Correction: Intraspecies Variability Affects Heterotypic Biofilms of Porphyromonas gingivalis and Prevotella intermedia: Evidences of Strain-Dependence Biofilm Modulation by Physical Contact and by Released Soluble Factors.

The image for Fig 3 is missing Fig 3B and 3C. Please see the corrected Fig 3 here.

Fig 3

Effect of co-culture of Porphyromonas gingivalis, Prevotella intermedia and Prevotella nigrescens on biofilm formation in a two-compartment co-culture system.

Panel A: P. gingivalis ATCC33277 and co-culture partners P. intermedia strains 17 and ATCC25611, and P. nigrescens ATCC33563. Panel B: P. gingivalis W83 and co-culture partners P. intermedia strains 17 and ATCC25611, and P. nigrescens ATCC33563. Panel C: P. intermedia strains 17 and ATCC25611 and co-culture partner P. nigrescens ATCC33563 Values represent average of 3 experiments (Kruskal-Wallis test followed by nonparametric post-tests, *p < 0.01). a denotes strain in the lower compartment (biomass measured) and b denotes strain in the upper compartment.

Table 1 has been corrected for improved readability. Please see the corrected Table 1 here.

Table 1

Primer sequences used for quantitative real-time PCR (q-PCR).

Target genes	Primers (5’– 3’)	Product size (bp)	Locus tag (NIH)
P. gingivalis waaA 1	F: TGGTTTCATGCAGCTTCTTT	146	PGN_RS02590
	R: TCGGCACCTTCGTAATTCTT
P. intermedia waaA 1	F:GACCCGAACGCAAAATACAT	130	PIN17_RS06380
	R:AGGGCGAAAAGAACGTTAGG
P. nigrescens waaA 2	F: GCTGCTGGACACTCCAAGGCTTT	120	ZP 08672979
	R: GCTATGATGAGTTTCCACTCGCTGTG
P. gingivalis thiC 2	F: ACGAYGCCAAYGATGCTGC		PGN_RS00750
P. intermedia thiC 2	R: ATCTTGTGCATBGGYACGTGTCC	124	PIN17_RS04875
P. nigrescens thiC 2			ZP 08673195

Source:

1 Hyvarinen et al., 2009;

2 This study