Literature DB >> 26594337

Case Report: Whole exome sequencing helps in accurate molecular diagnosis in siblings with a rare co-occurrence of paternally inherited 22q12 duplication and autosomal recessive non-syndromic ichthyosis.

Aayush Gupta1, Yugal Sharma1, Kirti Deo1, Shamsudheen Vellarikkal2, Rijith Jayarajan3, Vishal Dixit3, Ankit Verma3, Vinod Scaria4, Sridhar Sivasubbu2.   

Abstract

Lamellar ichthyosis (LI), considered an autosomal recessive monogenic genodermatosis, has an incidence of approximately 1 in 250,000. Usually associated with mutations in the transglutaminase gene ( TGM1), mutations in six other genes have, less frequently, been shown to be causative. Two siblings, born in a collodion membrane, presented with fish like scales all over the body. Karyotyping revealed duplication of the chromosome arm on 22q12+ in the father and two siblings. Whole exome sequencing revealed a homozygous p.Gly218Ser variation in TGM1; a variation reported earlier in an isolated Finnish population in association with autosomal recessive non-syndromic ichthyosis. This concurrence of a potentially benign 22q12+ duplication and LI, both rare individually, is reported here likely for the first time.

Entities:  

Keywords:  Lamellar ichthyosis; TGM1; Whole Exome Sequencing; chr22q12; genodermatosis

Year:  2015        PMID: 26594337      PMCID: PMC4648218          DOI: 10.12688/f1000research.6779.1

Source DB:  PubMed          Journal:  F1000Res        ISSN: 2046-1402


Introduction

Autosomal recessive congenital ichthyosis (ARCI), a heterogeneous disorder of cornification of skin, encompasses three clinical subtypes: lamellar ichthyosis (LI; OMIM 242300); congenital ichthyosiform erythroderma (CIE; OMIM 242100); and harlequin ichthyosis (HI; OMIM 242500) [1]. LI has an incidence of approximately 1 in 250,000. Over 115 mutations in TGM1 and less frequent ones in six other genes ( NIPAL4z, ALOX12B, CGI-58, FLJ39501, ICHYN and ABCA12) have been associated with the LI/CIE phenotypic spectrum worldwide [2, 3]. Overlapping phenotypes and the non-specificity of the conventional histopathology, makes clinical diagnosis challenging in many cases and inaccurate in some [4]. Whole exome sequencing has become a useful diagnostic aid for genetic disorders including multigene dermatoses such as epidermolysis bullosa [5, 6] and acrokeratosis verruciformis [7].

Case report

Two, 8 and 6-year-old, siblings born out of a non-consanguineous marriage ( Figure 1a) presented with hyperpigmented fish-like scales all over the body including face and flexures ectropion, loss of lateral half of eyebrows and alopecia along the scalp margins ( Figure 1b–1e). Both siblings were heat intolerant, photosensitive and hypohidrotic. Born uneventfully vaginally they were encased in a collodion membrane which was shed within a week of birth. There was no family history of any dermatoses. Slit lamp examination revealed bilateral keratitis. Karyotyping of their parents and the siblings performed previously revealed duplication of the chromosome arm on 22q12+ in the father and two siblings. The patients were put on daily oral (5 mg) isotretinoin after analysing their lipid profile.
Figure 1.

a) Pedigree of the family; ( b), ( c) and ( d), ( e) correspond to the ventral and dorsal views of siblings II:1, and II:2 respectively and shows hyperpigmented fish-like scales all over the body including face and flexures, ectropion, loss of lateral half of eyebrows and hair along scalp margins. Panel ( f) shows the chromatogram from capillary sequencing for the parents and siblings, while panel ( g) shows the domain organization of the protein and the location of the p.Gly218Ser variation with respect to the protein domains.

a) Pedigree of the family; ( b), ( c) and ( d), ( e) correspond to the ventral and dorsal views of siblings II:1, and II:2 respectively and shows hyperpigmented fish-like scales all over the body including face and flexures, ectropion, loss of lateral half of eyebrows and hair along scalp margins. Panel ( f) shows the chromatogram from capillary sequencing for the parents and siblings, while panel ( g) shows the domain organization of the protein and the location of the p.Gly218Ser variation with respect to the protein domains. Considering the diagnosis of LI, whole exome sequencing was attempted. Genomic DNA (gDNA) was isolated from 5 ml of blood [8] of each of the affected children after obtaining written informed consent conforming to the institutional ethical committee approvals (Dr. D.Y. Patil Vidyapeeth, Pune. Approval number DYPV/EC/178/14 ). The whole exome capture and library preparation (Nextera expanded exome, Illumina Inc., USA) were carried out according to the manufacturer’s instructions and followed by high throughput sequence generation on Hiseq 2500 with default 101 paired end single index sequence by synthesis chemistry (Illumina Inc., USA). The raw sequence reads were trimmed at a Phred score of 30 leaving over 44.9 and 33.45 million reads respectively for the two siblings. The variations were called against the hg19 version of the human genome using standard GATK-Picard pipeline with Burrows-Wheeler Alignment according to GATK best practice [9]. The variants from the genomes of both siblings were further analysed using ANNOVAR [10] for coding region and also screened using the NCBI-Clinvar database ( http://www.ncbi.nlm.nih.gov/clinvar/). Analysis revealed a homozygous p.Gly218Ser variation in TGM1 previously reported to be associated with autosomal recessive non-syndromic ichthyosis in an isolated Finnish population [11]. The variant mapped to the transglutaminase domain in the protein ( Figure 1g) and was also predicted to be pathogenic by both SIFT (Sorts Intolerant From Tolerant) [15] and PolyPhen2 [16] (Polymorphism Phenotyping v2). This variation was further validated in parents and both siblings by site-specific PCR using a forward primer CTTCTCCTGGGGTCAGGCA and reverse primer GAGAAGTCCCAGGCTCCATC (Sigma Aldrich). The PCR was done using taq polymerase (Invitrogen, USA, Cat. No. 10342053) according to the manufacturer supplied protocol with a Tm of 60.5°C. The PCR products were size selected and gel purified (2% agarose) using qiaquick gel extraction kit (QIAGEN, NL) and performed capillary sequencing (Applied Biosystems) performed using manufacturer instruction. Analysis revealed the variant was heterozygous in parents, while homozygous in both affected siblings ( Figure 1f). Follow up after two years of low dose isotretinoin, titrated intermittently, revealed complete subsidence of ectropion, eclabium and alopecia with residual fine scales.

Discussion

ARCI is a rare disorder with an estimated prevalence of 1 per 200,000 population in Europe and 1 per 200,000–300,000 population in the United States. Neonates with LI typically present with a collodion membrane which dries and peels away and is replaced by brown, plate-like scales over the entire body. Disease course ranges from very mild to severe, latter entailing ectropion, eclabium, scarring supraciliary and scalp alopecia, and palmoplantar hyperkeratosis [11]. DNA based molecular diagnosis is crucial in ichthyosis as it provides a firm basis for genetic counseling of affected individuals and families, and also permits prenatal diagnosis. In a cohort of 520 independent families with ARCI, mutations were identified by direct sequencing of the 6 ARCI genes identified to date in 78% of patients: 32% harbored mutations in TGM1, 16% in NIPAL4, 12% in ALOX12B, 8% in CYP4F22, 5% in ABCA12, and 5% in ALOXE3. Whole exome sequencing may fill in the diagnostic lacuna of at least 22% of the patients who failed in this study to exhibit mutations in any of the known ARCI genes, indicating the existence of additional loci, such as 2 loci on chromosome 12p11.2-q13 [12]. The 22q12+ duplication is known to cause cat eye syndrome, which has a range of potential morbidities with the occurrence of characteristic triad of iris coloboma, aural tags and/or pits and anal atresia [14], though none of these features were present in the father or the children. To the best of our knowledge, this is the first reported concurrence of a potentially benign 22q12+ duplication and LI, both of which are extremely rare individually. The mother of the siblings is now pregnant and the present finding will be used to help screen the foetus prenatally.

Consent

Written informed consent for publication of their clinical details and clinical images was obtained from the parent of the patients.

Data availability

The raw exome sequencing data are available at the NCBI Sequence Read Archive ( http://www.ncbi.nlm.nih.gov/sra), accession numbers SRX1096915 (II:1) and SRX1096920 (II:2). Gupta et al. focused on two siblings with ARCI with confirmed TGM1 mutation. In addition they found 22q12 duplication in these siblings and in their father. The title and abstract are both appropriate for the article, and the abstract is a suitable summary. The diagnosis has been sufficiently described, however it is a little bit unclear whether the 22q12 duplication is associated with the ARCI. The authors mention the cat eye syndrome which is related to the duplication of the chromosome 22q12. What about the relevance of this finding? It should be worked out in more detail. I have read this submission. I believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard. The authors reported 2 siblings with lamellar ichthyosis (LI) and the family pedigree shows the autosomal pattern of inheritance. In addition, duplicate 22q12+ has been shown in the father and the 2 affected siblings. It seems, however, that this chromosomal abnormality is unrelated to the LI as the father is phenotypically normal and the 2 siblings do not show any of the manifestations of this chromosomal abnormality. The significance of this concurrence is not clear. The authors may amend the manuscript by naming the site of the TGM1 mutation at the nucleotide level and the name of the gene transcript. It is not clear whether the authors examined the father and the affected siblings for manifestations of the duplicate 22q12+ (apart from the cat eye syndrome), such as learning difficulties, growth retardation, minor genital abnormalities of the boy etc. There are few typo errors. For instance, the "transglutaminase gene" is better given as "transglutaminase gene1" and "Ichyn" is "Ichthyin" etc. Ref.13 is not cited in the text and there seems to be a problem with enumeration of the references in the text. ​ I have read this submission. I believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard.
  15 in total

1.  Whole-exome sequencing solves diagnostic dilemma in a rare case of sporadic acrokeratosis verruciformis.

Authors:  A Gupta; Y K Sharma; S K Vellarikkal; R Jayarajan; V Dixit; A Verma; S Sivasubbu; V Scaria
Journal:  J Eur Acad Dermatol Venereol       Date:  2015-01-26       Impact factor: 6.166

2.  A simple salting out procedure for extracting DNA from human nucleated cells.

Authors:  S A Miller; D D Dykes; H F Polesky
Journal:  Nucleic Acids Res       Date:  1988-02-11       Impact factor: 16.971

Review 3.  Phenotypic variability of the cat eye syndrome. Case report and review of the literature.

Authors:  P R Rosias; J M Sijstermans; P M Theunissen; C F Pulles-Heintzberger; C E De Die-Smulders; J J Engelen; S B Van Der Meer
Journal:  Genet Couns       Date:  2001

4.  Predicting functional effect of human missense mutations using PolyPhen-2.

Authors:  Ivan Adzhubei; Daniel M Jordan; Shamil R Sunyaev
Journal:  Curr Protoc Hum Genet       Date:  2013-01

Review 5.  The clinical spectrum of nonbullous congenital ichthyosiform erythroderma and lamellar ichthyosis.

Authors:  M Akiyama; D Sawamura; H Shimizu
Journal:  Clin Exp Dermatol       Date:  2003-05       Impact factor: 3.470

6.  New mutations in the transglutaminase 1 gene in three families with lamellar ichthyosis.

Authors:  X Cao; Z Lin; H Yang; D Bu; P Tu; L Chen; H Wu; Y Yang
Journal:  Clin Exp Dermatol       Date:  2009-05-22       Impact factor: 3.470

7.  Autosomal recessive congenital ichthyosis.

Authors:  Judith Fischer
Journal:  J Invest Dermatol       Date:  2009-06       Impact factor: 8.551

8.  Whole-exome sequencing improves mutation detection in a diagnostic epidermolysis bullosa laboratory.

Authors:  T Takeichi; L Liu; K Fong; L Ozoemena; J R McMillan; A Salam; P Campbell; M Akiyama; J E Mellerio; W H I McLean; M A Simpson; J A McGrath
Journal:  Br J Dermatol       Date:  2014-11-19       Impact factor: 9.302

9.  A framework for variation discovery and genotyping using next-generation DNA sequencing data.

Authors:  Mark A DePristo; Eric Banks; Ryan Poplin; Kiran V Garimella; Jared R Maguire; Christopher Hartl; Anthony A Philippakis; Guillermo del Angel; Manuel A Rivas; Matt Hanna; Aaron McKenna; Tim J Fennell; Andrew M Kernytsky; Andrey Y Sivachenko; Kristian Cibulskis; Stacey B Gabriel; David Altshuler; Mark J Daly
Journal:  Nat Genet       Date:  2011-04-10       Impact factor: 38.330

10.  Exome sequencing reveals a novel mutation, p.L325H, in the KRT5 gene associated with autosomal dominant Epidermolysis Bullosa Simplex Koebner type in a large family from western India.

Authors:  Shamsudheen K Vellarikkal; Ashok Patowary; Meghna Singh; Renu Kumari; Mohammed Faruq; Dilip C Master; Sridhar Sivasubbu; Vinod Scaria
Journal:  Hum Genome Var       Date:  2014-09-04
View more
  2 in total

Review 1.  Genomics of rare genetic diseases-experiences from India.

Authors:  Sridhar Sivasubbu; Vinod Scaria
Journal:  Hum Genomics       Date:  2019-09-25       Impact factor: 4.639

Review 2.  Review: Understanding Rare Genetic Diseases in Low Resource Regions Like Jammu and Kashmir - India.

Authors:  Arshia Angural; Akshi Spolia; Ankit Mahajan; Vijeshwar Verma; Ankush Sharma; Parvinder Kumar; Manoj Kumar Dhar; Kamal Kishore Pandita; Ekta Rai; Swarkar Sharma
Journal:  Front Genet       Date:  2020-04-30       Impact factor: 4.599

  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.