| Literature DB >> 26573036 |
Omid Assar1, Azim Nejatizadeh, Farzaneh Dehghan, Mohammad Kargar, Nader Zolghadri.
Abstract
Atherosclerosis is a complex multifactorial disorder. Studies show that infectious microbial agents may play an important role in the development of atherosclerosis; however, these findings are conflicting. This study investigated the presence of Chlamydia pneumoniae DNA in atherosclerotic plaques of patients suffering from coronary artery disease. In a cross-sectional study, 85 patients (43 females and 42 males with mean age of 61±9.5, range 42-82 years) referred for coronary artery bypass grafting (CABG) and thoracic biopsy as the control groups were enrolled for this study. Standard questionnaires, including demographic and clinical evaluation were administered. Obtained specimens were processed and then nested polymerase chain reaction with primers for Pst1 fragment was carried out to detect Chlamydia pneumoniae DNA. Statistical analysis was done using the SPSS software. Of note, in 25 out of the 85 patients (29.4%), C. pneumoniae was detected within atherosclerotic plaques, whereas, 5 out of the 85 thoracic biopsy (5.9%) were positive for the presence of the mentioned bacteria in internal thoracic artery. There was a statistically significant association between atherosclerotic plaque (study group) and thoracic biopsy (control group) in terms of C. pneumoniae positivity (P= 0.0001). The findings of this study support the hypothesis that C. pneumoniae is associated with atherosclerosis.Entities:
Mesh:
Year: 2015 PMID: 26573036 PMCID: PMC4873590 DOI: 10.5539/gjhs.v8n4p260
Source DB: PubMed Journal: Glob J Health Sci ISSN: 1916-9736
PCR primer for amplification of C.pneumonia Pst1 fragment
| Primer name | Primer sequence (5’-3’) | Size (bp) |
|---|---|---|
| CP1 | TTATTCACCGTCCTACAGCAGAAA | 404 |
| CP2 | GGGGGTTCAGGGATCATTTGT | |
| CPN1 | TTACGAAACGGCATTACAACGGCTAGAAATCAAT | 214 |
| CPN2 | TATGGCATATCCGCTTCGGGAACGAT |
Figure 1PCR product of C.pneumoniae was electrophoresed in 2% Agarose gel. Lane1-4 positive sample, 5-8 negative sample, M, size marker, 9, Positive control, 10, negative control
Clinical Characteristics of Patient with respect to C. pneumoniae DNA Positivity
| Parameters | P-value | ||||
|---|---|---|---|---|---|
| Positive n=25 | Negative n=60 | Positive n=5 | Negative n=80 | ||
| Mean Age | 60.3±9.7 | 61.7 ±9.5 | 63.6 ± 5.2 | 61.1 ± 9.7 | 0.12 |
| Female | 14 (%56) | 29(%48.3) | 4(%80) | 39(%48.8) | 0.55 |
| Male | 11 (%44) | 31(%51.7) | 1(%20) | 40(%51.2) | |
| Smoking Habit | 9(%36) | 27(%45) | 3(%60) | 33(%41.2) | 0.44 |
| Diabetes | 10(%40) | 23(%38.3) | 4(%80) | 33(%41.2) | 0.05 |
| Hypertension | 9(%36) | 31(%51.7) | 5(%100) | 35(%43.8) | 0.62 |
| Hypercholesterolemia | 5(%36) | 31(%51.7) | 5(%100) | 35(%43.8) | 0.86 |
| Obesity | 2(%8) | 2(%3.3) | 0(%0) | 4(%5) | 0.65 |
| Family History | 8(%32) | 11(%18.3) | 3(%60) | 16(%20) | 0.17 |