Literature DB >> 26504574

Morphological characteristics, anatomical structure, and gene expression: novel insights into gibberellin biosynthesis and perception during carrot growth and development.

Guang-Long Wang1, Fei Xiong2, Feng Que1, Zhi-Sheng Xu1, Feng Wang1, Ai-Sheng Xiong1.   

Abstract

Gibberellins (GAs) are considered potentially important regulators of cell elongation and expansion in plants. Carrot undergoes significant alteration in organ size during its growth and development. However, the molecular mechanisms underlying gibberellin accumulation and perception during carrot growth and development remain unclear. In this study, five stages of carrot growth and development were investigated using morphological and anatomical structural techniques. Gibberellin levels in leaf, petiole, and taproot tissues were also investigated for all five stages. Gibberellin levels in the roots initially increased and then decreased, but these levels were lower than those in the petioles and leaves. Genes involved in gibberellin biosynthesis and signaling were identified from the carrotDB, and their expression was analyzed. All of the genes were evidently responsive to carrot growth and development, and some of them showed tissue-specific expression. The results suggested that gibberellin level may play a vital role in carrot elongation and expansion. The relative transcription levels of gibberellin pathway-related genes may be the main cause of the different bioactive GAs levels, thus exerting influences on gibberellin perception and signals. Carrot growth and development may be regulated by modification of the genes involved in gibberellin biosynthesis, catabolism, and perception.

Entities:  

Year:  2015        PMID: 26504574      PMCID: PMC4595985          DOI: 10.1038/hortres.2015.28

Source DB:  PubMed          Journal:  Hortic Res        ISSN: 2052-7276            Impact factor:   6.793


Introduction

Plant growth and development is a complex process that involves differentiation and morphogenesis. Hormonal regulation is recognized as a key process in plant growth and development[1]. For example, gibberellins (GAs) are phytohormones that play essential roles in plant growth and developmental stages, including seed germination, flowering, sex expression, and leaf and fruit senescence[2,3]. It has been reported that GA-mediated plant growth is mainly achieved by promoting cell elongation in plants[4]. Further studies indicate that GAs also regulate cell production to control plant growth[5]. Inadvertently, GA was first discovered in the fungus Gibberella fujikuroi [6]. To date, more than 100 GAs have been identified in plants, fungi, and bacteria; however, only a few GAs exhibit biological activities. GA1, GA3, GA4, and GA7 are the major bioactive GAs; other GAs are non-bioactive and act as precursors of the bioactive forms[7]. To understand the roles of GAs in plant growth and development, researchers should investigate the regulation and response of GAs in plants. In higher plants, GAs originate from geranylgeranyl diphosphate (GGPP), which is synthesized from isopentenyl pyrophosphate (IPP)[8]. GGPP is then converted into ent-kaurene by ent-copalyl diphosphate synthase (CPS) and ent-kaurene synthase (KS). Ent-kaurene is oxidized to GA12-aldehyde, a precursor of all GAs. Finally, GA12-aldehyde is then transformed into various GAs in a process catalyzed by GA20-oxidase (GA20ox), GA3-oxidase (GA3ox), GA2-oxidase (GA2ox), and other enzymes[9,10] (Figure 1). Biochemical, molecular, and genetic studies have shown that genes that encode the enzymes in this pathway are essential for GA accumulation and plant growth[11-13]. The downregulation of the StGA3ox genes in potato alters GA content and affects plant and tuber growth[14]. Similarly, PsGA3ox1 transgene expression exhibits higher GA1 levels and alters GA biosynthesis and catabolism gene expression as well as plant phenotype[15]. Gibberellin metabolism, stem growth, and biomass production in tobacco (Nicotiana tabacum) either increase or decrease when AtGA20ox or AtGA2ox is overexpressed[16]. Thus, the genes involved in GA biosynthesis and catabolism should be identified to better control GA accumulation and plant growth.
Figure 1

Proposed pathway for gibberellin (GA) biosynthesis in plants.

Hormone-mediated control of plant growth and development involves both synthesis and response[17]. DELLA proteins are major inhibitors of plant growth and development[18]. A bioactive GA binds to a GA receptor, namely, GIBBERELLIN INSENSITIVE DWARF1 (GID1), and forms a GA-GID1 complex; as a result, the degradation of DELLAs is triggered[19,20]. This mechanism is also called de-repression of GA. Further studies on Arabidopsis and rice have found that a specific ubiquitin E3 ligase complex (SCFSLY1/GID2) is required for this process[21]. In recent years, positive and negative factors of GA signaling were identified in higher plants[22]. SLEEPY1 (SLY1), GAMYB, and PICKLE act as positive regulators of gibberellin signaling[23,24]. Negative regulators of gibberellin signaling include SHORT INTERNODE (SHI), SPINDLY (SPY), and other proteins[25,26]. Chitin-inducible gibberellin-responsive protein (CIGR) may be involved in GA-mediated phosphorylation/dephosphorylation of DELLAs[27]. Carrot (Daucus carota L.), an Apiaceae plant, is commonly consumed worldwide for its nutritional value[28]. Carrot has also been the focus of many studies aimed at investigating the molecular biology of plants[29-31]. GA is essential for carrot somatic embryogenesis and is believed to play important roles in stem elongation, root growth, and flower initiation in carrot[32-36]. However, GA biosynthesis and response in carrot remain unclear. The regulation of GA biosynthesis and response may also differ among organs in the carrot. Thus, GA-mediated plant growth and development in carrot should be studied. Our work aimed to investigate GA metabolism and signaling during carrot growth and development. We attempted to gain more insight into GA biosynthesis and response in carrot. The results from this study also provide useful information for GA-mediated plant growth and development.

Materials and methods

Plant material and growth conditions

The seeds of D. carota L. cv. ‘Kurodagosun’ were cultivated in an artificial chamber at the Nanjing Agricultural University (32°02′N, 118°50′E). The plants were grown at 25°C for 16 h during the daytime followed by 18°C for 8 h in the dark. Samples were collected at 25, 42, 60, 75, and 90 days after sowing (DAS). Morphological characteristics and age were considered to verify the developmental stages. To ensure the accuracy of biochemical and molecular research, whole carrot taproot was collected at each developmental stage. For upper ground tissues, petioles and leaves from whole carrot plants were separately harvested at each developmental stage. The samples of whole taproot, petioles, and leaves were ground in a mortar. The samples were then randomly divided into two groups for GA determination and RNA isolation. Three biological replicates were performed at each collection time point.

Anatomical structure analysis

To examine the growth status of each plant, we investigated the changes in cell structure during carrot growth and development. Fresh samples were cut into small pieces and immediately stored in phosphate buffer (pH 7.2) with 2.5% glutaraldehyde. The slices were dehydrated with ethanol and then treated with epoxy propane. Subsequently, the samples were soaked and embedded in Spurr resin[37]. A Leica ultramicrotome (Germany) was used to cut the samples into thin sections (∼1 μm), which were stained with 0.5 % methyl violet for 10 min. Then, the slices were observed and then photographed under a Leica DMLS microscope (Germany).

Assay of bioactive GA levels

Samples were ground in a mortar with 10 mL of 80% methanol extraction solution containing 1 mM butylated hydroxytoluene. The extract was incubated at 4°C for 4 h and centrifuged at 3500g for 10 min. Supernatants were then filtered through Chromoseq C18 columns. Efflux was collected and dried with N2. Residues were dissolved in a phosphate-buffered saline (PBS) solution containing 0.1 % (v/v) Tween 20 and 0.1 % (w/v) gelatin (pH 7.5). The endogenous levels of bioactive GAs were then determined using an indirect enzyme-linked immunosorbent assay (ELISA) as previously described[38-40].

Total RNA extraction and cDNA synthesis

Total RNA was isolated from carrot roots, petioles, and leaves at different stages using an RNAsimple Total RNA Kit (Tiangen, Beijing, China) according to the manufacturer’s instructions. RNA quality and concentration was then assessed by gel electrophoresis and the use of a One-Drop spectrophotometer. To eliminate contaminating genomic DNA, we treated total RNA with gDNA Eraser for 2 min at 42°C (TaKaRa, Dalian, China).cDNA was synthesized using PrimeScript RT reagent kit (TaKaRa, Dalian, China) according to the manufacturer’s protocols. The cDNA was then diluted 10 times for quantitative real-time PCR (qRT-PCR) analysis.

Gene expression analysis by quantitative real-time PCR

To identify the genes involved in GA biosynthesis and response in carrot, GA-related genes of Arabidopsis and other plant species were aligned with the sequences in carrotDB, a genomic and transcriptomic database for carrot, which was built by our group (Lab of Apiaceae Plant Genetics and Germplasm Enhancement, http://apiaceae.njau.edu.cn/carrotdb/index.php)[29] (Figure S1–S29). Primers used for qRT-PCR were designed with Primer Premier 6 software (Tables 1 and 2). qRT-PCR was performed using SYBR Premix Ex Taq (TaKaRa, Dalian, China). Each reaction contained 2 μL of diluted cDNA strand, 10 μL of SYBR Premix Ex Taq, 7.4 μL of deionized water, and 0.4 μL of each primer, accumulating a final volume of 20 μL. PCR was strictly performed according to the following standards: 95°C for 30 s, followed by 40 cycles of 95°C for 5 s and 60°C for 30 s. The experiments were repeated with three independent samples, and the results were normalized against the carrot reference gene, namely, DcActin[31]. Data from DcGA2ox2 in carrot root at 22 DAS were selected as calibrators for gene expression analysis.
Table 1

Description of pathway-related genes and primers of genes used for qRT-PCR

NameGene IDPrimer sequences (forward/reverse)
DcKSID49567GCGATGGGATGTTGGCGAAGAA/CCGATTGGTGAACTCTGATTGTTGTC
DcKOID32899ATGGTCGCAACAAGTGATTATGATGAG/TCTCTGTTATTACGATGTCGCTTCTGA
DcKAO1ID50166CACAAGCGGCTGAGACGATTAACA/TTCGACCACTTATCCAATGCAGACTT
DcKAO2ID21746AAGAAGAGGAAGAAGATGAGTGATGGT/TCGTATCCTGCAATAACAAGACTGACA
DcGA20ox1ID43121AACCTAATATCGGATGCTCACAAGTCT/AGGTGGATGAGGTCTTCTTAGTAGAGT
DcGA20ox2ID18860AACACCAGAGAAGAACCAGAGTAACAT/GCCTGCCATGACTATGAAGGATGAA
DcGA20ox3ID44911CTTGGTATAGGTCCGTCGTATCTTAGG/ATGTAGGATCACAATGAGGTCCAGTTC
DcGA3ox1ID40044GGAAGAAATGGGATGGGTCACTGT/CCGTTGGTTAGTATGTGGAGCAGAT
DcGA3ox2ID17101AGACTCCCTGCTGCTCACCATTT/CCGATGCTCCTTCTCACTCACGAT
DcGA2ox1ID44237TGTTGATGACTGCCTACAGGTAATGAC/CATGAGTGAAGTTGATGGTGCAATCTT
DcGA2ox2ID47688ACTTATAATCAGAGCCTGCGAAGAACA/GGAAGGATTGGCGTCAAGTAAGAGAT
DcGA2ox3ID47590GCCGTTGATAGCGACCTAATGTTC/CCGTTGGATCTCAAGATGGTGAAGA
DcGA2ox4ID30452TTCAGTTCCAGCAGACCAAGACTC/GCTTGAGCAGTGAAGGCAATGG
DcGA2ox5ID34042TAACCAGCAGTCCCGAATCTCCAT/AAGCGTCCAGAATACACAGCCTTC
DcActinID41767CGGTATTGTGTTGGACTCTGGTGAT/CAGCAAGGTCAAGACGGAGTATGG
Table 2

Description of selected genes related to gibberellin perception and primers of genes for qRT-PCR

NameGene IDPrimer sequences (forward/reverse)
DcGID1aID427505GCAGCGGAATCAGGAATTGAAGTG/ATGCTCTCCAATACCAATCTCTGTCTC
DcGID1bID427507ATGCTTCGCCGTCCTGATGG/GCTGACCTATAAACACGATTGAGAAG
DcGID1cID427506AACATGCTTCGCCGTCCTGATG/GAACTGCGTTGGGAGGGACTTTG
DcDELLA1ID48205GTCGGATCTTGATGCTTCTATGCTTGA/TTGCTCCACAACCGTGACAATCTC
DcDELLA2ID31936CCTTCGCAGGATAACACGGATCATT/CCACAGCAACCATCACCTTCTCAA
DcDELLA3ID43703TTGAGCGACACGAGACACTGACT/GAGGTAGCAATAAGCGAGCGAGTG
DcSLY1ID28764GATAATTTCGCCGACAATTTCGCTGAT/GCCGTCTTGTTCCACTGCTTGT
DcCIGRID15901CGATAGATGTTAGCCTGCCGAGAG/CTCCAACTTGTAATGCTCCGAGTAAGA
DcPICKLE1ID46539ATGTCCAACTGCTGCTGCTGATAG/TTCCACTTCACAAGATACTGCTTCACA
DcPICKLE2ID48322AAGCGAGCTAGAACGAAGACAACC/CGATGGACTGAGTGAGATGAGATGAC
DcSPYID47859TGGAGAGTTGGAGTCTGCTATCACT/AATATGCCACGCCTTGGTTAATATCG
DcGAMYBID43195ACTATTCCAGCCAGTTGACTTCTCCT/GCGTCGTCTAATGAACTTCCACTAACA
DcSHI1ID460846GCCATTCAGCAGCCACTTAATCTC/AAGCATTGAGCGGAGTTGGATAGA
DcSHI2ID460843GGCAACCAAGCGAAGAAGGATTGTATA/CCAAGAATGTTCACCTGCTGTCTCT
DcSHI3ID34142CAACCTGGTCTCGGATCACTCAAG/CCGCAGTCCTGACAGCTTATGG

Statistical analysis

Differences in the GA levels during carrot development were detected using Duncan’s multiple-range test at a 0.05 probability level.

Results

Plant growth analysis

Over the course of growth and development, carrot tissues were harvested at 25, 42, 60, 75, and 90 DAS, respectively (Figure 2). The developmental stages were identified by age and growth indices. The root was white, and the fresh weight of the root was less than that of the shoot at 25 DAS. Up to 42 DAS, the root surface appeared orange, and the root, together with the petioles, was evidently elongated. Root weight and diameter significantly increased between 42 and 60 DAS. Subsequently, the root continued to enlarge, and the root became heavier than the shoot. However, root length presented no evident change (Figure 2).
Figure 2

Description of root weight and shoot weight during carrot growth and development. Carrot samples at 25, 42, 60, 75, and 90 days after sowing were harvested. Black lines in the lower left corner of each plant represent 3 cm in that pixel, whereas error bars represent standard deviation among three independent replicates. Data are the mean ± SD of three replicates.

Structural changes in the roots, petioles, and leaves

In the roots

At 25 DAS, the root was white, and the vascular cambium (VC) located between primary phloem (PP) and protoxylem (Px) did not show evident thickness (Figure 3A). At 42 DAS, the root surface appeared orange, and VC differentiated outward and inward, forming the secondary phloem (SP) and the secondary xylem (SX), respectively (Figure 3B). Subsequently, the root continued to enlarge (Figure 3C, F, and J).
Figure 3

Structural changes in the roots during carrot growth and development. The roots were harvested at 25 (A), 42 (B), 60 (C, D, and E), 75 (F, G, H, and I), and 90 (J, K, L, and M) days after sowing. Epidermis (Ep), parenchymalcell (PC), phellogen (Ph), primary phloem (PP), protoxylem (Px), starch granule (SG), secondary phloem (SP), vascular cambium (VC), and vessel (Ve) are marked in the figure. Scale bars in A, B, D, E, G, H, I, K, L, and M are 100 μm in length, whereas bars in C, F, and J are 1 cm in length.

In the petioles

The collenchyma (Co), which provides structural support for carrot growth, was very conspicuous under the microscope (Figure 4). As the plant grew, regions of Co, phloem (P), and xylem(X) were evidently enlarged, suggesting that constant thickness developed in the petioles.
Figure 4

Structural changes in the petioles during carrot growth and development. The petioles were harvested at 25 (A), 42 (B), 60 (C), 75 (D), and 90 (E) days after sowing. Collenchyma (Co), epidermis (Ep), exodermis (Ex), phloem (P), and xylem (X) were marked in the figure. Scale bars in A, B, C, D, and E are 100 μm in length.

In the leaves

At 25 DAS, the numbers of palisade and spongy cells were limited, and the cell arrangement was disordered (Figure 5A). Subsequently, the leaves expanded, and the cells in the palisade tissue (Pt) and spongy tissue (St) were compactly arranged (Figure 5B–E).
Figure 5

Structural changes in the leaves during carrot growth and development. The leaves were harvested at 25 (A), 42 (B), 60 (C), 75 (D), and 90 (E) days after sowing. Epidermis (Ep), palisade tissue (Pt), spongy tissue (St), and vascular (V) were marked in figure. Scale bars in A, B, C, D, and E are 100 μm in length.

Changes in bioactive GAs

The levels of bioactive GAs (GA1, GA3, GA4, and GA7) were analyzed in the roots, petioles, and leaves during carrot growth and development (Figure 6). For each plant, the bioactive GA contents in the leaves and petioles were higher than those in the roots. During carrot growth, the highest GA levels in the roots were observed at 42 DAS; this level subsequently decreased. However, GA levels in the petioles slightly changed, and the GA levels in the leaves relatively fluctuated.
Figure 6

Bioactive GAs levels in different tissues during carrot growth and development. Error bars represent the standard deviation among three independent replicates. Data are expressed as the mean ± SD of three replicates. Different lowercase letters represent significant differences at P <0.05.

Expression profiles of genes in the GA biosynthetic pathway during carrot growth and development

DcKS, DcKO, DcKAO1, DcKAO2, DcGA20ox1, DcGA20ox2, DcGA20ox3, DcGA3ox1, DcGA3ox2, DcGA2ox1, DcGA2ox2, DcGA2ox3, DcGA2ox4, and DcGA2ox5 were identified from our database. These genes were then selected for qRT-PCR to investigate their expression levels. Biosynthetic pathway-related genes were evidently regulated by carrot growth and development (Figure 7).
Figure 7

qRT-PCR analysis of genes involved in GA biosynthesis in different tissues during carrot growth and development. Error bars represent the standard deviation among three independent replicates. Data are expressed as the mean ± SD of three replicates.

In the roots, transcript levels of DcKS, DcKO, DcKAO1, DcGA3ox1, and DcGA2ox5 exhibited a similar pattern, in which an initial increase and a subsequent decrease were observed. In contrast, the mRNA level of DcGA20ox3 initially decreased and then increased. The mRNA levels of DcKAO2, DcGA20ox1, DcGA2ox2, and DcGA2ox3 initially decreased then increased and finally decreased again. Conversely, the mRNA level of DcGA2ox1 showed completely opposite results. However, DcGA20ox2, DcGA3ox2, and DcGA2ox4 constantly decreased over the course of the experiment. In the petioles and leaves, biosynthetic pathway-related genes were also significantly regulated by growth and development. For the same plant, the expression levels of these genes differed in different tissues. For example, the mRNA levels of DcKAO2 and DcGA3ox1 in the roots were lower than those in the petioles or leaves, whereas DcKO showed the highest level in the roots during carrot growth and development (Figure 7).

Expression profiles of GA-responsive genes during carrot growth and development

GA perception and subsequent signal transduction are essential for GA functions during plant growth. Thus, GA receptors should be identified to further increase our understanding of the GA signaling pathway. The genes involved in GA response, namely, GID1a, GID1b, GID1c, DcDELLA1, DcDELLA2, DcDELLA3, DcSLY1, DcCIGR, DcPICKLE1, DcPICKLE2, DcSPY, DcGAMYB, DcSHI1, DcSHI2, and DcSHI3 showed marked changes in mRNA levels during plant growth (Figure 8). In the roots, the transcript levels of DcGID1b and DcSLY1 were higher at 90 DAS and lower at 25 and 42 DAS. DcCIGR, DcSHI2, and DcSHI3 showed high expression at 25 and 42 DAS and consistently low expression at the last three time points. DcGID1a, DcGID1c, DcCIGR, DcPICKLE1, DcPICKLE2, DcSPY, DcGAMYB, and DcSHI1 were highly expressed at 60 DAS, whereas transcription of DcDELLA1 was highest at 75 DAS. In the petioles, transcription of DcDELLA3 was highest at 40 DAS. DcGID1b, DcGID1c, DcSLY1, DcCIGR, DcPICKLE2, DcSPY, and DcSHI1 showed high expression at 90 DAS. In the leaves, DcGID1c, DcDELLA1, DcDELLA2, DcCIGR, DcCIGR, DcPICKLE2, and DcSHI2 exhibited the highest mRNA abundance at 25DAS, whereas DcGID1a and DcGID1b showed high expression at 90 DAS.
Figure 8

qRT-PCR analysis of genes involved in GA response in different tissues during carrot growth and development. Error bars represent standard deviation among three independent replicates. Data are expressed as the mean ± SD of three replicates.

For the same plant, some genes, including DcDELLA1, DcDELLA2, DcDELLA3, DcCIGR, DcPICKLE1, DcSPY, DcSHI1, and DcSHI3, showed the lowest expression in the roots across all growth stages. However, expression patterns of other genes in different tissues may change during plant growth. DcGID1a, DcGID1b, DcDELLA1, DcDELLA2, DcDELLA3, DcSLY1, and DcCIGR were expressed at higher levels than other genes (Figure 8).

Discussion

Hormonal regulation is essential for plant growth and development[41,42]. Several classes of hormones have been identified, which are ascribed to growth regulation[43]. Among these hormones, GAs usually promote cell elongation[44]. Carrot, a root vegetable, is commonly consumed worldwide for its nutritional value. Carrot undergoes significant alterations in its tissues during plant growth. Our previous work suggested that some GA-related genes are differentially expressed at different carrot root developmental stages, indicating that GAs may play important roles in carrot root development[29,45]. Thus, GA accumulation and its potential role in carrot should be further investigated.

Carrot growth and structural development

In this study, marked elongation and differentiation was observed at 42 DAS, suggesting that this time point may be crucial for root development. Root enlargement can be attributed to the continuous differentiation of VC. A 42-day-old carrot may also be active in pigment accumulation because the root surface first appeared orange during this time[46,47]. The petiole, as a transport organ, was elongated and thickened during plant growth (Figure 4). The leaves also evidently expanded (Figure 5). Therefore, we aimed to investigate whether GAs are implicated in these processes and to determine the response of carrots to GAs.

GA content and functions

Our results found that the levels of bioactive GAs were higher in the leaves and petioles than in other parts (Figure 6). These findings indicated that GA biosynthesis and catabolism might be tissue-specific[48]. Previous studies have suggested that GAs are the major promoters of cell elongation[49-51]. In the current work, the existence of GAs in different tissues may provide constant stimuli for structure formation and development (Figures 3, 4, 5)[52]. In the roots, the highest levels of bioactive GAs were observed at 42 DAS when an enlargement occurred at the same time (Figure 3). Thus, GAs may play important roles in cell proliferation in carrot growth and development, which is consistent with the results reported by Ubeda-Tomás and colleagues[5].

GA biosynthesis and catabolism

GAs are present in all tissues and are essential for carrot growth. However, our results found that GA levels may differ in various carrot tissues. GA levels were also significantly altered during carrot growth. Thus, GA production and regulation should be understood. In this study, the expression levels of 14 genes involved in GA biosynthesis were studied during carrot growth and development. All of these genes responded to the growth stages, thereby eliciting evident influence on the GA levels. However, the expression patterns were incompletely consistent with the GA levels possibly because of the feedback mechanisms of GAs[53-55]. Other hormones may also play vital roles in GA biosynthesis and metabolism, indicating a complex mechanism of GA biosynthesis and catabolism[56,57]. DcKAO2, DcGA3ox1, and DcGA2ox3 also showed tissue-specific expression patterns. This interesting observation may partly explain the different GA levels in the different tissues.

GA response and regulators

GA perception and signaling transduction are also important for GA-mediated plant growth and development. A GA-GID1-DELLA signaling module has been extensively described[21,58]. A total of 15 receptors or acting components in this module were investigated using qRT-PCR during carrot growth. These genes were evidently regulated by carrot growth and development, and this result indicated that this module is also present in carrot. The transcripts of DcDELLA1, DcDELLA2, DcDELLA3, DcCIGR, DcPICKLE1, DcSPY, DcSHI1, and DcSHI3 were higher in the petioles and leaves than in the roots. This observation was consistent with the GA levels among different tissues, which indirectly suggested that bioactive GAs are produced at their site of action[59,60]. Interestingly, genes encoding DELLAs in the current study were expressed at high levels. Two main factors support this finding. First, high DcDELLA transcript levels suggested that DELLAs may be the main restraints in plant growth[61,62]. Second, DELLA homeostasis could balance or relieve the cues induced by GAs or other hormones[63], thereby stabilizing plant growth.

Conclusions

The morphological and anatomical structure of roots, petioles, and leaves were significantly altered during carrot plant growth. GAs may play important roles in the elongation and expansion of carrot tissues. The relative transcript levels of pathway-related genes may be the main cause for the different levels of bioactive GAs, therefore exerting influences on gibberellin perception and signals. Carrot growth and development may be regulated by modification of the genes involved in gibberellin biosynthesis, catabolism, and perception.

Authors’ contributions

Conceived and designed the experiments: Ai-Sheng Xiong and Guang-Long Wang. Performed the experiments: Guang-Long Wang, Fei Xiong, Feng Que, Zhi-Sheng Xu, and Feng Wang. Analyzed the data: Guang-Long Wang. Contributed reagents/materials/analysis tools: Ai-Sheng Xiong. Wrote the paper: Guang-Long Wang. Revised the paper: Guang-Long Wang and Ai-Sheng Xiong. All authors read and approved the final manuscript.
  57 in total

1.  A local maximum in gibberellin levels regulates maize leaf growth by spatial control of cell division.

Authors:  Hilde Nelissen; Bart Rymen; Yusuke Jikumaru; Kirin Demuynck; Mieke Van Lijsebettens; Yuji Kamiya; Dirk Inzé; Gerrit T S Beemster
Journal:  Curr Biol       Date:  2012-06-07       Impact factor: 10.834

2.  Elevated CO2 induces physiological, biochemical and structural changes in leaves of Arabidopsis thaliana.

Authors:  Nianjun Teng; Jian Wang; Tong Chen; Xiaoqin Wu; Yuhua Wang; Jinxing Lin
Journal:  New Phytol       Date:  2006       Impact factor: 10.151

3.  Identification and characterization of Arabidopsis gibberellin receptors.

Authors:  Masatoshi Nakajima; Asako Shimada; Yoshiyuki Takashi; Young-Cheon Kim; Seung-Hyun Park; Miyako Ueguchi-Tanaka; Hiroyuki Suzuki; Etsuko Katoh; Satoshi Iuchi; Masatomo Kobayashi; Tatsuya Maeda; Makoto Matsuoka; Isomaro Yamaguchi
Journal:  Plant J       Date:  2006-06       Impact factor: 6.417

4.  Gibberellin 3-oxidase gene expression patterns influence gibberellin biosynthesis, growth, and development in pea.

Authors:  Dennis M Reinecke; Aruna D Wickramarathna; Jocelyn A Ozga; Leonid V Kurepin; Alena L Jin; Allen G Good; Richard P Pharis
Journal:  Plant Physiol       Date:  2013-08-26       Impact factor: 8.340

5.  Genome-wide identification of gibberellins metabolic enzyme genes and expression profiling analysis during seed germination in maize.

Authors:  Jian Song; Baojian Guo; Fangwei Song; Huiru Peng; Yingyin Yao; Yirong Zhang; Qixin Sun; Zhongfu Ni
Journal:  Gene       Date:  2011-05-24       Impact factor: 3.688

6.  Involvement of gibberellin and cytokinin in the formation of embryogenic cell clumps in carrot (Daucus carota).

Authors:  Yoshihiko Tokuji; Kyoko Kuriyama
Journal:  J Plant Physiol       Date:  2003-02       Impact factor: 3.549

7.  Where do gibberellin biosynthesis and gibberellin signaling occur in rice plants?

Authors:  Miyuki Kaneko; Hironori Itoh; Yoshiaki Inukai; Tomoaki Sakamoto; Miyako Ueguchi-Tanaka; Motoyuki Ashikari; Makoto Matsuoka
Journal:  Plant J       Date:  2003-07       Impact factor: 6.417

8.  Developmental and hormonal regulation of gibberellin biosynthesis and catabolism in pea fruit.

Authors:  Jocelyn A Ozga; Dennis M Reinecke; Belay T Ayele; Phuong Ngo; Courtney Nadeau; Aruna D Wickramarathna
Journal:  Plant Physiol       Date:  2009-03-18       Impact factor: 8.340

9.  Carotenoid accumulation in orange-pigmented Capsicum annuum fruit, regulated at multiple levels.

Authors:  Laura Rodriguez-Uribe; Ivette Guzman; Wathsala Rajapakse; Richard D Richins; Mary A O'Connell
Journal:  J Exp Bot       Date:  2011-09-26       Impact factor: 6.992

10.  Selection of suitable reference genes for qPCR normalization under abiotic stresses and hormone stimuli in carrot leaves.

Authors:  Chang Tian; Qian Jiang; Feng Wang; Guang-Long Wang; Zhi-Sheng Xu; Ai-Sheng Xiong
Journal:  PLoS One       Date:  2015-02-06       Impact factor: 3.240

View more
  19 in total

1.  Transcriptome-based identification of genes revealed differential expression profiles and lignin accumulation during root development in cultivated and wild carrots.

Authors:  Guang-Long Wang; Ying Huang; Xin-Yue Zhang; Zhi-Sheng Xu; Feng Wang; Ai-Sheng Xiong
Journal:  Plant Cell Rep       Date:  2016-05-09       Impact factor: 4.570

2.  Genome-wide identification, expansion, and evolution analysis of homeobox genes and their expression profiles during root development in carrot.

Authors:  Feng Que; Guang-Long Wang; Tong Li; Ya-Hui Wang; Zhi-Sheng Xu; Ai-Sheng Xiong
Journal:  Funct Integr Genomics       Date:  2018-06-16       Impact factor: 3.410

3.  Elevated gibberellin altered morphology, anatomical structure, and transcriptional regulatory networks of hormones in celery leaves.

Authors:  Ao-Qi Duan; Kai Feng; Jie-Xia Liu; Feng Que; Zhi-Sheng Xu; Ai-Sheng Xiong
Journal:  Protoplasma       Date:  2019-06-05       Impact factor: 3.356

4.  Developmental processes and responses to hormonal stimuli in tea plant (Camellia sinensis) leaves are controlled by GRF and GIF gene families.

Authors:  Zhi-Jun Wu; Wen-Li Wang; Jing Zhuang
Journal:  Funct Integr Genomics       Date:  2017-02-24       Impact factor: 3.410

5.  Exogenous gibberellin enhances secondary xylem development and lignification in carrot taproot.

Authors:  Guang-Long Wang; Feng Que; Zhi-Sheng Xu; Feng Wang; Ai-Sheng Xiong
Journal:  Protoplasma       Date:  2016-06-22       Impact factor: 3.356

6.  Hypoxia enhances lignification and affects the anatomical structure in hydroponic cultivation of carrot taproot.

Authors:  Feng Que; Guang-Long Wang; Kai Feng; Zhi-Sheng Xu; Feng Wang; Ai-Sheng Xiong
Journal:  Plant Cell Rep       Date:  2018-04-21       Impact factor: 4.570

7.  Identification and Characterization of DcUSAGT1, a UDP-Glucose: Sinapic Acid Glucosyltransferase from Purple Carrot Taproots.

Authors:  Yi-Yun Chen; Zhi-Sheng Xu; Ai-Sheng Xiong
Journal:  PLoS One       Date:  2016-05-12       Impact factor: 3.240

8.  Transcript profiling of sucrose synthase genes involved in sucrose metabolism among four carrot (Daucus carota L.) cultivars reveals distinct patterns.

Authors:  Yan-Jun Liu; Guang-Long Wang; Jing Ma; Zhi-Sheng Xu; Feng Wang; Ai-Sheng Xiong
Journal:  BMC Plant Biol       Date:  2018-01-05       Impact factor: 4.215

9.  Transcriptional Regulation of Brassinosteroid Accumulation during Carrot Development and the Potential Role of Brassinosteroids in Petiole Elongation.

Authors:  Feng Que; Guang-Long Wang; Zhi-Sheng Xu; Feng Wang; Ai-Sheng Xiong
Journal:  Front Plant Sci       Date:  2017-08-11       Impact factor: 5.753

10.  Regulatory mechanism of GA3 on tuber growth by DELLA-dependent pathway in yam (Dioscorea opposita).

Authors:  Yunyi Zhou; Yuting Li; Mingxia Gong; Fang Qin; Dong Xiao; Jie Zhan; Aiqin Wang; Longfei He
Journal:  Plant Mol Biol       Date:  2021-06-17       Impact factor: 4.076

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.