        ISSN: 1756-0500


Background

Streptococcus suis is an important swine pathogen worldwide responsible for substantial economic losses in the swine industry. Among the 29 known serotypes determined by the capsular antigenic composition, serotype 2 is predominant in swine infections, causing meningitis, pneumonia, septicemia, endocarditis and arthritis [1-3]. Moreover, S. suis is regarded as an emerging zoonotic agent, mostly in Asia, since it can infect humans in close contact with contaminated pigs or their byproducts. The general population in Asia is also at risk due to consumption of raw pork meat or blood [4]. Two S. suis outbreaks were reported in China in 1998 and 2005 that caused over 60 deaths [5]. S. suis is also the major cause of adult meningitis in Vietnam [6]. S. suis serotype 2 has been divided into clonal complexes composed of sequence types (STs) determined by multilocus sequence typing (MLST) [7]. Two dominant (ST25 and ST28) and one less frequent (ST1) STs were identified in North America, which differ in their virulence in a mouse infection model [8]. Strains belonging to ST1 are highly virulent whereas ST25 and ST28 isolates have an intermediate and low virulence, respectively. To date, several virulence factors have been identified or proposed in S. suis [9, 10]. The sialic-acid rich capsule is considered one of the most important virulence factors since acapsular mutants of S. suis were more susceptible to phagocytosis by macrophages and avirulent in animal models (piglet and mouse) [11, 12]. Additional virulence-associated markers such as suilysin [13], extracellular factor [14], muraminidase-released protein [14], proteases [15, 16], and cell-wall anchored DNase [17] may also contribute to S. suis pathogenesis. In 2004, Allen et al. identified a hyaluronate lyase produced by S. suis (serotype 7) [18]. Hyaluronate lyases degrade hyaluronic acid, a major constituent of the extracellular matrix [19] made of repeating disaccharide units of β-1,4-D-glucuronic acid-β-1,3-N-acetyl-β-d-glucosamine, by β-elimination at the β-1,4 glycosidic linkages leading to Δ 4,5-unsaturated oligosaccharides [20]. Hyaluronate lyases produced by streptococci can play important roles in pathogenesis, from providing nutrients to the bacterium to enhancing the pathogen’s spread into host tissues by degrading hyaluronic acid [21]. More specifically, the hyaluronate lyase produced by Streptococcus intermedius has been shown to contribute to bacterial detachment from biofilms, consequently enhancing its dissemination in the host [22]. Evidence have been brought that Streptococcus agalactiae hyaluronate lyase is involved in macrophage intracellular survival as well as regulation of pro-inflammatory cytokine expression [23]. The hyaluronate lyase produced by S. suis has been suggested as a virulence factor, although no direct link could be established by studying the distribution of active hyaluronate lyase among S. suis field strains. This latter study also showed that a number of strains of S. suis can display an inactive form of hyaluronate lyase due to a 2 bp insertion causing a shifted reading frame resulting in a truncated and inactive form of the protein [24]. A role assigned to S. suis hyaluronate lyase relates to degradation of hyaluronic acid generating oligosaccharides that were then processed by the bacterium as a carbon source [18]. A role of S. suis hyaluronate lyase in the pathogenesis of meningitis has been recently proposed by Wu et al. since the protein was able to interact with an angiogenin inhibitor, a property that may lead to an increased permeability of the blood brain barrier [25]. In group A streptococci (GAS), also known as Streptococcus pyogenes, the hyaluronate lyase has been shown to contribute to subcutaneous spread and growth of the pathogen [26]. However, in a more recent study, the GAS hyaluronate lyase has been found to be present in an inactive form in the most virulent strains [27]. Given the fact that GAS capsule is mainly constituted of hyaluronic acid, expression of a functional hyaluronate lyase may cause capsule degradation and therefore increase susceptibility of the pathogen to the host immune system. Consequently, Hynes et al. suggested that GAS hyaluronate lyase should be considered as an anti-virulence factor [27]. S. suis is also known to express a capsule [9, 10]. However, its major constituent is sialic acid rather than hyaluronic acid as for S. pyogenes [27]. In the first part of this study, we investigated the distribution and genetic diversity of S. suis hyaluronate lyase among the three major STs of S. suis serotype 2 found in North America (ST1, ST25, ST28) that are known to differ in their degree of virulence, in order to provide an insight on the involvement of this protein in S. suis virulence. In the second part of the study, various aspects of the interaction between exogenous hyaluronic acid and S. suis were analyzed, including the effect on biofilm formation, adherence to brain microvascular endothelial cells (BMEC) and virulence factor gene expression. Lastly, since it has been shown that hyaluronic acid can regulate inflammation in host cells [28], we studied the effect of hyaluronic acid on pro-inflammatory cytokine secretion by BMEC.

Methods

Bacterial strains and culture conditions

Strains of S. suis serotype 2 used in this study as well as their corresponding ST and origin are listed in Table 1. Bacteria were routinely grown in Todd-Hewitt Broth (THB; BD-Canada, Mississauga, ON, Canada) at 37 °C unless specified otherwise.
Table 1

Sequence type, origin, type of infection, and hyaluronate lyase activity of S. suis serotype 2 isolates

StrainSequence typeOriginType of infectionHyaluronate lyase activity
P156/00P61ArgentinaUnknown
P477/03P11ArgentinaMeningitis
P517/03P41ArgentinaMeningitis
P613/05P31ArgentinaUnknown
Prot 611/071ArgentinaUnknown
315331FranceMeningitis
DAT2291JapanEndocarditis
DAT2611JapanPneumonia
DAT2641JapanMeningitis
NIAH11431JapanMeningitis
MNCM011ThailandEndocarditis
MNCM061ThailandMeningitis
MNCM161ThailandMeningitis
S7351The NetherlandsUnknown+
P1/71United KingdomMeningitis
MGGUS21USAMeningitis
MGGUS31USAMeningitis
104324825CanadaMeningitis+
104362925CanadaPneumonia+
104442325CanadaUnknown+
105325325CanadaPneumonia+
108554325CanadaMeningitis+
110233725CanadaMeningitis+
110286425CanadaSepticemia+
LPH425ThailandSepticemia+
LPH1225ThailandSeptic shock+
MNCM0425ThailandMeningitis+
MNCM1025ThailandSepticemia+
MNCM2425ThailandEndocarditis+
MNCM2625ThailandEndocarditis+
MNCM5125ThailandSepticemia+
MGGUS425USAMeningitis+
MGGUS525USAUnknown+
105447128CanadaMeningitis+
105790628CanadaMeningitis+
108470828CanadaUnknown+
108856328CanadaMeningitis+
109720528CanadaMeningitis+
90-133028CanadaHealthy pig+
DAT24228JapanMeningitis+
DAT24528JapanMeningitis+
DAT24628JapanSepticemia+
DAT25128JapanUnknown+
DAT29228JapanUnknown+
MNCM4328ThailandEndocarditis+
MGGUS928USAEndocarditis+
MGGUS1028USAPneumonia+
MGGUS1128USAPneumonia+
MGGUS1228USAPneumonia+
MGGUS1328USAMeningitis+
Sequence type, origin, type of infection, and hyaluronate lyase activity of S. suis serotype 2 isolates

Plate assay for hyaluronate lyase activity

Hyaluronate lyase activity was determined using the plate assay previously described by Smith and Willett [29]. Briefly, 10 µl of overnight cultures of S. suis were spotted on Brain Heart Infusion (BHI; BD-Canada) agar plates supplemented with 0.04 % (w/v) hyaluronic acid (Sigma-Aldrich Canada Co., Oakville, ON, Canada) and 1 % (w/v) bovine serum albumin (BSA). Plates were then incubated for 24 h at 37 °C. Hyaluronate lyase activity was revealed by the addition of 2 M acetic acid for 3 min which allows precipitation of the complex BSA/hyaluronic acid, the presence of a clear halo around bacterial growth area was indicative of hyaluronate lyase activity (Fig. 1).
Fig. 1

Hyaluronate lyase activity of S. suis MGGUS2 (HylA −, left) and S. suis S735 (HylA +, right), as determined using the plate assay

Hyaluronate lyase activity of S. suis MGGUS2 (HylA −, left) and S. suis S735 (HylA +, right), as determined using the plate assay

Gene amplification and sequencing

In order to compare DNA sequences of the entire hyaluronate lyase gene found in S. suis serotype 2 strains belonging to different STs, amplification of overlapping fragments was performed by PCR using primers designed with Primer3Plus [30] and listed in Table 2. Amplicons were then sequenced, the full hylA genes were assembled and then compared to the hyaluronate lyase gene previously identified in S. suis serotype 7 (accession number AJ3088328) [18] using BioEdit (http://www.mbio.ncsu.edu/BioEdit/bioedit.html) and the NCBI database (http://blast.ncbi.nlm.nih.gov/Blast.cgi).
Table 2

Primers used for the amplification of hyaluronate lyase gene in S. suis strains

Primer nameSequence (5′–3′)
HYLA5587FCCCGCATAAAAAGGAAAGGAAACAC
HYLA5614FiATGGGATTTTTTATCAGTCAAAGCA
HYLA5916RTTCTTTTGTCGCCTGAACAGCTTGC
HYLA6414CGAATACGTAGAAAAGACACCAGAA
HYLA6414RTTCTGGTGTCTTTTCTACGTATTCG
HYLA6722RTCGTTAGATTGGTAGCGTTTATTGG
HYLA7213AGACGGATTTGAGCAAGGTGGCCAT
HYLA7516RGTCATATCCATCAGTTCACCGCGAA
HYLA8014TTACCGGGAACGACAACGACCAAGG
HYLA8315RTCTGTCACTACTTCTTTGGACAAAT
HYLA8792CCGTAAAGAATGGCATTGAGTTGAC
HYLA9109RiAGGAGTGCGATCTGCGACACTTGAA
HYLA9138RCGCTCCCCCTTCACCCACGAATTTC
Primers used for the amplification of hyaluronate lyase gene in S. suis strains

Effect of hyaluronic acid on biofilm formation by S. suis

An overnight culture of S. suis P1/7 (ST1, negative for hyaluronate lyase activity) was diluted to an optical density at 660 nm (OD660) of 0.1 in THB supplemented or not with hyaluronic acid (Sigma-Aldrich Canada Co.; 0.01–1 mg/ml). Two hundred microliters of the bacterial suspension were seeded into wells of a 96-well tissue culture microplate. After incubation at 37 °C for 24 h, S. suis growth was monitored by recording the OD660. The medium and planktonic bacteria were then aspirated and biofilms were washed three times with 50 mM phosphate-buffered saline (PBS; pH 7.2). Biofilms were then stained with 100 µl of 0.04 % crystal violet for 10 min. Three washing steps were performed with PBS to remove the excess of dye and plates were left to dry for 2 h at 37 °C before adding 100 µl/well of 95 % ethanol and shaking for 10 min to release the stain. The absorbance at 550 nm (A550) was then recorded with a xMark microplate spectrophotometer (Bio-Rad Laboratories, Mississauga, ON, Canada).

Effect of hyaluronic acid on adherence of S. suis to BMEC

The human BMEC cell line used in this study has been previously described [31]. Cells were grown in RPMI 1640 medium (Life Technologies Inc., Burlington, ON, Canada) supplemented with 10 % (v/v) heat-inactivated fetal bovine serum (Life Technologies Inc.), 10 % (v/v) Nu-Serum IV supplement (Becton–Dickinson Biosciences, Bedford, MA, USA), 2.05 mM l-glutamine, and 1 % penicillinstreptomycin at 37 °C in a 5 % CO2 atmosphere. One hundred microliters of a BMEC suspension (106 cells/ml) were seeded into wells of a 96-well black wall microplate with clear bottom and incubated overnight at 37 °C with 5 % CO2. An overnight culture of S. suis P1/7 (ST1, negative for hyaluronate lyase activity) was centrifuged at 10,000×g for 20 min at 4 °C and washed once in PBS. Bacteria were then resuspended in bicarbonate buffer (0.5 M NaHCO3, pH 8) to an OD660 = 1, and fluorescein isothiocyanate (FITC) was added to a final concentration of 0.03 mg/ml. Labeling of the bacteria was performed at 37 °C for 30 min. In the meantime, BMEC were washed 3 times with PBS pH 7.2 and 100 µl of culture medium supplemented with hyaluronic acid (Sigma-Aldrich Canada Co.; 0.1, 0.5 and 1 mg/ml) was added. Cells were then incubated for 30 min at 37 °C in the presence of 5 % CO2. FITC-labelled bacteria were washed 3 times with PBS and 100 µl of this suspension was added to the BMEC monolayers to a final multiplicity of infection (MOI) of 200. The microplate was then subjected to a low-speed centrifugation (5 min at 200×g) to allow contact of bacteria with BMEC, and incubated at 37 °C in the presence of 5 % CO2 for 2 h. Wells were washed twice with PBS and 200 µl PBS was added prior to record fluorescence using a Synergy 2 microplate reader (BioTek Instruments Inc, Winooski, VT, USA) with an excitation wavelength of 485 nm and an emission wavelength of 528 nm. Percentage of adherence was calculated using the control value (no hyaluronic acid) as 100 %.

Effect of hyaluronic acid on virulence factor gene expression by S. suis

S. suis P1/7 (ST1, negative for hyaluronate lyase activity) was grown in THB supplemented with hyaluronic acid (Sigma-Aldrich Canada Co.; 0.625, 1.25 and 2.5 mg/ml) for 6 h in three independent cultures. Total RNA was extracted using the RNeasy minikit (Qiagen Inc., Mississauga, ON, Canada). The RNA quality was controlled using the Experion RNA StdSens Analysis kit (Bio-Rad Laboratories). Purity and quantity of the RNA were measured using Nanodrop (Thermo Fisher Scientific, Wilmington, DE, USA). Samples were then diluted in nuclease-free water to a final concentration of 100 ng/µl and cDNA were produced using iScript R-T Supermix for RT-qPCR (Bio-Rad Laboratories) according to the manufacturer’s protocol. Gene expression of five putative virulence factors (capsule [cps2J], muraminidase-released protein [mrp], extracellular protein factor [epf], suilysin [sly] and cell-wall anchored DNase [ssnA]) was recorded using the CFX96 Real-Time System C1000 Thermal Cycler (Bio-Rad Laboratories) with the IQ™ SYBR Green fluorophore (Bio-Rad Laboratories) according to the manufacturer’s protocols, using the 16S rRNA as internal control for data normalization as it is routinely used for gene expression quantification in S. suis [32]. Primers, purchased from Life Technologies Inc., are listed in Table 3. To validate the specificity for each primer pair, melting curves were analyzed and migration of PCR products on 1 % agarose gel 45 min at 100 V was performed. Amplicons migrated to their expected size of 123 bp (16S rRNA), 198 bp (cps2J), 216 bp (mrp), 162 bp (epf), 97 bp (sly) and 390 bp (ssnA) (data not shown).
Table 3

Primers used for the determination of virulence factor gene expression in S. suis P1/7

GenePrimer sequence (5′–3′)Expected amplicon size (bp)
16S rRNAForward: TAGGGTTTCTCTTCGGAGCATCGReverse: AACTGAATGATGGCAACT123
cps2J Forward: AGAGTGTTTAGATAGCATTATTTCCReverse: TAATTTGCTGTGCTATTTTTGATAC198
mrp Forward: TATCAGATTAATACAACTCGTTACGReverse: ATATTGTACTGTATCCTTTTGAACC216
epf Forward: CTAAACGTAACTTGGAATTTGTAAGReverse: AGCCATAAGTAAGATTATTTGATCC162
sly Forward: TTGAATATTGACATGAAGATTGCGAReverse: AAGCTGGAGAAGTTTGGGAACC97
ssnA Forward: GCTGACTATCGCTTCTTATAACATTReverse: GTCGATTCGGCCTAGGCTGAGATTG390
Primers used for the determination of virulence factor gene expression in S. suis P1/7

Effect of hyaluronic acid on secretion of pro-inflammatory cytokines by BMEC

Two ml of a suspension of BMEC (106 cells/ml) in the culture medium described above were seeded into each well of a 6-well microplate and incubated overnight at 37 °C in a 5 % CO2 atmosphere. The medium was then aspirated and replaced with fresh culture medium supplemented with hyaluronic acid (Sigma-Aldrich Canada Co.; 0.1, 0.5, 1, and 2 mg/ml). Hyaluronic acid treatments were performed for 24 h at 37 °C prior to collect culture supernatants for quantification of interleukin-1β (IL-1β), tumor necrosis factor-α (TNF-α), interleukin-6 (IL-6) and interleukin-8 (CXCL8) by enzyme-linked immunosorbent assays (ELISA) (eBioscience Inc., San Diego, CA, USA) according to the manufacturer’s instructions.

Statistical analysis

All assays were performed in triplicate and the means ± standard deviations were calculated. Differences were analyzed for statistical significance using the Student’s t test and were considered significant at p < 0.05.

Results

Distribution of hyaluronate lyase activity among S. suis STs

Fifty S. suis serotype 2 strains (17 ST1, 16 ST25, and 17 ST28) were tested for hyaluronate lyase activity on BHI plates supplemented with BSA and hyaluronic acid. As shown in Fig. 1, positive hyaluronate lyase activity resulted in the formation of a clear halo around the bacterial growth. It was found that sixteen out of seventeen isolates belonging to ST1, which comprises the most virulent strains, were devoid of hyaluronate lyase activity (Table 1), whereas all ST25 (intermediate virulence) and ST28 (low virulence) isolates possessed the activity. S. suis S735 was the only ST1 isolate possessing hyaluronate lyase activity.

Comparative analysis of S. suis hyaluronate lyase gene

Given the differences observed in hyaluronate lyase activity of strains belonging to different STs, the hyaluronate lyase gene of nine ST1, three ST25 and three ST28 strains was amplified. As we were unable to obtain a proper amplification of the full gene due to non-specific amplification, PCR of overlapping fragments were performed. The resulting products were then sequenced and the full gene was then assembled for analysis. Comparison of the nucleic acid sequences between STs using S. suis serotype 7 hylA gene previously described as reference gene (accession number AJ3088328) [18] showed the presence of four conserved insertions that occurred in ST1 strains (Fig. 2): a 21 bp insertion starting at position 192, a 3 bp insertion starting at position 330, a 2 bp insertion at position 1554–1555 and a single bp insertion at position 2036. Interestingly, the only ST1 strain (S735) that possessed hyaluronate lyase activity did not display the two last insertions in the hyaluronate lyase gene.
Fig. 2

Comparative analysis of nucleic acid sequence of the hyaluronate lyase gene (hylA) in S. suis belonging to ST1, ST25 and ST28. S. suis serotype 2 strains belonging to the ST1 group are devoid of hyaluronate lyase activity with the exception of strain S735. Strains belonging to ST25 and ST28 all possess an active hyaluronate lyase

Comparative analysis of nucleic acid sequence of the hyaluronate lyase gene (hylA) in S. suis belonging to ST1, ST25 and ST28. S. suis serotype 2 strains belonging to the ST1 group are devoid of hyaluronate lyase activity with the exception of strain S735. Strains belonging to ST25 and ST28 all possess an active hyaluronate lyase

Effect of hyaluronic acid on biofilm formation, adherence to BMEC, and virulence factor gene expression in S. suis P1/7

Given that the above data indicated that the most virulent strains of S. suis (ST1) do not possess hyaluronate lyase activity and consequently are likely to interact with hyaluronic acid during the course of infection, we then investigated the effect of this glycosaminoglycan on biofilm formation, adherence to BMEC, and virulence factor gene expression in S. suis P1/7 (ST1, negative for hyaluronidase activity). The biofilm assay was performed in a microplate model following growth of S. suis in THB supplemented with hyaluronic acid, prior to crystal violet staining. Growth of S. suis was not affected by the presence of hyaluronic acid at concentrations of 0.01–0.1 mg/ml, as determined by recording the OD660 following overnight incubation. However, in the presence of high concentrations of hyaluronic acid (0.5 and 1 mg/ml), bacterial growth was reduced (Fig. 3a). In regard to biofilm formation, no significant effect of hyaluronic acid was observed at 0.01 mg/ml, whereas at 0.05 mg/ml of hyaluronic acid, biofilm formation was significantly reduced. Hyaluronic acid at concentrations of 0.1 and 0.5 mg/ml increased biofilm formation by S. suis P1/7. At the highest concentration tested of hyaluronic acid (1 mg/ml), biofilm formation by S. suis was attenuated and may result from the reduced bacterial growth (Fig. 3b).
Fig. 3

Effect of hyaluronic acid on S. suis P1/7 growth (a) and biofilm formation (b). *Significantly different from control at p < 0.05

Effect of hyaluronic acid on S. suis P1/7 growth (a) and biofilm formation (b). *Significantly different from control at p < 0.05 To investigate the effect of hyaluronic acid on S. suis adherence to BMEC, FITC-labelled bacteria were incubated with a monolayer of cells in the presence of hyaluronic acid at concentrations ranging between 0.1 and 1 mg/ml. Adherence of S. suis relative to control (without hyaluronic acid) is reported in Fig. 4. An increased adherence (~35 %) was observed in the presence of hyaluronic acid at a concentration of 0.1 mg/ml while the highest concentration of hyaluronic acid (1 mg/ml) caused an inhibition of adherence of S. suis to BMEC. More specifically, adherence of S. suis P1/7 decreased by 68 %.
Fig. 4

Effect of hyaluronic acid on the adherence of S. suis P1/7 to BMEC. *Significantly different from control at p < 0.05

Effect of hyaluronic acid on the adherence of S. suis P1/7 to BMEC. *Significantly different from control at p < 0.05 The effect of hyaluronic acid on gene expression of five virulence-associated markers (capsule [cps2J], extracellular protein factor [epf], muraminidase-released protein [mrp], suilysin [sly] and DNase [ssnA]) in S. suis P1/7 was determined by RT-qPCR using 16S rRNA as reference gene. Hyaluronic acid at 0.625 and 1.25 mg/ml increased cps expression by a factor 1.3 and 1.8, respectively (Fig. 5a). An increase in epf expression was also observed in the presence of hyaluronic acid (Fig. 5b); the highest increase (1.65-fold) was observed with 1.25 mg/ml of hyaluronic acid. In the presence of ≤ 2.5 mg/ml hyaluronic acid, the expression of mrp increased, reaching a maximum of 2-fold increase at 1.25 mg/ml (Fig. 5c). The expression of sly was 1.6- and 1.7-fold higher in the presence of 1.25 and 2.5 mg/ml hyaluronic acid, respectively, compared to control (Fig. 5d). Lastly, the expression of ssnA was 1.5- and 1.7-fold higher in the presence of hyaluronic acid at 0.625 and 1.25 mg/ml hyaluronic acid, respectively (Fig. 5e).
Fig. 5

Effect of hyaluronic acid on virulence factor gene expression by S. suis P1/7. Relative gene expression of cps2J (a), epf (b), mrp (c), sly (d), ssnA (e). Significantly different from control at # p < 0.05; *p < 0.01

Effect of hyaluronic acid on virulence factor gene expression by S. suis P1/7. Relative gene expression of cps2J (a), epf (b), mrp (c), sly (d), ssnA (e). Significantly different from control at # p < 0.05; *p < 0.01

Effect of hyaluronic acid on pro-inflammatory cytokine secretion by BMEC

BMEC were treated with hyaluronic acid (18 h) at concentrations ranging from 0.1 to 2 mg/ml prior to determine pro-inflammatory cytokine (IL-6, CXCL-8, IL-1β and TNF-α) secretion by ELISA. While no production of IL-1β and TNF-α was observed (data not shown), levels of IL-6 and CXCL-8 increased in a dose-dependent fashion as reported in Fig. 6a, b, respectively. More specifically, when hyaluronic acid was added at 2 mg/ml, IL-6 and CXCL-8 secretion was 3.6 and 12.8 times higher than the control, respectively.
Fig. 6

Effect of hyaluronic acid on the secretion of IL-6 (a) and IL-8 (CXCL-8) (b) by BMEC. *Significantly different from control at p < 0.05

Effect of hyaluronic acid on the secretion of IL-6 (a) and IL-8 (CXCL-8) (b) by BMEC. *Significantly different from control at p < 0.05

Discussion

In 2004, a hyaluronate lyase (130 kDa) produced by the swine pathogen S. suis (serotype 7) has been identified and proposed as a virulence factor [18]. The fact that not all virulent strains expressed an active form of the enzyme suggested that S. suis hyaluronate lyase should not be considered as an essential virulence factor [24]. In this study, we focused on strains of S. suis serotype 2, which represents the most commonly isolated serotype from sick animals. In order to further investigate the relationship between expression of active hyaluronate lyase and virulence, we used S. suis serotype 2 strains belonging to the three clonal complexes present in North America, known as ST1, ST25 and ST28. It has been previously reported that these STs differ in their degree of virulence in a mouse infection model, ST1 isolates possess a high virulence whereas ST25 and ST28 isolates have an intermediate and low virulence, respectively [8]. While all ST25 and ST28 strains possessed hyaluronate lyase activity, sixteen out of seventeen isolates belonging to ST1 were devoid of activity. Interestingly, the only ST1 isolate positive for hyaluronate lyase activity (S. suis S735) has been previously reported to be only weakly virulent in piglets [33]. From the above data, an inverse correlation between virulence and the presence of hyaluronate lyase activity can be suggested. Genetic analysis of the hyaluronate lyase gene of ST1, ST25 and ST28 strains showed the presence of four conserved insertions in strains belonging to ST1. The 2 bp insertion at position 1554–1555 is responsible for a shifted reading frame leading to an early stop codon resulting in a truncated form of the hyaluronate lyase in ST1 isolates, thus explaining the lack of hyaluronate lyase activity in these strains. Interestingly, it has been shown that this truncated protein (53 kDa) was able to interact with an angiogenin inhibitor [25]. Such an interaction could inactivate the angiogenin inhibitor, thus promoting angiogenesis and vascular permeability that could allow S. suis to cross the blood–brain barrier and cause meningitis. It can be speculated that the loss of hyaluronate lyase activity in the most virulent strains of S. suis could have resulted in an increased bacterial virulence through such a mechanism. Given that S. suis ST1 strains that do not produce active hyaluronate lyase are likely to interact with host hyaluronic acid in vivo, we then investigated the effects of this glycosaminoglycan on some biological properties of S. suis P1/7, a reference ST1 strain. Since the hyaluronic acid-rich capsule of S. pyogenes has been described as important for biofilm formation, as it could be involved in intercellular adherence between bacteria [34], we evaluated whether supplementing the culture medium with exogenous hyaluronic acid could induce biofilm formation by S. suis, for which most strains cannot form a biofilm in a basal culture medium [35]. Our data revealed that hyaluronic acid at low concentration (0.05 mg/ml) reduced biofilm formation whereas higher concentrations (0.1 and 0.5 mg/ml) stimulated biofilm formation. These observations suggest that at a concentration of 0.05 mg/ml, hyaluronic acid could interfere with intercellular adhesion of S. suis or exopolysaccharide secretion. It was also found that high concentration of hyaluronic acid (1 mg/ml) inhibits the ability of S. suis to grow and produce a biofilm, probably due to the high osmotic pressure created. It has been reported that at the early step of the pathogenic process of meningitis, S. suis adheres to BMEC in order to facilitate migration of bacteria through the blood–brain barrier [36]. In this regard, we then evaluated the effect of exogenous hyaluronic acid on the adherence of S. suis P1/7 (ST1) to BMEC. In the presence of hyaluronic acid at a low concentration (0.1 mg/ml), bacterial adherence was increased, while at a high concentration (1 mg/ml), the adherence of S. suis to BMEC was significantly decreased. Using FITC-labeled hyaluronic acid, it was found that hyaluronic acid preferentially binds to BMEC and not to bacteria (Additional file 1: Figure S1). From the above observations, it may be suggested that at high concentrations, binding of hyaluronic acid to BMEC could lead to a decreased accessibility of receptors for S. suis, resulting in a lower bacterial adherence to BMEC. However, at low concentrations, the cell surface charge of the BMEC may be modified by hyaluronic acid, resulting in increased bacterial adherence. Interestingly, hyaluronic acid has been previously reported to modulate the adherence of Mycobacterium tuberculosis to lung epithelium [37]. Our results are thus in agreement with these previous observations, especially that hyaluronic acid at high concentrations inhibits bacterial adherence. However, the molecular mechanisms of S. suis adherence to cells via exogenous hyaluronic acid remains to be characterized. It has been shown that growing S. pyogenes in the presence of hyaluronic acid resulted in an increased expression of several virulence factors, including the M1 protein and a collagen-like surface protein, that play key roles in the pathogenesis of GAS infections [38]. Growing S. suis P1/7 in hyaluronic acid-supplemented culture medium was found to increase the expression of several virulence-associated markers such as the cell wall-anchored DNase, suilysin, MRP, EPF and capsule. Consequently, it can be hypothesized that the virulence of S. suis can be modulated by the presence of hyaluronic acid under in vivo conditions. Given the fact that S. suis P1/7 does not express an active form of hyaluronate lyase, the changes observed in virulence-associated markers gene expression can be linked with an adaptation to an osmotic or acidic stress in the culture medium supplemented with hyaluronic acid. Hyaluronic acid from the host is likely to be present during infections caused by S. suis ST1 isolates, considering that they do not produce an active hyaluronate lyase. Hyaluronic acid has been reported to possess pro- and anti-inflammatory properties depending on the size of the molecule [28]. In our study, stimulation of BMEC with hyaluronic acid was associated with a pro-inflammatory effect. More specifically, hyaluronic acid was found to dose-dependently increase the secretion of IL-6 and CXCL-8, two major inflammatory mediators. In a previous study, it has been reported that hyaluronic acid can modulate pro-inflammatory cytokines secretion in human uterine fibroblasts by interacting with the CD44 receptor [39]. Our observations suggest a lower inflammatory potential for strains possessing an active hyaluronate lyase. Indeed, these isolates could degrade hyaluronic acid in the extracellular matrix thus decreasing pro-inflammatory cytokines secretion by host cells.

Conclusions

Our study brought evidence that hyaluronate lyase in its full length and active form does not represent a key virulence factor for S. suis. Indeed, hyaluronate lyase appears to be active only in isolates of S. suis serotype 2 belonging to the less virulent STs (ST25 and ST28). Considering that the S. suis P1/7 hyaluronate lyase (truncated and inactive form) has been shown to interact with an angiogenin inhibitor [25], it can be suggested that the highly conserved 2 bp insertion in the hyaluronate lyase gene could lead to more invasive isolates by enhancing vascular permeability of the blood–brain barrier leading to the development of meningitis. Since Wu et al. [25] mainly focused their study on the truncated form of hyaluronate lyase, no data are available on the interaction of the active form of hyaluronate lyase with the angiogenin inhibitor, a phenomenon that may be important in the endothelial dysregulation associated with meningitis. Given that strains of S. suis belonging to ST1, the most virulent ST, do not degrade hyaluronic acid, we investigated the effect of this glycosaminoglycan on S. suis and host cells. While hyaluronic acid did not promote biofilm formation, it was found to modulate S. suis adhesion to BMEC. Moreover, hyaluronic acid increased virulence factor gene expression in S. suis and enhanced pro-inflammatory cytokine secretion by BMEC.
  38 in total

1.  Streptococcus suis meningitis in adults in Vietnam.

Authors:  Nguyen Thi Hoang Mai; Ngo Thi Hoa; Tran Vu Thieu Nga; Le Dieu Linh; Tran Thi Hong Chau; Dinh Xuan Sinh; Nguyen Hoan Phu; Ly Van Chuong; To Song Diep; James Campbell; Ho Dang Trung Nghia; Tran Ngoc Minh; Nguyen Van Vinh Chau; Menno D de Jong; Nguyen Tran Chinh; Tran Tinh Hien; Jeremy Farrar; Constance Schultsz
Journal:  Clin Infect Dis       Date:  2008-03-01       Impact factor: 9.079

2.  A single nucleotide mutation results in loss of enzymatic activity in the hyaluronate lyase gene of Streptococcus pyogenes.

Authors:  Wayne Hynes; Cecelia Johnson; Martha Stokes
Journal:  Microb Pathog       Date:  2009-09-22       Impact factor: 3.738

3.  Rapid plate method for screening hyaluronidase and chondroitin sulfatase-producing microorganisms.

Authors:  R F Smith; N P Willett
Journal:  Appl Microbiol       Date:  1968-09

4.  Group A streptococcus cell-associated pathogenic proteins as revealed by growth in hyaluronic acid-enriched media.

Authors:  Meng Zhang; Fiona M McDonald; Shane S Sturrock; Simon J Charnock; Ian Humphery-Smith; Gary W Black
Journal:  Proteomics       Date:  2007-05       Impact factor: 3.984

5.  Streptococcus suis serotype 2 mutants deficient in capsular expression.

Authors:  N Charland; J Harel; M Kobisch; S Lacasse; M Gottschalk
Journal:  Microbiology (Reading)       Date:  1998-02       Impact factor: 2.777

6.  Hyaluronic acid-specific regulation of cytokines by human uterine fibroblasts.

Authors:  H Kobayashi; T Terao
Journal:  Am J Physiol       Date:  1997-10

7.  Characterization of virulence of the Streptococcus suis serotype 2 reference strain Henrichsen S 735 in newborn gnotobiotic pigs.

Authors:  U Vecht; H J Wisselink; N Stockhofe-Zurwieden; H E Smith
Journal:  Vet Microbiol       Date:  1996-07       Impact factor: 3.293

8.  Identification of two proteins associated with virulence of Streptococcus suis type 2.

Authors:  U Vecht; H J Wisselink; M L Jellema; H E Smith
Journal:  Infect Immun       Date:  1991-09       Impact factor: 3.441

Review 9.  Surface-associated and secreted factors of Streptococcus suis in epidemiology, pathogenesis and vaccine development.

Authors:  Christoph Georg Baums; Peter Valentin-Weigand
Journal:  Anim Health Res Rev       Date:  2009-06       Impact factor: 2.615

Review 10.  Hyaluronan, a crucial regulator of inflammation.

Authors:  Aaron C Petrey; Carol A de la Motte
Journal:  Front Immunol       Date:  2014-03-11       Impact factor: 7.561

View more
  2 in total

1.  Screening for Virulence-Related Genes via a Transposon Mutant Library of Streptococcus suis Serotype 2 Using a Galleria mellonella Larvae Infection Model.

Authors:  Jingyan Fan; Lelin Zhao; Qiao Hu; Siqi Li; Haotian Li; Qianqian Zhang; Geng Zou; Liangsheng Zhang; Lu Li; Qi Huang; Rui Zhou
Journal:  Microorganisms       Date:  2022-04-21

2.  A serine/threonine phosphatase 1 of Streptococcus suis type 2 is an important virulence factor.

Authors:  Lihua Fang; Jingjing Zhou; Pengcheng Fan; Yunkai Yang; Hongxia Shen; Weihuan Fang
Journal:  J Vet Sci       Date:  2017-12-31       Impact factor: 1.672

  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.