Literature DB >> 26582577

Proteome analysis of male accessory gland secretions in oriental fruit flies reveals juvenile hormone-binding protein, suggesting impact on female reproduction.

Dong Wei1, Hui-Min Li1, Chuan-Bei Tian1, Guy Smagghe1,2, Fu-Xian Jia1, Hong-Bo Jiang1, Wei Dou1, Jin-Jun Wang1.   

Abstract

In insects, the accessory gland proteins (Acps) secreted by male accessory glands (MAGs) account for the majority of seminal fluids proteins. Mixed with sperm, they are transferred to the female at mating and so impact reproduction. In this project, we identified 2,927 proteins in the MAG secretions of the oriental fruit fly Bactrocera dorsalis, an important agricultural pest worldwide, using LC-MS analysis, and all sequences containing open reading frames were analyzed using signalP. In total, 90 Acps were identified. About one third (26) of these 90 Acps had a specific functional description, while the other two thirds (64) had no functional description including dozens of new classes of proteins. Hence, several of these novel Acps were abundant in the MAG secretions, and we confirmed their MAG-specific expression by qPCR. Finally and interestingly, one of these novel proteins was functionally predicted as juvenile hormone-binding protein, suggesting the impact of Acps with reproductive events in the female. Our results will aid in the development of an experimental method to identify Acps in insects, and in turn this information with new Acps in B. dorsalis will pave the way of further exploration their function in reproduction and potential development as new insecticide targets.

Entities:  

Mesh:

Substances:

Year:  2015        PMID: 26582577      PMCID: PMC4652233          DOI: 10.1038/srep16845

Source DB:  PubMed          Journal:  Sci Rep        ISSN: 2045-2322            Impact factor:   4.379


The male accessory glands (MAGs) produce a variety of secreted proteins and peptides that are known as accessory gland proteins (Acps), which are transferred from the male to the female, together with sperm during copulation. These Acps play a critical role in insect fertilization, with the function not limited to males1. Their influence also extends to females, including modulating the outcome of postmating sexual selection, female reproductive physiology and immune responses2. Acps can also affect sperm storage parameters, sperm competition and mating plug formation12. Most of these changes in females result from gene expression changes induced by Acps34. Early study of reproductive proteins began when the biochemical fractionation of gametes and gonads led to the purification and characterization of specific proteins. Recently, various molecular and genetic tools, coupled with bioinformatics, have been widely used to identify and analyze Acps in many insects15. However, these proteins are not well characterized outside the Drosophila species, although some works have been done in grasshoppers, mosquitoes, moths, beetles, crickets, and honeybees5678. Recent efforts have been made to extend our knowledge of reproductive protein evolution across species that are not well characterized genetically. These studies have used proteomic approaches to identify and sequence proteins derived from reproductive accessory glands and/or directly from the seminal fluid of Drosophila species6. Such approaches have also successfully identified reproductive proteins from the ejaculates of non-model species5910111213. Proteomic analysis can identify thousands of proteins in complex biological samples14. In recent years, with the aid of proteomic approaches, comprehensive studies have been initiated to identify and analyze the Acps in many insect species for which we are lacking genomic information. There has also been an increase in the number of studies on insect MAGs and testes that investigate the function of specific seminal proteins through transcriptomic1516 and proteomic analysis1117. Mass spectrometry can be used to characterize a set of expressed proteins, and has been used previously in the identification and evolutionary analysis of Acps18. In Heliconius butterfly MAGs, 51 Acps have been identified by a combination of EST and proteome analyses, and these included chymotrypsin, proteinase inhibitor and hormone binding protein12. These secreted Acps showed a high presence in the MAGs, and are good candidates that may be transferred to the female during copulation. In Drosophila, there were also 138 seminal fluid proteins that were identified, including some new seminal fluid proteins named Obp56f, Obp56g and CG174726. The oriental fruit fly Bactrocera dorsalis is an important agricultural pest worldwide19. To date, information is lacking on the Acps of B. dorsalis because of difficulties identifying the individual proteins. Proteomics is a novel and direct method to identify unannotated Acps in insect MAGs. In a previous study, we obtained a tissue-specific RNA sequencing database of the MAGs of B. dorsalis20. The latter data are useful so to identify the Acps via similarity searching, which method was also done previously for Acps identification in butterflies12. In the present study, we carried out liquid chromatogram mass spectrometry (LC-MS) analysis of the proteins secreted by the MAGs of B. dorsalis. This combined transcriptomic and proteomic analysis then allowed to identify and characterize the Acps with the help of open reading frame (ORF) and signal peptide prediction. Among the novel Acps identified in male B. dorsalis, we found one interesting that was functionally predicted as juvenile hormone-binding protein (JHBP), suggesting the impact of Acps with the reproductive event in the female adult.

Results

Proteomic analysis of proteins secreted by the MAGs

A total of 30,669 unigenes were assembled by this transcriptomic sequencing20. The assembled sequences were thereafter deposited at DDBJ/EMBL/GenBank with the Transcriptome Shotgun Assembly project accession number of GDRP00000000. After proteins coding sequences (CDSs) prediction analysis in transcriptome data, 19,484 unigene sequences were assembled to match known proteins following BLASTx analysis of protein databases. Sequences with an amino acid sequence match were designated as CDSs. In total, most of the CDSs were shorter than 500 residues. The Acps secreted by MAGs were separated and identified by label-free LC-MS based on the CDSs dataset. In total, 27,038 and 27,702 peptides were detected in each sample, respectively, which corresponded to 3,527 and 3,984 proteins in each sample, respectively. The raw data of the current proteomics were available from the authors upon request. After combining all data from the two samples, we identified 25,606 peptides that were present in both samples. These peptides were matched to 3,942 protein groups, for which we were able to annotate 2,927 significant CDSs. Notably, there were no proteins that were identified by only one peptide, and most of these proteins corresponded to between two and ten peptides (73.5%, Fig. 1). Thirty-two proteins were identified by more than forty peptides. The average number of peptides per protein was 8.75, leading to an average sequence coverage of 29.2 times (Fig. 2). There were 334 proteins (11.4%) with a sequence coverage of >50%. Because B. dorsalis is not a model organism and there is no complete genome sequence available currently, the species homology analysis was performed. Almost all of the proteins showed the greatest homology to Diptera species, of which 91.2% were Drosophila, followed by Bactrocera (2.39%), Aedes (1.02%) and other genera (5.89%) (Fig. 3).
Figure 1

The distribution of identified peptides of proteins by proteomic analysis of the secretions of the MAGs from B. dorsalis as identified by mass spectrometry.

Figure 2

Proteomic analysis of proteins in the secretions of the MAGs from B. dorsalis as identified by mass spectrometry.

Figure 3

Homology analysis of identified CDSs/proteins in the secretions of the MAGs from B. dorsalis as identified by mass spectrometry.

Acps identification in the MAGs

Most of the proteins had no specific annotation or functional description in the databases. Following ORF prediction, 1,116 proteins (40.9%) containing ORFs were screened out. In most cases, extracellularly secreted proteins were identified by the presence of a signal peptide. Using SignalP, 90 of these ORFs contained predicted 5′ signal peptides that were identified as putative Acps (Table 1 and Supplementary Data). Amongst these there were 26 known proteins and 64 proteins with no functional description (>70%). The known proteins consisted of proteases, odorant binding proteins (Obps), metalloproteinase, ribosomal protein, serine protease inhibitor, and some immunity-related proteins.
Table 1

Identification of proteins in the secretions of the MAGs of B. dorsalis.

No. of peptidesAnnotation/DescriptionSCaMWbSLcPEPdiBAQe
9CG586762.929.0912640111250000000
5odorant binding protein 2193.414.285121028666000000
4heat shock protein cognate 3, isoform A56.672.381656027481000000
2protein disulfide isomerase56.854.936488024224000000
12antigen 5 precursor49.827.727251020233000000
3odorant binding protein 247.515.3931395.65E-4214713000000
2acidic ribosomal protein58.911.4691122.79E-19513052000000
5GH2033268.822.248205012351000000
15Cyp165.724.7642307.12E-25811974000000
14ribosomal protein P252.211.7431131.09E-19611773000000
3GL1525638.28.3386762.87E-21310433000000
4GI2294841.617.9071542.08E-1858214700000
7CRLBP homologous protein54.415.95714707361600000
48GI2431547.891.33579706614700000
4abnormal wing discs47.419.03517105972900000
5GI2223653.915.0731412.59E-1635311000000
7GH1311036.928.542494.04E-1194675000000
9GH2024760.120.61618304512500000
3GI2120540.837.64633803768200000
4dromyosuppressin, isoform A47.810.046926.95E-1553015000000
5GL1852936.115.5821471.30E-672551300000
9GH1828446.957.50649902530400000
16GI2169040.640.0763551.75E-1271966500000
5GJ1851132.450.3324482.17E-1881870900000
4GA1724912.236.1033351.39E-541792700000
12GL1783223.721.1551904.64E-971695300000
5GF1735530.654.8104801.42E-1041678600000
8GL1961344.217.2081541.53E-1621604600000
3GM1909346.424.50621101587800000
4hexamerin LSP-228.383.01669901533600000
6GI210562217.7101689.36E-251511400000
4GF1410435.650.8414445.27E-1051487000000
9GF147583629.0372613.83E-1251374200000
7ferritin heavy chain-like28.923.1432041.50E-491370500000
10CG9691, isoform A44.812.5401161.49E-561157300000
14GD1305735.346.6074173.25E-2411115500000
10AGAP002632-PA406.7478601.63E-411035500000
6GJ2427332.528.1302401.87E-131939140000
10GF1783837.922.6842061.90E-117767750000
626,29kDa proteinase26.962.4075471.76E-107714250000
24GG2062337.950.1944515.81E-167663700000
6GJ1054049.316.6561461.05E-26657850000
4GJ2055826.137.2153308.64E-47623240000
12ferritin light-chain26.925.1192237.48E-23585380000
11GJ1202345.7182.0716300579550000
6GH2073230.961.4415577.75E-116544240000
5GJ2427321.331.2372672.51E-85534720000
37GK2586330.1142.7612785.07E-242523000000
6GJ1874518.231.8722912.43E-71517470000
17GD1198329.639.1723381.21E-294511620000
11GG1705429.526.8282411.75E-299507980000
11GH1381030.67.8732724.06E-11496690000
4GI2209227.625.1862214.71E-216482670000
12GE2633435.525.6342341.94E-45479020000
2Chitinase-like protein Idgf440.747.8354351.22E-72445130000
6GF233124917.0151533.05E-27424600000
6GJ1944226.632.7762978.07E-93418670000
9GK1275127.646.7273928.23E-80368820000
3GL1269147.48.4289761.24E-16354380000
11GI1582032.216.2431466.87E-13343610000
12odorant binding protein 143.515.8901381.58E-20339060000
8GF2426136.527.1342442.45E-74332140000
4AGAP011367-PA48.526.3082291.75E-42300750000
5GF2440624.162.3605511.37E-100295230000
23GF1336635.481.1917264.67E-113284410000
5GK2423122.915.0561405.62E-13258140000
2GF2380933.38.997811.05E-08257940000
7serine protease inhibitor 125.644.4684062.17E-37254430000
2GH2192123.547.2124122.28E-51248570000
5GA1237945.914.3321221.48E-15238840000
5Gmfb835.824.9592182.01E-28226580000
3GA1579415.443.3833963.99E-57208850000
3gasp, isoform A49.628.4542585.83E-140199290000
4obstructor-E, isoform A36.59.0422854.95E-06195140000
2CG3119521.393.7298021.44E-84173140000
4GA1948529.523.5252101.05E-15155040000
10GH2002327.420.4191757.72E-15149910000
16cellular repressor of E1A-stimulated genes, isoform A22.121.4811952.70E-15142470000
5juvenile hormone epoxide hydrolase 214.952.7454647.34E-26126460000
7GA2064814.239.8523311.21E-12115880000
3maltase A5, isoform A25.510.375943.66E-08111750000
25insect-derived growth factor22.361.3335391.65E-3786078000
6cathepsin F like protease13.152.4594672.45E-1482380000
12GK1546722.211.7541083.54E-0777075000
6putative zinc-metalloproteinase precursor15.728.3802491.13E-1475032000
14Gp15015.1102.6209112.96E-4557972000
5GJ1715812.128.2852561.30E-1356852000
9GJ2371619.261.5735462.52E-11149834000
2putative salivary trypsin15.444.8704081.62E-3223734000
5GJ181568.871.4216171.29E-1317199000

aSequence coverage (%).

bMolecular weight (kDa).

cSequence length.

dPosterior error probability of the identification.

eIntensity-based absolute quantification.

Most abundant Acps in the MAGs

We estimated the relative molar abundance of the predicted Acps in the MAGs secretions using label-free MS and the intensity-based absolute quantification (iBAQ) algorithm. Most of the abundant proteins were of unknown function, which was consistent with the protein content. Of the 30 most abundant Acps, 19 were unknown proteins (Fig. 4). The true contribution of a particular protein to the total mass of the secretion is the product of its molar abundance and its molecular weight. Using this determination, the most abundant protein was CG5867, a protein of unknown function, with a molar proportion of 4.38% of total protein. Several of most abundant proteins were previously-characterized Acps, such as Obp21 and the immune-related proteins, cyclophilins. However, several proteins that were previously not linked to MAG secretions, were also in the top quartile for abundance, including the most abundant six protein CG5867, GH20332, GL15256, GI2948, GI24315 and GI22236, etc.
Figure 4

Selection of the 30 most abundant proteins in the secretions of the MAGs from B. dorsalis.

The total absolute expression value of each protein in two samples was estimated by intensity-based absolute quantification (iBAQ). Red labels indicate novel Acps with no functional description.

Tissue-specific expression at mRNA level and functional prediction of novel Acps from the MAGs

The majority of Acps identified in this study showed no significant BLASTx similarity to proteins in GenBank. After combined InterProScan and Gene Ontology analysis, there were 58 Acps were functional predicted. All of these predicted proteins were classified into 11 categories based on their molecular functions including 32 unknown proteins (Table 2). Proteases, protease inhibitors, mediators of immune responses, and odorant binding included more Acps than the other categories. There were also 32 (35.6%) proteins of unknown function.
Table 2

Function classification of proteins in the secretions of the MAGs from B. dorsalis.

Functional classNumber of proteins
Protease10
Protein binding13
Ion binding6
Immunity8
Odorant binding5
Hydrolase4
Protease inhibitor4
Structural protein2
Chitin binding2
Hormone binding2
Protein modification2
None predicted32
Total90
In the present proteomic analysis, we identified many Acps with best matches to not described proteins in the NCBI nr database. These proteins may be novel Acps to B. dorsalis flies. The six most abundant and novel Acps were assayed for tissue-specific expression patterns from standard concentrations of total RNA isolated from tissues of male B. dorsalis using real time PCR. Of these, all the determined six novel Acp genes were highly and specifically expressed in the MAGs of B. dorsalis (Fig. 5). The first and most interesting, CG5867 was expressed in the MAGs with expression levels tens of thousands of times higher than in the head. The functional prediction indicated that it was a hemolymph juvenile hormone-binding protein (JHBP) by Blasting in InterProScan online tool. The second one GH20332, also highly expressed in MAGs, was predicted as cyclophilin-type peptidyl-prolyl cis-trans isomerase. Cyclophilins can exhibit peptidyl-prolyl cis-trans isomerase activity, accelerating protein folding by catalyzing the cis-trans isomerization of proline imidic peptide bonds in oligopeptides. This kind of cyclophilin also has protein chaperone-like functions. GL15256 had no functional prediction in NCBI and InterPro, but it showed a domain signature named kazal domain. The fourth most abundant, GI22948, was predicted as a mesencephalic astrocyte-derived neurotrophic factor homolog, and the fifth GI24315 as a heat shock protein 90 family protein. The last Acp-specific, GI22236, had no functional prediction in databases. We expect that these Acps that are highly and specifically present in the MAGs may be transferred to females to regulate the reproductive physiology of the insect.
Figure 5

Quantitative real time PCR validation of the high and tissue-specific expression of the six most abundant and novel Acps in the secretions of the MAGs from B. dorsalis.

Relative expressions were determined in head (HE), thorax (TH), midgut (MG), fat body (FB), Malpighian tubules (MT), testis (TE), and male accessory glands (MAGs) from male Bactrocera dorsalis. Relative expression levels were calculated based on the value in head tissue, which was ascribed an arbitrary value of 1. Different letters above the bars indicate significant differences based on Tukey’s test (P < 0.05).

Discussion

Reproductive proteins maintain species-specific barriers to fertilization, affect the outcome of sperm competition, and mediate reproductive conflicts between the sexes18. However, specific proteins and molecular mechanisms that underlie these processes in B. dorsalis are virtually unknown. This is the first study to report the identification of Acps in B. dorsalis. The study provides a proteomic-scale view of the Acps secreted by B. dorsalis MAGs. Based on the MAG-specific transcriptome sequence data, 90 Acps were identified in the B. dorsalis MAGs. This project confirmed that a combination of transcriptomic analysis, proteomic analysis, bioinformatics and expression assays is an effective method for identifying Acps in organisms for which a reference genome sequence is not available. A recent explosion of proteomics studies has identified many reproductive proteins in organisms such as Drosophila618, Heliconius (butterfly)1221, Gryllus (cricket)22, Apis mellifera (honeybee)23 and Tribolium castaneum (red flour beetle)17. In the accessible genomes of insect species, there is much more genetic information on reproductive proteins. For instance, in Drosophila, there were also 138 Acps that were identified by proteomic analysis in seminal fluids6. In these insects with genome information, there are also many orphan genes2425. These genes have no recognizable homology to any sequences in other species. This is also one of the reasons that most of the Acps identified in the MAGs secretions had no functional prediction in the NCBI nr database. As shown here and previously, Acps are short, rapidly evolving, and relatively free of codon bias2627. As such, Acps are less likely to be detected by computational gene prediction programs. Nonetheless, the Acps identification method used in this study was straightforward and high-efficiency for Acps identification. Recently, the genome of B. dorsalis has been sequenced and uploaded into the online database of NCBI (ftp://ftp.ncbi.nlm.nih.gov/genomes/Bactrocera_dorsalis/), but to date not much is known about the genes related to reproduction in this species. There were 90 Acps that were identified in the secretions of the MAGs of B. dorsalis, and they were assigned to 11 categories based on their molecular functions. Most of these proteins had previously been identified as Acps in other insects, including proteases, protease inhibitors and ion binding proteins612. Almost 36% of these Acps were not identified as functional unknown proteins. In two previous studies of Acps in D. melanogaster and Heliconius butterflies, 34% and 60% of the proteins remained as unknown, although these insect have been studied well612. In this study, only sequences containing ORFs were considered as Acp candidates; however, it is likely that other Acps with no ORFs were also picked up by LC-MS. The availability of a whole genome sequence would increase the success of Acps identification. Other proteins such as transferrin, calmodulin and juvenile-related proteins, which were studied as Acps in other insects, were also identified although they were without ORFs112829. Furthermore, not every protein identified in a mass spectrometry screen as a reproductive protein actually has a function in reproduction30, since some proteins may also play a housekeeping role that does not relate specifically to reproduction. Acps are commonly abundant with proteases and protease inhibitors in many other taxa ranging from insects to mammals231. Proteases and protease inhibitors are also highly abundant in the sperm proteome of Drosophila32. Protease inhibitors are commonly identified as Acps in previous studies1118, and are involved in sperm-egg interactions together with specific proteases33. Notably, cyclophilin and cyclophilin-type peptidyl-prolyl cis-trans isomerase were identified in the current study. These proteins are involved in the immune response during reproduction. The later one, GH20332, was identified as a novel Acp in the B. dorsalis MAGs secretions. Cyclophilins have been identified as Acps in D. melanogaster34, Anopheles gambiae8, A. aegypti35 and L. longipalpis36. Cyclophilins is one of the antimicrobial peptides (AMPs) that exist widely in both the male and female reproductive tracts of insects and mammals, and they are presumed to protect against microorganisms3738. It has been demonstrated that male insects will transfer antibacterial proteins from their accessory glands and ejaculatory duct (ED) to their mates to increase their reproductive success38. Another immune protein, antigen 5, was also identified in the MAG/ED secretions of B. dorsalis. Antigen 5 is expressed mostly in MAGs (Wei D and Wang JJ, unpublished data) and is a major allergen of venom in vespids. Homologs of this gene or protein have been identified in many insect species3940. However, the exact biological function and its sequence-related proteins remain unknown. Two ferritin proteins were also identified in B. dorsalis MAG secretions, which have previously been implicated in the immune response of ferritin in B. dorsalis41. Interestingly, four pheromone/general odorant binding proteins (Obps) were identified in the MAGs secretions. They are traditionally associated with the olfactory nervous system42, and may present odorants, pheromones, or other small molecules to receptors in the female reproductive tract. Obps have also been identified in the MAGs of D. melanogaster643. Several Obps showed a MAG-specific expression in D. melanogaster43, but the specific functions of these tissue-specific Obps remain unknown. Two Obps (Obp21 and Obp2) were detected with high abundance in B. dorsalis MAGs by MS (Table 1). In B. dorsalis MAGs secretions, a further three Obps-like proteins (CRLBP homologous, AGAP011367-PA and GJ10540) were also identified by MS, and these are particularly attractive targets for further characterization. These Obps may be transferred to regulate the female reproductive physiology by interacting with a receptor in the female reproductive tract. An up-regulated expression of the Or10a odorant receptor has been observed in female D. melanogaster reproductive tracts in response to Acps44, suggesting Or10a as a possible target in B. dorsalis. Two hormone-related Acps, which are similar to Obps, were identified in the MAGs secretions in the current study. One of them CG5867 was functionally predicted as a JHBP by Blasted in InterPro. JH has a profound effect in insects regulating embryogenesis, maintaining the status of larval development and stimulating reproductive maturation in the adult forms45. JH is transported from the sites of its synthesis to the target tissues by a hemolymph carrier, called JHBP. JHBP protects the JH molecules from hydrolysis by non-specific esterases. It has been demonstrated that JH could be de novo biosynthesized by the mosquito MAGs46, and that JH produced by the MAGs was transferred to the female ovaries during copulation29. A study in T. castaneum revealed that JH regulated the secreting activity of the MAGs in return47. Proteomic analysis in the current study revealed that one JHBP (CG5867) was the most abundant Acp in the MAGs. Results of qRT-PCR also validated the high and tissue-specific expression of CG5867 in the B. dorsalis MAGs at mRNA levels (Fig. 5). Previous study showed that JHBP was highly expressed in the larval immature stage, especially in the fat body4849. Here in this study, we believe that the abundance of JHBP validates the presence of JH in the B. dorsalis seminal fluids, but the receptors for JH, and the mechanism of JH regulation of reproductive physiology, remain to be determined. In addition, we want to note that the crustacean neurohormone GA12379, which has neuropeptide hormone activity, was also identified in the current study (CL896). This protein belongs to the neuropeptide family that is expressed by arthropods50. The specific function of this protein should be determined in further studies. In this study, we identified a number of Acps secreted by the MAGs of B. dorsalis using combined transcriptomic, proteomic and bioinformatics analyses. Most of the identified Acps in the B. dorsalis MAGs were functionally unknown proteins, but for 58 of these Acps we could functionally classify them into 11 categories, including protease, immunity, odorant binding as most important. For the new Acps in the male B. dorsalis MAGs, only 32 Acps would be functionally predicted by Blasting and searching in databases based on the sequence similarities and domains. We believe that the MAG-specific proteins as revealed by this study will be a foundation for future research to understand the patterns and processes of molecular evolution, mating regulation, and immunity among reproductive proteins in Tephritid insects. This LC-MS proteomic approach yields large numbers of proteins present in the secretions of the MAGs, and even less abundant Acps will be identified. Finally and interestingly, the most abundant of the newly identified Acps was identified as a JHBP which is confirming the impact of Acps with the reproductive event in the female adult. Future functional tests with the individual Acps or combinations will be essential for understanding their role in the female behavior and reproduction. Thus, our study provides important information combining proteome and mRNA data, and this for the first time, to address fundamental questions about reproduction and evolution within and among insect taxa, and also paves the way for further exploration of the functions of these Acps in the female adult. Finally and of interest to practice, this new information on insect-specific Acps may be useful in the development as new insecticide target sites, for instance to provoke male sterility and so to combat fruit flies that show high levels of resistance against all current insecticide classes.

Methods

Protein coding sequences prediction

The transcriptome sequencing was performed and analyzed in previous study with the accession number of SRR1168415 in the Sequence Read Archive in National Center for Biotechnology Information20. Unigenes were firstly aligned by blastx (E-value < 10−5) to protein databases in the priority order of National Center of Biotechnology Information NR, Swiss-Prot, Kyoto Encyclopedia Of Genes And Genomes (KEGG) and Clusters of Orthologous Group (COG). That is, we first aligned Unigenes to NR, then Swiss-prot, then KEGG, and finally COG. Unigenes aligned to a higher priority database will not be aligned to lower priority database. The alignments ended when all alignments are finished. Proteins with highest ranked in blast results were taken to decide the coding region sequences of Unigenes, then the coding region sequences are translated into amino sequences with the standard codon table. Therefore, both the nucleotide sequences (5′–3′) and amino sequences of the Unigene coding region named CDSs were acquired.

Preparation of MAGs secretion samples

A stock colony of the oriental fruit fly B. dorsalis was established from pupae obtained from Haikou, Hainan Province, China, in 2008. The insects were reared in our laboratory according to methods described previously51. Adult male of B. dorsalis were dissected in saline solution (NaCl, 0.9%) at 15 days old after emergence to recover the MAGs, including two types of glands (mesodermal and ectodermal accessory glands) and the ejaculatory duct. Dissected MAGs were immediately immersed in 200 μL of sample storage solution (8 M urea, 2 M thiourea, 4% CHAPS, 1% (m/v) DTT, and 0.14% (w/v) PMSF) in a 1.5-mL tube. Fresh samples from 100–200 individuals were vortexed for ~20 s, and then centrifuged at 12,000 rpm for 15 min at 4 °C. The resulting supernatant was used for digestion. The protein concentrations were determined as described by Bradford using BSA as a standard52. Two independent MAGs secretion samples (biological replicates) were prepared. Protein digestion was performed as described by Dong et al.53. Briefly, secreted proteins were digested with trypsin (1 μg trypsin per 25 μg protein, Promega, Madison, WI) overnight at 37 °C in 150 μL of 50 mM NH4HCO3 according to the filter-aided sample preparation protocol. Tryptic peptides were recovered by centrifugation at 4 °C for 10 min in the ultrafiltration tubes, resuspended in 1% formic acid, and then lyophilized using Coolsafe 55–4 (Gene, Denmark).

LC-MS analysis

Tryptic peptides were separated using an EASY nanoLC 1000 system (Thermo Fisher Scientific, San Jose, CA) with an EASYSpray column (C18, 2 μm, 100 Å, 50 μm × 50 cm). An acetonitrile gradient of 2–100% in 0.1% formic acid was used, and samples were run for 120 min at a flow rate of 250 nL/min. The separated peptides were analyzed using a Thermo Scientific Q Exactive mass spectrometer (Bremen, Germany) operating in data-dependent mode. Up to 10 of the most abundant isotope patterns with charge ≥2 from an initial survey scan were automatically selected for fragmentation by higher energy collisional dissociation with normalized collision energies of 27%. The maximum ion injection times for the survey scan and the MS/MS scans were 20 and 60 ms, respectively, and the ion target value for both scan modes was set to 1 × 106. The spray voltage was 1.8 kV. Full scan mass accuracy was obtained by Orbitrap over a mass coverage of 400–15,000 m/z at a resolution of 30,000. Each sample was analyzed in triplicate.

Data analysis and Acps identification

Proteins were identified using the MASCOT search engine (version 2.3, Matrix Science, London, UK). The raw data were converted to MASCOT generic files using the Proteome Discoverer software (version 1.4, Thermo Scientific). Mass spectra were searched against the transcriptomic coding sequences (CDSs) from B. dorsalis MAGs transcriptomic data (accession number SRR1168415 in the Sequence Read Archive (SRA) of NCBI). The initial precursor mass tolerance and fragment mass tolerance were set to 10 ppm and 0.02 Da, respectively. The search included variable modifications of methionine oxidation and N-terminal acetylation, and fixed modification of carbamidomethyl cysteine. Minimum and maximum peptide lengths were set to six and 144 amino acids, respectively. A maximum of two miscleavages was allowed in the data search. Both peptide and protein identifications were filtered at a 1% false discovery rate. In cases where identified peptides were shared between two proteins, the results were combined and reported as one protein group. MASCOT results were filtered using the MASCO percolator for accuracy and sensitivity, thus improving peptide identification54. A minimum of one unique peptide was required for protein identification. Proteins identified in both samples were considered to be the Acps candidates. Amino acid sequences of the ORFs of the selected Acps were then determined from the B. dorsalis MAGs transcriptome data. In this work, amino acid sequences with ORFs were screened out for the purposes of signal peptide prediction. Signal peptide prediction was carried out using the online tool SignalP 4.1 (http://www.cbs.dtu.dk/services/SignalP). ORFs of the proteins from the B. dorsalis MAGs containing a predicted signal peptide were considered to be Acps.

Protein quantification

We used the intensity-based absolute quantification (iBAQ) algorithm to compare the abundance of different proteins within each MAGs secretion sample55. Label-free quantification was used to compare the relative quantification of proteins in each sample, with a minimum of two ratio counts to determine the protein intensity5657. For this, we used both unique peptides and razor peptides to determine the label-free quantification. The mean protein intensity of proteins detected in both samples was estimated as the abundance.

Functional analysis of Acps

Combined InterProScan (http://www.ebi.ac.uk/ InterProScan/) and BLAST similarity searches against the annotated proteins in the NCBI nr database were performed to determine the functional categories. The known Acps were analyzed using the online tool AmiGO 2 from the Gene Ontology Consortium (http://amigo.geneontology.org/amigo).

RNA extraction for validation of novel Acps

Newly emerged males were dissected at 3 days old to obtain tissues from the head, thorax, midgut, fat body, Malpighian tubules, testis, and MAGs. Tissues were immediately immersed in RNA-later solution on ice and stored at –80°C until required. Frozen samples were powdered in liquid nitrogen, and mRNA was isolated using TRIzol reagent (Invitrogen, Carlsbad, CA) following the manufacturer’s instructions. RNA was quantified by measuring the absorbance at 260 nm using a NanoVue UV-Vis spectrophotometer (GE Healthcare Bio-Science, Uppsala, Sweden). The purity of all RNA samples was assessed at an absorbance ratio of OD260/280 and OD260/230, and the integrity of RNA was confirmed by 1% agarose gel electrophoresis. The novel Acp candidates were assayed for tissue-specific expression patterns by quantitative real time PCR from standard concentrations of total RNA isolated from tissues. The primers in this study were designed using DNAMAN 7.0 (LynnonBiosoft, Quebec, Canada) based on the sequences of B. dorsalis (Table 3). For control purposes, a fragment of the ribosomal protein subunit 3 open reading frame was also amplified using the specific primers. Total RNA was reverse-transcribed using a PrimeScript RT-PCR kit (Takara, Dalian, China). gDNA eraser (Promega) was used to eliminate the genomic DNA. Each PCR reaction was performed within the StepOne Plus Real-Time PCR System (Life Technologies, Singapore) in a 20 μL volume containing 1 μL of cDNA template, 10 μL of GoTaq qPCR Master Mix (Promega), 1 μL of each primer (10 μM), and 7 μL of nuclease-free water. The reaction conditions were: one cycle at 95 °C for 2 min, followed by 40 cycles of 95 °C for 15 s and 60 °C for 30 s. Melting curve analysis from 60–95 °C was carried out for all reactions to ensure specificity and consistency of all generated products. Three technical replicates were performed for each trial. Transcript levels were quantified according to the 2−ΔΔCt method58. Gene-specific primers were designed within predicted ORFs using Primer Premier 5.0 software (Premier Biosoft International, Palo Alto, CA). All primers used in the research presented here were available from the authors upon request. A control fragment of the ribosomal protein subunit 3 ORF was also amplified.
Table 3

The primers used in the tissue-specific expression profiling study for the six most abundant and novel Acps in the secretions of the MAGs from B. dorsalis.

GeneForward Primer (5′–3′)Reverse Primer (5′–3′)
RPS3TAAGTTGACCGGAGGTTTGGTGGATCACCAGAGTGGATCA
CG5867CTGGACATCGAGGCAGAAGGCCAAGTTGTGCGCGTTTCTT
GH20332GGATTATGTCTGGTGGCGCTAAATTGCGGGCGGTTTTCTC
GL15256CTGCTGGCCGTATTGCTACTCGCAGCATATTCAGACTGCG
GI22948TATCTGGGCGGTCTGGAAGACGCAGCTTTCATCCCAATCG
GI24315GCGGTTCCAATCATCCAACGACCATCGAACTCAGGCAAGG
GI22236TTGCGATCAGGTGCCAAAACGGGAGACGGTGCAAAGATCA

Statistical analysis

Significant differences of expressions among tissues of male B. dorsalis for novel Acp genes were tested by ANOVA for multiple sample comparisons using SPSS 16.0 software (SPSS Inc., Chicago, IL). P < 0.05 was considered to be statistically significant.

Additional Information

How to cite this article: Wei, D. et al. Proteome analysis of male accessory gland secretions in oriental fruit flies reveals juvenile hormone-binding protein, suggesting impact on female reproduction. Sci. Rep. 5, 16845; doi: 10.1038/srep16845 (2015).
  58 in total

1.  An ectopic expression screen reveals the protective and toxic effects of Drosophila seminal fluid proteins.

Authors:  Jacob L Mueller; Jennifer L Page; Mariana F Wolfner
Journal:  Genetics       Date:  2006-11-16       Impact factor: 4.562

2.  Cloning and characterization of Ancylostoma-secreted protein. A novel protein associated with the transition to parasitism by infective hookworm larvae.

Authors:  J M Hawdon; B F Jones; D R Hoffman; P J Hotez
Journal:  J Biol Chem       Date:  1996-03-22       Impact factor: 5.157

3.  Transcriptome analysis to identify genes for peptides and proteins involved in immunity and reproduction from male accessory glands and ejaculatory duct of Bactrocera dorsalis.

Authors:  Dong Wei; Chuan-Bei Tian; Shi-Huo Liu; Tao Wang; Guy Smagghe; Fu-Xian Jia; Wei Dou; Jin-Jun Wang
Journal:  Peptides       Date:  2015-08-20       Impact factor: 3.750

4.  Identity and transfer of male reproductive gland proteins of the dengue vector mosquito, Aedes aegypti: potential tools for control of female feeding and reproduction.

Authors:  Laura K Sirot; Rebecca L Poulson; M Caitlin McKenna; Hussein Girnary; Mariana F Wolfner; Laura C Harrington
Journal:  Insect Biochem Mol Biol       Date:  2007-10-25       Impact factor: 4.714

5.  Genes regulated by mating, sperm, or seminal proteins in mated female Drosophila melanogaster.

Authors:  Lisa A McGraw; Greg Gibson; Andrew G Clark; Mariana F Wolfner
Journal:  Curr Biol       Date:  2004-08-24       Impact factor: 10.834

6.  Detection of seminal fluid proteins in the bed bug, Cimex lectularius, using two-dimensional gel electrophoresis and mass spectrometry.

Authors:  K Reinhardt; C H Wong; A S Georgiou
Journal:  Parasitology       Date:  2008-12-18       Impact factor: 3.234

7.  Molecular characterization and gene expression of juvenile hormone binding protein in the bamboo borer, Omphisa fuscidentalis.

Authors:  Eakartit Ritdachyeng; Manaporn Manaboon; Stephen S Tobe; Tippawan Singtripop
Journal:  J Insect Physiol       Date:  2012-09-21       Impact factor: 2.354

8.  Comparative structural modeling and inference of conserved protein classes in Drosophila seminal fluid.

Authors:  Jacob L Mueller; Daniel R Ripoll; Charles F Aquadro; Mariana F Wolfner
Journal:  Proc Natl Acad Sci U S A       Date:  2004-09-02       Impact factor: 11.205

9.  A genome-wide analysis in Anopheles gambiae mosquitoes reveals 46 male accessory gland genes, possible modulators of female behavior.

Authors:  Tania Dottorini; Lietta Nicolaides; Hilary Ranson; David W Rogers; Andrea Crisanti; Flaminia Catteruccia
Journal:  Proc Natl Acad Sci U S A       Date:  2007-09-27       Impact factor: 11.205

10.  The transcriptome of Lutzomyia longipalpis (Diptera: Psychodidae) male reproductive organs.

Authors:  Renata V D M Azevedo; Denise B S Dias; Jorge A C Bretãs; Camila J Mazzoni; Nataly A Souza; Rodolpho M Albano; Glauber Wagner; Alberto M R Davila; Alexandre A Peixoto
Journal:  PLoS One       Date:  2012-04-05       Impact factor: 3.240

View more
  4 in total

1.  The Old and the New: Discovery Proteomics Identifies Putative Novel Seminal Fluid Proteins in Drosophila.

Authors:  Timothy L Karr; Helen Southern; Matthew A Rosenow; Toni I Gossmann; Rhonda R Snook
Journal:  Mol Cell Proteomics       Date:  2019-02-13       Impact factor: 5.911

2.  A mosquito hemolymph odorant-binding protein family member specifically binds juvenile hormone.

Authors:  Il Hwan Kim; Van Pham; Willy Jablonka; Walter G Goodman; José M C Ribeiro; John F Andersen
Journal:  J Biol Chem       Date:  2017-07-27       Impact factor: 5.157

3.  Symbiotic microbes affect the expression of male reproductive genes in Glossina m. morsitans.

Authors:  Francesca Scolari; Geoffrey Michael Attardo; Emre Aksoy; Brian Weiss; Grazia Savini; Peter Takac; Adly Abd-Alla; Andrew Gordon Parker; Serap Aksoy; Anna Rodolfa Malacrida
Journal:  BMC Microbiol       Date:  2018-11-23       Impact factor: 3.605

4.  Rapid Genomic Evolution Drives the Diversification of Male Reproductive Genes in Dung Beetles.

Authors:  Cho Yeow Koh; Nalini Puniamoorthy
Journal:  Genome Biol Evol       Date:  2021-08-03       Impact factor: 3.416

  4 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.