Literature DB >> 26525903

Microsatellite markers for the Jaera albifrons species complex (marine isopods).

Ambre Ribardière1, Thomas Broquet2, Claire Daguin-Thiébaut3.   

Abstract

BACKGROUND: The Jaera albifrons complex contains five species of marine isopods (J. albifrons, J. praehirsuta, J. ischiosetosa, J. forsmani, and J. posthirsuta). These species, occurring on the shores of the North-Atlantic Ocean, are partially reproductively isolated by barriers due to sexual isolation (mate choice), genetic incompatibilities, and ecological specialization. Microsatellite loci would be useful for parentage-based analyses of sexual selection and studies of genetic structure in the context of speciation.
FINDINGS: Twenty-four microsatellite markers were developed for J. albifrons using pyrosequencing of enriched libraries. Patterns of polymorphisms were analyzed in 49 J. albifrons adult males sampled in two populations from Brittany (Western France). The average number of alleles per locus was 4.73 ± 2.45 and the average gene diversity was 0.55 ± 0.23. Most markers also successfully amplified in the three sibling species J. praehirsuta, J. ischiosetosa, and J. forsmani.
CONCLUSIONS: These polymorphic and cross-amplifiable markers will be useful for population genetics and parentage studies in the J albifrons complex.

Entities:  

Mesh:

Substances:

Year:  2015        PMID: 26525903      PMCID: PMC4630881          DOI: 10.1186/s13104-015-1595-9

Source DB:  PubMed          Journal:  BMC Res Notes        ISSN: 1756-0500


Findings

Background

The Jaera albifrons complex (Leach, 1814) is composed of five intertidal isopod species [1, 2]. Three species (J. albifrons, J. praehirsuta, and J. ischiosetosa) have a large distribution along the coasts of the North-Atlantic Ocean from South-Spain and South-USA up to Baltic and Arctic regions, while the two other species are restricted either to the North-American East coast (J. posthirsuta) or the European coasts (J. forsmani). Interest in these species stems from the fact that gene flow is interrupted by several isolating barriers but hybridization can occur under particular circumstances. Isolating barriers include ecological isolation, sexual isolation, and genetic incompatibilities [3, 4]. Microsatellite loci will be useful for population genetic studies of the J. albifrons complex, and fine scale analyses requiring parentage assignment (e.g. for investigating mechanisms of sexual selection). Microsatellite markers were developed using two French J. albifrons populations and cross-amplification was tested for the three other species that are found in Europe (J. praehirsuta, J. ischiosetosa, and J. forsmani).

Methods

Total genomic DNA was isolated from seven J. albifrons individuals (three males and four females) using the Nucleospin® Tissue kit (Macherey–Nagel) and sent to Genoscreen (Lille, France) for microsatellite development. Libraries enriched for microsatellites were prepared according to Malausa et al. [5] and sequenced on a 454 GS-FLX Titanium pyrosequencer (Roche). Among 42,661 raw sequences, 2609 microsatellite motifs were detected using QDD v1 [6] with default parameters, yielding 168 potential primer pairs. Among them, 95 primer pairs maximizing the number of repeats were tested for amplification and polymorphism using a set of seven J. albifrons individuals. Nine loci were found to be monomorphic, 46 loci did not yield amplification products, and 16 gave uninterpretable amplification patterns. The remaining 24 promising loci included dinucleotide, trinucleotide and tetranucleotide repeat motifs (Table 1).
Table 1

Microsatellite loci for Jaera albifrons and multiplex PCR conditions

LocusF primer seq. (5′ to 3′)R primer seq. (5′ to 3′)MotifRange size (pb)GenBankAccession no.PCR multiplexDyePrimer (10 µM)Init. temp.Fin. temp.No. final cycles
F** (µl)F (µl)R (µl)
Ja30CGTCATTTATGCGTGCGGTACGTCCATTCTTCATCTGACTGC(TC)9 173–185KP7498811PET0.10.20.3605020
Ja37TCGAGCATCATACGACGACAGCCTATAGTGTCTTTGGCACC(GA)8 101–115KP749883FAM0.400.4
Ja41GGTGTTGGCGGAAAGATTCTAGCCTACTCTACCGTCTGTT(GA)8 172–180KP749885NED0.10.20.3
Ja91ATCGGCATTCCACTGAGAGGCCAGTCTTGAATGCCTTGGG(CCT)6 073–082KP749896VIC0.10.20.3
Ja01CAATCTTCGTCTTGGCGTCTCACTGTGGGCTTAGGATTGT(AG)8 226–247KP7498752FAM0.500.5574720
Ja02TGCCACCAATTAACCAAACACGACAGCCATAATGATCACC(CT)10N16(CT)5 182-212KP749876NED0.10.20.3
Ja35TGGATTCACATTGCTTCCTGGTCACGCATTCTAGTCTACGCT(AT)8 173–179KP749882VIC0.30.10.4
Ja47GGTGCTTAATGTAGTAGAGCGGATGGAACCACAAAACGGACG(TG)10 116–124KP7498863NED0.10.20.3605020
Ja56ACTAACACAAACATGCACTTACAATTGTTAGGTGCCTGCCATT(ACA)6 261–276KP749888FAM0.30.30.6
Ja58CCCACTGGACCACTACTTGAACCCTATCGTTGTAGTTGAGGT(CT)5 186–188KP749889VIC0.30.10.4
Ja99ATCAAACATGCAGCGGTGTCAGGCATCTCAGAGGAATCACTT(TC)5 152–154KP749898PET0.10.20.3
Ja21TTCAAATTAAATGCAACGATGCATTATTCTGAAGCTGTTGGTC(GA)10 272–286KP7498784NED0.2500.25605025
Ja71CTGCCCTATCAGTTGAGCTTCACAGTGCCATCAACAAAGC(GA)7 263–269KP749892VIC0.300.3
Ja78CACTCTACAGCAGCATAAGAGTAGAACAAGGCAAGATGAGCTC(AC)8 243–254KP749893PET0.20.10.3
Ja94TGGTCCGATCGTGAGTTTCACCTTCGGATGGTAATAGGGCA(AT)6 101–111KP749897PET0.10.20.3
Ja22GCAAACTCGATCACCATTGGAACCCACCGTCGTCTATCAAC(CT)9 106–128KP7498795VIC0.20.10.3605023
Ja64TAAGCCGAGTCTCAACAGCACCCGTGCATAGCGAACAG(TG)5N22(TG)5 119–127KP749890PET0.10.20.3
Ja66CGCAAGTACAAATTTCTCTATGCTTCGAACGGTACTCAATGTGAAG(TAGA)5 175–187KP749891FAM0.400.4
Ja80TGATGGATGAGAGGTGATCGTTTGATTCAGATCCGATACCATGT(GA)6 154–154KP749894NED0.20.10.3
Ja13ATCCTTCATGAGTCCCGAGTAAGTATGTCCGAACTACCGC(GA)12 211–233KP7498776VIC0.20.10.3574723
Ja23CAGGCCATCTTGCTGCAGATACAGCCTCTCCATCATGCGT(GA)9 120–134KP749880VIC0.10.20.3
Ja39CGTGCAGTCATCTCAGTCAGGCTGAGGAGAGCGAGTAATC(TC)8 128–144KP749884NED0.150.150.3
Ja55ACAACAGCAACAACTTCCGTAGTTGTGATGTGGAGGAGCA(CAA)6 130–138KP749887PET0.150.150.3
Ja82TCCGAATGCACCAAATCTGAGGCTTGTATTCGAATTTACATGGA(GAA)6 292–295KP749895FAM0.400.4

The volume of fluorescent (F**) and non-fluorescent (F) forward primer was adjusted for each marker. Columns Init. temp. and Fin. temp. give the initial and final temperatures (in  °C) used for the touchdown PCR. Amplification products from multiplex 4–6 were diluted before electrophoresis (dilution level: 1/3)

Microsatellite loci for Jaera albifrons and multiplex PCR conditions The volume of fluorescent (F**) and non-fluorescent (F) forward primer was adjusted for each marker. Columns Init. temp. and Fin. temp. give the initial and final temperatures (in  °C) used for the touchdown PCR. Amplification products from multiplex 4–6 were diluted before electrophoresis (dilution level: 1/3) Polymorphisms of these 24 loci were estimated in two populations of J. albifrons from Brittany: Lingoz (48°39′12.31ʺN, 3°57ʹ0.43ʺW, n = 24 males) and Inizan (48°39′34.09″N, 3°56′25.66″W, n = 25 males), for which genomic DNA was extracted from entire individuals using NucleoSpin® 96 Tissue kit (Macherey–Nagel). Locus amplification was performed in six multiplex PCRs (three to five loci per PCR, Table 1), in 15 µl solutions containing 13 μl of reaction mixture and 2 µl of template DNA. Reaction mixtures contained 0.5 U of Gotaq G2 Hotstart DNA polymerase (Promega), 1× PCR buffer, 0.25 mM of each dNTP, 2 mM of MgCl2, 0.1 mg/ml of bovine serum albumin, and primers in locus-specific concentrations (Table 1). We used a touchdown PCR method, performed by a T100 Thermal Cycler (Bio-RAD) with the following conditions: initial denaturation at 95 °C for 4 min, followed by ten cycles of 95 °C for 30 s, annealing for 30 s with temperature step-downs (1 °C at each cycle) starting at an initial temperature specific to each multiplex (Init. temp. in Table 1), and 72 °C for 30 s. This was followed by 20–25 final cycles of 95 °C for 30 s, final temperature (Fin. temp.) for 30 s, 72 °C for 30 s, and a final elongation at 72 °C for 10 min. PCR products were electrophoresed in a ABI 3130XL capillary sequencer (Applied Biosystems) together with the SM594 size marker [7] and electropherograms were analyzed using Genemapper v4 (Applied Biosystems). The number of alleles per locus, allelic richness, and observed and expected heterozygosity were estimated in Fstat vs. 2.9.3.2 [8]. This software was also used to test for Hardy–Weinberg equilibrium (Global test, option “HW within samples”, 10,000 permutations, Bonferroni correction applied), population differentiation, and linkage disequilibrium (option “between all pairs of loci in each sample”, 11,040 permutations). The presence of null alleles was tested using Micro-Checker vs. 2.2.3 [9]. Finally, the transferability of these markers was tested on three other species from the J. albifrons complex: J. praehirsuta (n = 74 males from five European populations), J. ischiosetosa (n = 18 males from two North-American populations), and J. forsmani (n = 8 males from one European population).

Results and discussion

The average number of alleles per locus for the two pooled J. albifrons populations (n = 49) was 4.73 ± 2.45 and the average gene diversity was 0.55 ± 0.23 (details per locus and population in Table 2). All loci were polymorphic (2–13 alleles per locus) except Ja80, which is nonetheless reported here because it was polymorphic in J. praehirsuta and J. forsmani (Table 2) and could thus be useful at least for these species. Microsatellites Ja01, Ja55, and Ja64 deviated significantly from HWE (p < 0.001 in one of the two populations). Micro-checker results suggested that null alleles might be segregating at these loci as well as three additional markers associated with large FIS values (Ja13, Ja27, and Ja58). Null alleles are often unavoidable in highly polymorphic species such as many marine invertebrates [10] and relevant microsatellite loci should be used only in analyses where their effect can be detected and corrected (e.g. parentage assignment). Moreover, the occurrence of null alleles is expected to be variable across geographic regions and species, so that the results reported here for two populations might not apply to other areas or species (our two samples came from nearby, albeit differentiated populations, FST = 0.01, p < 0.0001). Markers used in empirical studies should be chosen accordingly, and the multiplex design proposed here could be adapted. There was no linkage disequilibrium for any pair of loci.
Table 2

Polymorphism of Jaera albifrons microsatellite loci

LocusLingoz (n = 24)Inizan (n = 25)Cross-amplification (no. alleles)
No. allelesHoHeFIS No. allelesHoHeFIS J. praehirsuta (n = 74) J. ischiosetosa (n = 18) J. forsmani (n = 8)
Ja3040.630.640.03160.720.71−0.013756
Ja3740.390.670.41860.320.560.4329# 5# 4
Ja4140.460.45−0.01650.560.50−0.1131085
Ja9140.500.530.05330.600.56−0.137634
Ja0190.430.850.496*110.590.840.302223# 4#
Ja0270.710.730.03560.760.68−0.1181145
Ja3550.540.580.07440.640.660.035724
Ja4740.670.61−0.08740.400.550.278514
Ja5660.670.62−0.07140.280.350.200843
Ja5820.000.081.00020.080.270.713621
Ja9920.380.31−0.21120.360.35−0.029322
Ja2150.570.690.18360.520.700.2571263
Ja7140.680.760.10150.720.71−0.013129#
Ja7850.610.750.19750.710.70−0.00986# 4#
Ja9450.630.680.07850.560.700.198955
Ja2260.790.73−0.09460.520.580.1021062
Ja6420.040.310.869*20.120.350.662623
Ja6630.250.290.14020.160.15−0.06751#1
Ja801NANANA1NANANA412
Ja1390.540.710.24080.400.600.33216810
Ja2340.500.690.27570.760.71−0.078854
Ja3980.920.85−0.077120.880.890.0081525#
Ja5530.170.590.720*50.480.670.289934
Ja8220.290.25−0.15020.120.12−0.043222

The number of alleles, expected heterozygosity (He), observed heterozygosity (Ho) and FIS are given for each locus in two populations of the J. albifrons species (* indicates a significant deviation from HWE, p < 0.05). The number of alleles obtained through cross-amplification is given for samples of J. praehirsuta, J. ischiosetosa, and J. forsmani (# indicates amplification success below 85 %, see text). Loci presented in the same order as in Table 1

Polymorphism of Jaera albifrons microsatellite loci The number of alleles, expected heterozygosity (He), observed heterozygosity (Ho) and FIS are given for each locus in two populations of the J. albifrons species (* indicates a significant deviation from HWE, p < 0.05). The number of alleles obtained through cross-amplification is given for samples of J. praehirsuta, J. ischiosetosa, and J. forsmani (# indicates amplification success below 85 %, see text). Loci presented in the same order as in Table 1 Cross-species amplification was considered successful if more than 85 % of the individuals tested produced a good quality genotype at the first attempt and without optimization. With this criterion, 23 out of 24 microsatellite markers successfully amplified in J. praehirsuta (n = 74), 20 in J. ischiosetosa (n = 18) and 20 in J. forsmani (n = 8). These loci appeared to be polymorphic in nearly all cases (Table 2). These markers seem readily transferable to other species for European populations of J. praehirsuta and J. forsmani, and even to North-American populations in the case of J. ischiosetosa. The panel of microsatellites reported here thus provides a useful set of markers for parentage analyses and studies of the interspecific genetic structure within the J. albifrons complex.

Availability of supporting data

The sequences containing microsatellite motifs are available through the National Centre for Biotechnology Information under accession numbers KP749875 to KP749898 (http://www.ncbi.nlm.nih.gov/).
  3 in total

1.  QDD: a user-friendly program to select microsatellite markers and design primers from large sequencing projects.

Authors:  Emese Meglécz; Caroline Costedoat; Vincent Dubut; André Gilles; Thibaut Malausa; Nicolas Pech; Jean-François Martin
Journal:  Bioinformatics       Date:  2009-12-10       Impact factor: 6.937

2.  High-throughput microsatellite isolation through 454 GS-FLX Titanium pyrosequencing of enriched DNA libraries.

Authors:  Thibaut Malausa; André Gilles; Emese Meglécz; Hélène Blanquart; Stéphanie Duthoy; Caroline Costedoat; Vincent Dubut; Nicolas Pech; Philippe Castagnone-Sereno; Christophe Délye; Nicolas Feau; Pascal Frey; Philippe Gauthier; Thomas Guillemaud; Laurent Hazard; Valérie Le Corre; Brigitte Lung-Escarmant; Pierre-Jean G Malé; Stéphanie Ferreira; Jean-François Martin
Journal:  Mol Ecol Resour       Date:  2011-02-21       Impact factor: 7.090

3.  Anonymous nuclear DNA markers in the American oyster and their implications for the heterozygote deficiency phenomenon in marine bivalves.

Authors:  M P Hare; S A Karl; J C Avise
Journal:  Mol Biol Evol       Date:  1996-02       Impact factor: 16.240

  3 in total
  1 in total

1.  Geographically distinct patterns of reproductive isolation and hybridization in two sympatric species of the Jaera albifrons complex (marine isopods).

Authors:  Ambre Ribardière; Claire Daguin-Thiébaut; Céline Houbin; Jérôme Coudret; Caroline Broudin; Olivier Timsit; Thomas Broquet
Journal:  Ecol Evol       Date:  2017-06-09       Impact factor: 2.912

  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.