| Literature DB >> 26528244 |
Lin Wang1, Chongwei Bi2, Hongjun Cai3, Bingrun Liu2, Xiaobo Zhong2, Xuming Deng1, Tiedong Wang2, Hua Xiang3, Xiaodi Niu4, Dacheng Wang2.
Abstract
The emergence and wide spread of multi-drug resistant Staphylococcus aureus (S. aureus) requires the development of new therapeutic agents with alternative modes of action. Anti-virulence strategies are hoped to meet that need. Sortase A (SrtA) has attracted great interest as a potential drug target to treat infections caused by S. aureus, as many of the surface proteins displayed by SrtA function as virulence factors by mediating bacterial adhesion to specific organ tissues, invasion of host cells, and evasion of the host-immune responses. It has been suggested that inhibitors of SrtA might be promising candidates for the treatment and/or prevention of S. aureus infections. In this study, we report that chlorogenic acid (CHA), a natural compound that lacks significant anti-S. aureus activity, inhibit the activity of SrtA in vitro (IC50 = 33.86 ± 5.55 μg/ml) and the binding of S. aureus to fibrinogen (Fg). Using molecular dynamics simulations and mutagenesis assays, we further demonstrate that CHA binds to the binding sites of C184 and G192 in the SrtA. In vivo studies demonstrated that CHA prevent mice from S. aureus-induced renal abscess, resulting in a significant survival advantage. These findings indicate that CHA is a promising therapeutic compound against SrtA during S. aureus infections.Entities:
Keywords: Staphylococcus aureus; binding site; chlorogenic acid; inhibitor; renal abscess; sortase A
Year: 2015 PMID: 26528244 PMCID: PMC4608362 DOI: 10.3389/fmicb.2015.01031
Source DB: PubMed Journal: Front Microbiol ISSN: 1664-302X Impact factor: 5.640
Strain and plasmid list.
| Strain or plasmid | Relevant genotype | Reference |
|---|---|---|
| Newman D2C | wild-type SrtA positive; non-hemolytic; coagulase negative | ATCC25904 |
| ΔSrtA | srtA::Erm; isogenic mutant of Newman D2C | |
| BL21 | Expression strain, F- ompT hsdS(rB- mB-) gal dcm (DE3) | Invitrogen |
| pGEX-6P-1 | Expression vector | Amersham |
| pGSrtAΔ | pGEX-6P-1 with | This study |
| C184A | pGSrtAΔ | This study |
| G192A | pGSrtAΔ | This study |
Oligonucleotide primers used in this study.
| Primer name | Oligonucleotide (5–3)a |
|---|---|
| PsrtA59F | GCG |
| PsrtA59R | CCG |
| C184A–F | GCCTGTCTTTTCATTGTAATCATC |
| C184A–R | |
| G192A–F | TATTTAATTGTTCA |
| G192A–R |
The calculated energy components, binding free energy (kcal/mol), binding constants, and the number of binding sites using the fluorescence spectroscopy quenching method in the WT-CHA, C184A-CHA, and G192A-CHA systems.
| TΔ | Δ | Binding constants | ||
|---|---|---|---|---|
| WT-CHA | 6.7 ± 2.0 | -15.2 ± 2.4 | 8.9 ± 1.3 | 0.9987 |
| C184A-CHA | 5.9 ± 1.4 | -7.9 ± 1.6 | 4.7 ± 0.8 | 1.0025 |
| G192A-CHA | 6.3 ± 1.3 | -8.4 ± 1.9 | 5.0 ± 0.9 | 0.9995 |