Literature DB >> 26504682

Characterization of 12 polymorphic SSR markers in Veronica subsect. Pentasepalae (Plantaginaceae) and cross-amplification in 10 other subgenera.

Noemí López-González1, Eike Mayland-Quellhorst2, Daniel Pinto-Carrasco1, M Montserrat Martínez-Ortega1.   

Abstract

PREMISE OF THE STUDY: Microsatellite primers were developed in the perennial herbs of the diploid-polyploid complex Veronica subsect. Pentasepalae (Plantaginaceae) to investigate the role that hybridization has played in the evolution of the group, which includes several endangered species. METHODS AND
RESULTS: Twelve pairs of primers leading to polymorphic and readable markers were identified and optimized from V. jacquinii and V. orbiculata using a microsatellite-enriched library method and 454 GS-FLX technique. The set of primers amplified dinucleotide to pentanucleotide repeats, and the number of alleles per locus ranged from one to six, one to 11, and one to nine for V. orsiniana, V. javalambrensis, and V. rosea, respectively. Transferability analyses were performed in 20 species corresponding to 10 different subgenera.
CONCLUSIONS: These results indicate the utility of the newly developed microsatellites across Veronica subsect. Pentasepalae, which will help in the study of gene flow patterns and genetic structure.

Entities:  

Keywords:  Plantaginaceae; Veronica subsect. Pentasepalae; conservation; hybridization; polyploid complex

Year:  2015        PMID: 26504682      PMCID: PMC4610313          DOI: 10.3732/apps.1500059

Source DB:  PubMed          Journal:  Appl Plant Sci        ISSN: 2168-0450            Impact factor:   1.936


The genus Veronica L. (Plantaginaceae) comprises ca. 450 species, which are grouped into 12 subgenera with between two and 180 species each (Albach et al., 2004; Garnock-Jones et al., 2007). It includes some perennials of relative economic importance in ornamental horticulture and others that are well-known widespread weeds. Additionally, several species of Veronica are registered on the International Union for Conservation of Nature Red List (http://www.iucnredlist.org/) and other regional catalogs of endangered plants (e.g., Peñas de Giles et al., 2004), or are threatened plants with narrow distribution areas (e.g., Petrova and Vladimirov, 2009). Veronica subsect. Pentasepalae Benth. is a monophyletic diploid-polyploid complex and one of the four subsections currently recognized within the also monophyletic Veronica subgen. Pentasepalae M. M. Mart. Ort., Albach & M. A. Fischer (Albach et al., 2008). This subsection comprises ca. 20 perennial taxa and is represented in the temperate regions of Eurasia with one species in North Africa. The complex seems to be of recent origin and divergence, as many diploid representatives are still extant and short branches are found in the phylogenetic analyses based on ITS and plastid DNA sequence data (Rojas-Andrés et al., 2015). Although the diploid species are characterized by subtle morphological differences, each has been recovered as monophyletic in previous studies. Hybridization and polyploidization are widespread in the group, and several authors (Lehmann, 1937; Scheerer, 1949; Rojas-Andrés et al., 2015) have concluded that gene flow and complex relationships among polyploids and their diploid relatives might exist. Interestingly, some of the diploid and polyploid species belonging to Veronica subsect. Pentasepalae are Mediterranean orophytes that face a high risk of extinction with climate warming and/or grow in Important Plant Areas (IPAs; IPA online database: http://www.plantlifeipa.org/reports.asp), regions that display exceptionally rich floras of biogeographic interest (Rojas-Andrés et al., 2015). Given that current gene flow and introgression may have blurred species limits, particularly in hybrid zones, accurate investigations of gene flow patterns within and among Veronica subsect. Pentasepalae populations are necessary for conservation and species delimitation purposes.

METHODS AND RESULTS

Microsatellite development

For the microsatellite library, silica gel–dried leaves of 12 diploid individuals of V. jacquinii Baumg. and V. orbiculata A. Kern. were selected from eight different populations (Appendix 1). Ploidy level was checked using flow cytometry. A microsatellite library was prepared by Genoscreen (Lille, France) using a 454 GS-FLX (Roche Diagnostics, Meylan, France) high-throughput DNA sequencer (Malausa et al., 2011). Genomic DNA was extracted using the cetyltrimethylammonium bromide method described in Doyle and Doyle (1987). The DNA was fragmented and enriched with TG, TC, AAC, AAG, AGG, ACG, ACAT, and ACTC motifs. A total of 32,052 high-quality sequences were obtained. Analyses of these sequences with QDD software (Meglécz et al., 2010) revealed 3010 sequences with microsatellite motifs, for which 195 pairs of primers were obtained. Given that it is too time consuming and not affordable to check all of the primer pairs obtained, 54 of them with low primer pair penalty and different lengths and repeat motifs were selected. These primers were ordered (Eurofins, Ebersberg, Germany) to evaluate polymorphic loci on 12 individuals from the complex V. jacquiniiV. orbiculata. PCRs were performed in a total volume of 15 μL, which contained 1× PCR Green GoTaq Buffer (Promega Corporation, Madison, Wisconsin, USA), 0.25 mM of each dNTP (Life Technologies, Carlsbad, California, USA), 0.33 mM of each primer, 0.5 units GoTaq DNA Polymerase (Promega Corporation), and 18.2 ng of DNA template. PCRs used the following conditions: an initial step at 94°C for 2 min; followed by 35 cycles of 1 min at 94°C, 1 min at 50–58°C, and 50 s at 72°C; and a final extension of 15 min at 72°C. All the reactions were conducted on a Mastercycler pro S thermocycler (Eppendorf, Hamburg, Germany). The PCR products were separated by electrophoresis on a 2.5% agarose gel and sent to Macrogen Europe sequencing service (Amsterdam, The Netherlands). In a second step, those primers that were polymorphic in the V. jacquiniiV. orbiculata complex were tested in two individuals from three species, each from a different clade (V. orsiniana Ten. [core clade], V. javalambrensis Pau [Iberian clade], and V. rosea Desf. [North African clade]), using the same PCR conditions. Twelve polymorphic primer pairs were selected (see Appendix 2 for additional primers). Following the procedure developed by Schuelke (2000), the sequence-specific forward primers were marked at the 5′ end with an M13 tail (5′-TGTAAAACGACGGCCAGT-3′) (Eurofins), which was then labeled with 5-FAM, VIC, NED, or PET fluorescent dyes (Table 1) (Life Technologies). The PCR mix contained 1× PCR Green GoTaq (Promega Corporation), 0.2 mM of each dNTP, 0.16 mM of each reverse and fluorescent-labeled M13 primer, 0.04 mM of forward primer, 0.75 units GoTaq DNA Polymerase, and 50 ng of DNA template in a total volume of 15 μL. Conditions of the PCR amplification were as described above, adding 10 cycles of 1 min at 94°C, 1 min at 53°C, and 50 s at 72°C before the final extension. PCR products were analyzed with GeneMarker AFLP/Genotyping Software version 1.8 (SoftGenetics, State College, Pennsylvania, USA).
Table 1.

Characterization of 12 polymorphic nuclear microsatellite loci isolated from Veronica subsect. Pentasepalae.

LocusPrimer sequences (5′–3′)Fluorescent dyeRepeat motifAllele size range (bp)bTa (°C)GenBank accession no.
8F: TGATGTGACTGATTGGGTCAG5-FAM(TGA)592–9555KR698358
R: TTACCTCCTCATCACTCCCC
10F: TGAACAACACACAGGTTCAATTC5-FAM(AG)9113–11955KR698359
R: GGCTAGAAGTTGTGAAGAAGGG
13F: GCTTTTCTCGGTGAAAGGGTPET(TGAT)5113–13358KR698360
R: CACCATAATCCACAGCCTGA
19F: TCGAAACTTATTCGGCAACG5-FAM(ATT)5133–15755KR698361
R: GACTCACGAGTTTGGAAGCG
20F: TGGAGACCAAAATTCAACCCPET(AC)1193–13552KR698362
R: TCTTGTCTCCTACTCTCCTCCG
26F: ATGTCGACGTGTCAACTCCANED(CAA)687–10256KR698363
R: CACTTGTTTCCACAGCTGGC
27F: TATGGGAGACGACATGGTCAPET(TTGTG)6201–22155KR698364
R: CTCCCTTTCGTAGCAACACC
35F: CATTTAATGGTATCCGATGCGNED(TATC)7106–13052KR698365
R: TCGCTTTTCGATTTCTTCGT
49F: GGATGCTTTATTTTGTCTTGTVIC(TGGA)5222–24252KR698366
R: TGTTACGACATTTATGGTGATT
50F: TGTGATGCACAGAGTTTTAGTTVIC(AGA)6400–46050KR698367
R: TGAAAACATAACACCTCGATAA
52F: ATAAAAACATCCATACTTTCCGVIC(GTT)5358–39152KR698368
R: GTTAACCGCCAGTCTAACTAAT
54F: CCAAATATCAAATGATACCACANED(AC)13283–30152KR698369
R: TCGTAAAATTACGTCATCAAGA

Note: Ta = annealing temperature.

All values are based on 90 samples from three Veronica populations.

Range of fragment sizes does not include the M13 tail (5′-TGTAAAACGACGGCCAGT-3′) attached to the forward primer.

Characterization of 12 polymorphic nuclear microsatellite loci isolated from Veronica subsect. Pentasepalae. Note: Ta = annealing temperature. All values are based on 90 samples from three Veronica populations. Range of fragment sizes does not include the M13 tail (5′-TGTAAAACGACGGCCAGT-3′) attached to the forward primer.

Population genetics parameters in three further species from Veronica subsect. Pentasepalae

The first comprehensive phylogenetic analysis of Veronica subsect. Pentasepalae based on DNA sequence data revealed four main clades each corresponding to a broad geographic area (Rojas-Andrés et al., 2015). Thus, for the characterization of the microsatellite markers, diploid populations corresponding to species from different clades were selected (Appendix 1): V. orsiniana (core clade), V. javalambrensis (Iberian clade), and V. rosea (North African clade). The Central Asian clade was not considered because no material was available. The mean number of alleles per locus, observed and expected heterozygosities, possible deviations from Hardy–Weinberg equilibrium (HWE; Table 2), and tests for linkage disequilibrium between markers in each population were estimated using Arlequin version 3.5.1.2 (Excoffier and Lischer, 2010).
Table 2.

Results of initial primer screening of polymorphic loci in three populations corresponding to three different taxa belonging to Veronica subsect. Pentasepalae.

V. orsiniana (n = 30)V. javalambrensis (n = 30)V. rosea (n = 30)
LocusAHoHeHWEbAHoHeHWEbAHoHeHWEb
820.9330.5060.000***20.1670.1551.000 ns1
1020.0000.0660.017*130.0330.0970.017*
1320.1670.4400.001***60.5000.5000.388 ns1
1920.3330.4880.125 ns40.7000.6970.852 ns40.2330.2980.968 ns
2040.7000.5250.140 ns100.7670.8180.077 ns90.6900.7360.144 ns
26130.4330.4321.000 ns50.6900.7430.391 ns
2730.5000.5600.290 ns30.4830.3810.448 ns30.2330.2131.000 ns
3520.4000.4880.447 ns30.3330.4200.100 ns40.7690.6690.860 ns
49160.6330.7420.061 ns
5030.2330.2161.000 ns110.5670.7850.017*40.0370.2400.000***
521130.1360.2100.222 ns
5460.5670.7330.000***30.3670.3100.632 ns40.6000.4940.399 ns

Note: — = not amplified; A = number of alleles; He = expected heterozygosity; Ho = observed heterozygosity; HWE = Hardy–Weinberg equilibrium probabilities; n = number of individuals sampled.

See Appendix 1 for locality and voucher information for each population.

Deviations from HWE were not statistically significant (ns) and statistically significant at *P < 0.05, **P < 0.01, and ***P ≤ 0.001.

Results of initial primer screening of polymorphic loci in three populations corresponding to three different taxa belonging to Veronica subsect. Pentasepalae. Note: — = not amplified; A = number of alleles; He = expected heterozygosity; Ho = observed heterozygosity; HWE = Hardy–Weinberg equilibrium probabilities; n = number of individuals sampled. See Appendix 1 for locality and voucher information for each population. Deviations from HWE were not statistically significant (ns) and statistically significant at *P < 0.05, **P < 0.01, and ***P ≤ 0.001. The number of alleles per locus ranged from one to six, one to 11, and one to nine in the V. orsiniana, V. javalambrensis, and V. rosea populations, respectively. Loci 26, 49, and 52 were monomorphic in V. orsiniana, loci 10 and 52 were monomorphic in V. javalambrensis, and in V. rosea, loci 8 and 13 were monomorphic and locus 49 did not amplify. The observed and expected heterozygosities for all populations are shown in Table 2. Significant deviation from HWE (P < 0.05) was seen for loci 8, 10, 13, and 54 in V. orsiniana, for locus 50 in V. javalambrensis, and for loci 10 and 50 in V. rosea. Linkage disequilibrium showed significance levels below 0.05 after false discovery rate (FDR) correction in two pairwise comparisons (pair 20–52 in V. rosea and pair 27–54 in V. orsiniana).

Cross-amplification in other species from Veronica subsect. Pentasepalae and 10 subgenera of Veronica

Cross-amplification performed for these 12 polymorphic loci showed successful results within the expected allele size in two additional species from Veronica subsect. Pentasepalae: V. austriaca L. and V. dentata F. W. Schmidt. Tests were also performed for 20 additional species from 10 different subgenera within the large genus Veronica (Table 3). The tests were carried out with the original PCR protocol. The 12 loci tested in agarose gel showed successful amplification of at least several bands. Six of these (8, 10, 13, 19, 26, and 35) showed good amplification results in most samples.
Table 3.

Amplification success of all microsatellite primers across 20 species from 10 subgenera of Veronica.

SubgeneraCollector no.[a,b]Species81013192026273549505254
Veronica subg. Beccabunga (Hill) M. M. Mart. Ort., Albach & M. A. Fisch.DCA350V. gentianoidesws+w+
Veronica subg. BeccabungaDCA297V. gentianoidesss+ws+
Veronica subg. BeccabungaMO1598V. gentianoides+
Veronica subg. Chamaedrys (W. D. J. Koch) M. M. Mart. Ort., Albach & M. A. Fisch.KBch67V. chamaedrys subsp. chamaedryoidesssw+++w+s
Veronica subg. ChamaedrysKBch54V. vindobonensiss+w++s++s
Veronica subg. Cochlidiosperma (Rchb.) M. M. Mart. Ort. & AlbachDCA403V. cymbalaria+++swss+s
Veronica subg. CochlidiospermaHMM31V. cymbalaria++++wss+
Veronica subg. CochlidiospermaHMM32V. cymbalaria++++wss+
Veronica subg. CochlidiospermaHMM29V. panormitana+s++s+
Veronica subg. CochlidiospermaHMM30V. trichadena+s+s+w
Veronica subg. Pellidosperma (E. B. J. Lehm.) M. M. Mart. Ort., Albach & M. A. Fisch.DCAs434V. triphyllos+++wssws+w
Veronica subg. Pocilla (Dumort.) M. M. Mart. Ort., Albach & M. A. Fisch.DCA144V. filiformisw++swsw+
Veronica subg. PocillaDCA954V. filiformiss++sws++vs
Veronica subg. PocillaDCA892V. filiformiss++sw+++s
Veronica subg. Pseudolysimachium (W. D. J. Koch) M. M. Mart. Ort., Albach & M. A. Fisch.KB847V. orchideas+ws+s++s
Veronica subg. PseudolysimachiumKBps54V. orchidea+s++++w
Veronica subg. PseudolysimachiumKBps57V. orchideaws+w++w
Veronica subg. PseudolysimachiumBF11726V. incanaws+w++
Veronica subg. Pseudoveronica J. B. Armstr.PGJ2878V. speciosass+s+sss
Veronica subg. PseudoveronicaHMM69V. salicornioidesss+s+sss
Veronica subg. PseudoveronicaHMM38V. hectori subsp. coarctataws+s+sswss
Veronica subg. PseudoveronicaHMM39V. ochraceass+s+sssss
Veronica subg. PseudoveronicaHMM40V. planopetiolatas++s+sssss
Veronica subg. PseudoveronicaHMM37V. catarractaessws+ss+ss
Veronica subg. Stenocarpon (Boriss.) M. M. Mart. Ort., Albach & M. A. Fisch.LS1408V. fruticanssss+ss+sw++
Veronica subg. StenocarponDCA71V. fruticulosas+++ss+s+++
Veronica subg. Synthyris (Benth.) M. M. Mart. Ort., Albach & M. A. Fisch.DCA124V. missuricaw+w++++s+w
Veronica subg. VeronicaDCA114V. officinaliswwsww+ww+w

Note: + = successful amplification; — = no amplification; s = several bands; w = weak amplification.

Abbreviations (collector numbers): BF = Bozo Frajman; DCA = Dirk C. Albach; HMM = Heidi M. Meudt; KB = Katharina E. Bardy; LS = Lena Struwe; PGJ = Phil Garnock-Jones.

DNA samples are deposited at Carl von Ossietzky Universität Oldenburg (Germany).

Amplification success of all microsatellite primers across 20 species from 10 subgenera of Veronica. Note: + = successful amplification; — = no amplification; s = several bands; w = weak amplification. Abbreviations (collector numbers): BF = Bozo Frajman; DCA = Dirk C. Albach; HMM = Heidi M. Meudt; KB = Katharina E. Bardy; LS = Lena Struwe; PGJ = Phil Garnock-Jones. DNA samples are deposited at Carl von Ossietzky Universität Oldenburg (Germany).

CONCLUSIONS

A set of polymorphic microsatellite markers for Veronica subsect. Pentasepalae is reported. Amplification success for these markers in the cross-transferability tests extends their potential usefulness to other subgenera. These markers will be useful for investigating genetic parameters, which may provide essential information for the conservation of threatened species, as well as data on the role of interspecific hybridization in the evolution of the genus.
Appendix 1.

Voucher information for the Veronica samples used in this study.

SpeciesCollector no. (Herbarium code)[a,b]Collection country and localityGeographic coordinates
V. austriaca L. (n = 15)BR94 (SALA)Croatia. Gračac, Crnopac44°15′02.2″N, 15°48′35.5″E
V. catarractae G. Forst. (n = 1)HMM37 (OLD)cult. Germany ex UK nursery “Botany Plants” stock. Botanical Garden, OldenburgNA
V. chamaedrys L. subsp. chamaedryoides (Bory & Chaub.) M. A. Fisch. (n = 1)KBch67 (WU)Greece. Olympia37°51′47.0″N, 21°48′45.0″E
V. cymbalaria Bodard (n = 1)DCA403 (WU)Greece. VourakisNA
V. cymbalaria (n = 1)HMM31 (OLD)Turkey. Alanya Castle36°31′58.0″N, 31°59′25.0″E
V. cymbalaria (n = 1)HMM32 (OLD)Turkey. Selge37°13′04.0″N, 31°07′45.0″E
V. dentata F. W. Schmidt (n = 14)BR178 (SALA)Austria. Niederösterreich, Krems48°24′18.1″N, 15°31′04.4″E
V. filiformis Sm. (n = 1)DCA144 (WU)Germany. Bonn-Venusberg50°41′43.0″N, 07°06′10.0″E
V. filiformis (n = 1)DCA954 (MJG)Turkey. Cam Pass41°13′33.0″N, 42°27′44.0″E
V. filiformis (n = 1)DCA892 (MJG)Turkey. Uzungoel40°35′00.0″N, 40°19′00.0″E
V. fruticans Jacq. (n = 1)LS1408 (WU)USA. Seedling. Botanical Garden, New YorkNA
V. fruticulosa L. (n = 1)DCA71 (BONN)Germany. Seedling. Botanical Garden, BonnNA
V. gentianoides Vahl (n = 1)DCA350 (WU)Georgia. Terek-Tal42°34′51.6″N, 44°25′12.0″E
V. gentianoides (n = 1)DCA297 (WU)Georgia. Kreuzpass42°31′02.0″N, 44°28′00.0″E
V. gentianoides (n = 1)MO1598 (SALA)Georgia. Great Caucasus, Monument Bidara42°29′33.0″N, 44°27′10.0″E
V. hectori Hook. f. subsp. coarctata (Cheeseman) Garn.-Jones (n = 1)HMM38 (OLD)cult. Germany ex New Zealand. Botanical Garden, BonnNA
V. incana L. (n = 1)BF11726 (WU)Serbia. Grgurevci45°06′36.0″N, 19°40′05.0″E
V. jacquinii Baumg. (n = 2)cBR108 (SALA)Bosnia-Herzegovina. Trebinje42°41′02.1″N, 18°17′49.2″E
V. jacquinii (n = 2)cBR112 (SALA)Croatia. Dubrovnik, Gromača42°43′28.0″N, 18°01′4.0″E
V. jacquinii (n = 1)cSA389 (SALA)Montenegro. Kotor, Lovćen42°25′04.9″N, 18°47′38.8″E
V. jacquinii (n = 2)cSA390 (SALA)Montenegro. Kotor, Lovćen42°25′04.9″N, 18°47′38.8″E
V. jacquinii (n = 1)cSA391 (SALA)Montenegro. Žabljak43°09′49.6″N, 19°09′00.3″E
V. javalambrensis Pau (n = 30)cDP1278 (SALA)Spain. Burgos. Ciruelos de Cervera41°54′50.4″N, 3°29′47.9″W
V. missurica Raf. subsp. major (Hook.) M. M. Mart. Ort. & Albach (n = 1)DCA124 (K)England. Seedling. Botanical Garden, KewNA
V. ochracea (Ashwin) Garn.-Jones (n = 1)HMM39 (OLD)cult. Germany ex New Zealand. Botanical Garden, BonnNA
V. officinalis L. (n = 1)DCA114 (K)England. Seedling. Botanical Garden, KewNA
V. orbiculata A. Kern. (n = 1)aBR110 (SALA)Croatia. Pelješac peninsula42°56′14.2″N, 17°22′39.5″E
V. orbiculata (n = 2)cMO5547 (SALA)Croatia. Prapatnice43°13′16.1″N, 17°21′35.0″E
V. orbiculata (n = 1)cSA392 (SALA)Montenegro. Žabljak43°09′49.6″N, 19°09′00.3″E
V. orchidea Crantz (n = 1)KBps57 (WU)Bulgaria. Lovech43°01′59.0″N, 24°18′09.0″E
V. orchidea (n = 1)KBps54 (WU)Bulgaria. Lovech43°10′49.0″N, 24°44′56.0″E
V. orchidea (n = 1)KB847 (WU)Hungary. Szabolcs-Szatmár-Bereg47°45′02.0″N, 21°52′02.0″E
V. orsiniana Ten. (n = 30)cMO6056 (SALA)Spain. Teruel. Iglesuela del Cid40°27′35.9″N, 0°18′46.5″W
V. panormitana Tineo ex Guss. (n = 1)HMM29 (OLD)Turkey. North of Paravallar36°40′02.0″N, 31°53′03.0″E
V. planopetiolata G. Simpson & J. S. Thomson (n = 1)HMM40 (OLD)New Zealand. Shotover Saddle44°31′21.6″S, 168°40′24.0″E
V. rosea Desf. (n = 30)cDP1368 (SALA)Morocco. Meknès-Tafilalet, Midelt32°36′21.1″N, 4°48′39.7″W
V. salicornioides Hook. f. (n = 1)HMM69 (OLD)cult. Kew ex New Zealand. Botanical Garden, KewNA
V. speciosa R. Cunn. ex A. Cunn. (n = 1)PGJ2878 (OLD)cult. New Zealand ex cult. New Zealand. WellingtonNA
V. trichadena Jord. & Fourr. (n = 1)HMM30 (OLD)Spain. Mallorca, Camí des RaiguerNA
V. triphyllos L. (n = 1)DCAs434 (OLD)Germany. Seedling. Botanical Garden, OldenburgNA
V. vindobonensis M. A. Fisch. (n = 1)KBch54 (WU)Hungary. Heves megye47°50′19.0″N, 19°57′44.0″E

Note: n = number of individuals used in the population genetic analyses; NA = not available.

Abbreviations (collector numbers): BF = Bozo Frajman; BR = Blanca M. Rojas-Andrés; DCA = Dirk C. Albach; DP = Daniel Pinto-Carrasco; HMM = Heidi M. Meudt; KB = Katharina E. Bardy; LS = Lena Struwe; MO = M. Montserrat Martínez-Ortega; PGJ = Phil Garnock-Jones; SA = Santiago Andrés-Sánchez.

Herbarium specimens are deposited at the herbaria of Universidad de Salamanca (SALA), Universität Wien (WU), University of Bonn (BONN), Royal Botanic Gardens, Kew (K), Johannes Gutenberg-Universität (MJG), and Carl von Ossietzky Universität Oldenburg (OLD); DNA samples are deposited at Biobanco de ADN Vegetal (Universidad de Salamanca) and Carl von Ossietzky Universität Oldenburg (Germany).

Populations used to generate the data included in Appendix 2.

Appendix 2.

Primers rejected during the study and reason for discarding.

LocusPrimer sequences (5′–3′)Repeat motifPCR product sizeGenBank accession no.Ta (°C)Discarding reason
1F: TGATAGGGTTTGTGCGTGAG(TTG)6146KT00518152Suboptimal quality of the sequences
R: TGTCGACCAAACCAAAACAA
2F: CCCTTTGGAGTTGTTATGATCG(AT)5149Unsuccessful amplification
R: GAATGAACGGTTTAAGTGGACA
3F: AACAAATCATAAGCAATGCCA(TA)5208KT00518258Monomorphic
R: CGCTAGTGTCATCATGTTATGC
4F: AATTAAATTTCGCGGATCCTT(TC)14157Unsuccessful amplification
R: CGGTCTTACCAATGGCAGAT
5F: GCTGGAAAGAAAACCCAACA(ACA)5104KT00518350Suboptimal quality of the sequences
R: TTGCATTGGATTTTGAACCA
6F: CGAAATCAGAATCAACACCAA(AAC)692KT00518452Suboptimal quality of the sequences
R: GAATCATCGATTGGGATCTTT
7F: CCCGAGTAGCGCTTGTTTTA(TC)8152Unsuccessful amplification
R: CACGAGTATGGGACGATTCA
9F: GCACGGAAACAACATGAACA(AG)8267KT00518552Unsuccessful amplification in the Iberian clade
R: TCCCCATCATAATCACAATCA
11F: TTGTTGGTTTTGGTTTGTGG(CTT)1291Unsuccessful amplification
R: GATGAACTCCAATCTACCCCA
12F: GCCACGGAGACTCAGGTTAG(GTT)5132KT00518655Suboptimal quality of the sequences
R: TGACGAATAGCAATAGACAACGA
14F: AAAGATAATTGTCCTAAAGTTAAGGGG(ATGG)6140Unsuccessful amplification
R: GCAGCATTATGCAGGTAGATT
15F: ACGCTTGAACGCGTCTAACA(GT)6144KT00518754Monomorphic
R: AGATCCCCACTCACGATCTC
16F: ATCGAGGACGGATTTAGGCT(GTA)5113KT00518856Monomorphic
R: AAGTGCCCTTTCCTCCAAAC
17F: GAGTGATCGAAAGATTGCATTAAG(GTG)6148KT00518954Suboptimal quality of the sequences
R: TCCTCCCTAATTCCTCCGAC
18F: TTGAATATCAGGATCTTGTGCG(TCT)691KT00519058Suboptimal quality of the sequences
R: AAGTAATATGTCCATAAGTTCATCAGG
21F: AGAGGATGAAGACTCAGGCG(GAA)9140Unsuccessful amplification
R: TGTCAGCTTTGGTGGAAGAA
22F: GACGACGATCATCCAGATCC(AGA)6147KT00519152Presence of indels
R: CCGATTTCCTTTCGAATCAT
23F: AAACTTGTGAAACTGTTTGAATGG(CA)590Unsuccessful amplification
R: ATGCTCAGCGGAAGTATTTGA
24F: TTCCGATATTTCCGTTCTGC(GAG)6142KT00519252Presence of indels
R: CCATTCTACCCTCCGAACAA
25F: GCACAAGGTAGCATTTGCATT(TTG)9142Unsuccessful amplification
R: AGGGCGGGTAAAGGATAGAA
28F: GTGTTCGTGTTTTAAATTTGCTT(GAG)11141Unsuccessful amplification
R: TCACTCATATACCTAGTGACTGAACTG
29F: TTGAATCCATTTCTTATTGGTTTG(TTC)790KT00519353Unsuccessful amplification in the Iberian clade
R: CAATCGTGGTAACACATCATGG
30F: CTTCCTTACCTCACCTCACTCTG(CAT)591KT00519453Suboptimal quality of the sequences
R: TGGTGTTTTGTTGATAGATTGATT
31F: GCCATTGCCTTGTTTTGAGT(GA)991Unsuccessful amplification
R: CATCAACCATGATCCATCCA
32F: ATTGAGCGACACTCGTCAGA(AC)7140KT00519552Monomorphic
R: CAATGGCTTTAAATGAATCCC
33F: TTCAGCTCATGACCAAGAACA(AAG)6123KT00519650Unsuccessful amplification in the Iberian clade
R: CAAATAGGGCATTCCGACAT
34F: TAAACAAACAGATTGGTGGTCG(TAA)6190KT00519754Unsuccessful amplification in the Iberian clade
R: CCTTATGTCACTGAAAACCTACCT
36F: CGGTGCCAAATTAAGATATTG(ACTC)5182Unsuccessful amplification
R: GCGGTGAAGAAAGGTTTTGA
37F: TGCACCCCTACTCGAGAAAT(CT)8120Unsuccessful amplification
R: TCCATTTAATTGTAAGCCCCA
38F: ACAGGTTGTGCGGAAGAAGT(TGT)9155KT00519852Suboptimal quality of the sequences
R: GTGTGCCAACAAATCAAGGA
39F: GAAAAGAATTACCAACACGC(AAAG)693Unsuccessful amplification
R: TTAAGGCCTAGCTAGCAGAA
40F: ATCTCCAAAACTCAGATCCA(AAC)686Unsuccessful amplification
R: TTAAGGCCTAGCTAGCAGAA
41F: TCATAGCTTCTTCTCTTCGG(CTT)585Unsuccessful amplification
R: TATGATGGCCTTCAAAACAT
42F: TGTATTATTCTATGAGACGCCA(TG)16193KT00519952Suboptimal quality of the sequences
R: GTGAGAAGACATATGAAAAGCA
43F: ACGATAACTTTCCGGTGAA(GA)8179Unsuccessful amplification
R: CAACCATTTTCTTCATACACAG
44F: CTTTTAAATGTCTTTCTGGAGG(TTG)5179KT00520052Monomorphic
R: ATGTCCTTCATAGTAAACGTCC
45F: CTTATCCTTGAATTTCATCTCC(ACA)6174KT00520152Presence of indels
R: GATTATTTTACGGTTAGACGGA
46F: AAGCTTGAGTGGATTAAATGTT(GTT)6239KT00520255Presence of indels
R: AACTCTTACCACCTCAAATCAC
47F: AGTAATCAATTCTCACTTGGCT(TC)5236KT00520353Monomorphic
R: ACAACCCTAGTTCATACCAAAG
48F: TGAACAAATGTACAGCTAGAGG(TG)9246KT00520454Presence of indels
R: GATGAGGAGAAGGAGTGTATGT
51F: ATTGTTGTATATGCGAATCTTG(CA)8303Unsuccessful amplification
R: TTCCATGTAAATTTCACTACCA
53F: GAATACATTCAGACCACGTCTT(TC)8301KT00520552Unsuccessful amplification in the Iberian clade
R: AAACGATAGAGTCTCAAGAGGA

Note: — = no information available; Ta = annealing temperature.

  4 in total

1.  An economic method for the fluorescent labeling of PCR fragments.

Authors:  M Schuelke
Journal:  Nat Biotechnol       Date:  2000-02       Impact factor: 54.908

2.  QDD: a user-friendly program to select microsatellite markers and design primers from large sequencing projects.

Authors:  Emese Meglécz; Caroline Costedoat; Vincent Dubut; André Gilles; Thibaut Malausa; Nicolas Pech; Jean-François Martin
Journal:  Bioinformatics       Date:  2009-12-10       Impact factor: 6.937

3.  High-throughput microsatellite isolation through 454 GS-FLX Titanium pyrosequencing of enriched DNA libraries.

Authors:  Thibaut Malausa; André Gilles; Emese Meglécz; Hélène Blanquart; Stéphanie Duthoy; Caroline Costedoat; Vincent Dubut; Nicolas Pech; Philippe Castagnone-Sereno; Christophe Délye; Nicolas Feau; Pascal Frey; Philippe Gauthier; Thomas Guillemaud; Laurent Hazard; Valérie Le Corre; Brigitte Lung-Escarmant; Pierre-Jean G Malé; Stéphanie Ferreira; Jean-François Martin
Journal:  Mol Ecol Resour       Date:  2011-02-21       Impact factor: 7.090

4.  Arlequin suite ver 3.5: a new series of programs to perform population genetics analyses under Linux and Windows.

Authors:  Laurent Excoffier; Heidi E L Lischer
Journal:  Mol Ecol Resour       Date:  2010-03-01       Impact factor: 7.090

  4 in total
  3 in total

1.  Transcriptomic resources and marker validation for diploid and polyploid Veronica (Plantaginaceae) from New Zealand and Europe.

Authors:  Eike Mayland-Quellhorst; Heidi M Meudt; Dirk C Albach
Journal:  Appl Plant Sci       Date:  2016-10-18       Impact factor: 1.936

2.  Microsatellite markers: what they mean and why they are so useful.

Authors:  Maria Lucia Carneiro Vieira; Luciane Santini; Augusto Lima Diniz; Carla de Freitas Munhoz
Journal:  Genet Mol Biol       Date:  2016-08-04       Impact factor: 1.771

3.  Microsatellite marker development for the tetraploid Veronica aragonensis (Plantaginaceae) using next-generation sequencing and high-resolution melting analyses.

Authors:  Nélida Padilla-García; Teresa Malvar-Ferreras; Josie Lambourdière; M Montserrat Martínez-Ortega; Nathalie Machon
Journal:  Appl Plant Sci       Date:  2018-06-05       Impact factor: 1.936

  3 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.