Prevalence of Mycobacterium lentiflavum in cystic fibrosis patients, France.

BACKGROUND: Mycobacterium lentiflavum is rarely isolated in respiratory tract samples from cystic fibrosis patients. We herein describe an unusually high prevalence of M. lentiflavum in such patients.
METHODS: M. lentiflavum, isolated from the respiratory tract of cystic fibrosis patients, was identified using both rpoB partial sequencing and detected directly in the sputum by using real-time PCR targeting the smpB gene.
RESULTS: M. lentiflavum emerged as the third most prevalent nontuberculous mycobacterial species isolated in cystic fibrosis patients in Marseille, France. Six such patients were all male, and two of them may have fulfilled the American Thoracic Society clinical and microbiological criteria for M. lentiflavum potential lung infection.
CONCLUSIONS: M. lentiflavum was the third most common mycobacteria isolated in cystic fibrosis patients, particularly in six male patients. M. lentiflavum outbreaks are emerging particularly in cystic fibrosis patients.

Background

Mycobacterium lentiflavum is a fastidious nontuberculous mycobacterium (NTM) isolated from the respiratory tract, urine, lymph nodes and vertebral-bone specimens [1-4]. M. lentiflavum has seldom been reported in cystic fibrosis patients, at a much lower prevalence than Mycobacterium abscessus and Mycobacterium avium [5-8]. Moreover, its clinical significance is debated because M. lentiflavum is an environmental organism [9].

As we observed an unusual prevalence of M. lentiflavum isolates in clinical samples taken from patients suffering from respiratory diseases, the objective of this clinical study was to describe the potential opportunistic role of M. lentiflavum in cystic fibrosis.

Methods

Detection and isolation of M. lentiflavum

Respiratory tract specimens were prospectively collected and analyzed in the Reference Laboratory for Mycobacteria of the Institut Hospitalo-Universitaire Méditerranée Infection in Marseille, France. After decontamination using 4 % NaOH-N-acetyl-L-cysteine according to the manufacturer’s recommendations (MycoPrep, Becton Dickinson, Le Pont-de-Claix, France), each specimen was centrifuged and the pellet was microscopically examined after Ziehl-Neelsen staining. A 500-μL aliquot was simultaneously inoculated into a mycobacterial growth indicator tube (MGIT, Becton Dickinson, Le Pont-de-Claix, France) and onto a Coletsos slant (bioMérieux, La-Balme-les-Grottes, France) incubated at 37 °C in a 5 % CO2 atmosphere. After Ziehl-Neelsen staining confirmation of positive cultures, the isolates were identified using partial rpoB sequencing [10].

Direct detection of M. lentiflavum in sputum samples was conducted using a specific real-time PCR assay. Briefly, two primers and a probe were designed to specifically hybridize the M. lentiflavum smpB gene (Table 1). The specificity of this assay was checked in silico using the Basic Local Alignment Search Tool (BLAST) [10]. In vitro assessment of a collection of sixteen Mycobacterium species (including M. lentiflavum) previously identified by partial rpoB gene sequencing [11], yielded 100 % sensitivity and 100 % specificity for M. lentiflavum (Additional file 1).

Table 1

Probe and primer sequences and protocol for real-time PCR targeting Mycobacterium lentiflavum

Target gene	smpB
Primers
MlentismpB MBF	CAACTTGCACATTCCCGAGT
MlentismpB MBR	CCCGATCAGTGTGTCGATCT
Probe
MlentismpB MBR	6FAM-TCGCACTCGGAAGTTGTTGTTACATAGGC
Dilution	0.1 nmol/μL then 1/40

The extraction of DNA was performed using the EZ1 DNA tissue kit with a Qiagen EZ1 extractor Advanced XL (Qiagen, Courtaboeuf, France) according to the manufacturer’s recommendations. Real-time PCR was performed using a Biorad CFX96 thermocycler with the FAST qPCR MasterMix Plus No ROX kit (Eurogentec, Angers, France) according to the manufacturer’s recommendations: five minutes at 95 °C for activation, followed by 40 cycles of 95 °C for 10 s and 60 °C for 35 secons. Amplification products were analyzed using Biorad software

Statistical analysis

Statistical analysis was performed using EpiInfo v3.5.4 software; p < 0.05 was needed for statistical significance.

Ethics

This work was approved by the IFR48 local ethics committee at the Faculty of Medicine, under reference number 07–008. No written consent was needed for this work in accordance with the ‘LOI n° 2004–800 relative à la bioéthique’ [Law No. 2004–800 concerning bioethics] published in the Journal Officiel de la République Française on 6 August 2004 because no additional samples were obtained for the study.

Results and discussion

Between January 2010 and September 2014, respiratory tract specimens (sputum, bronchoalveolar lavages and bronchial aspirates) collected from 354 cystic fibrosis patients (235 adults ≥18 years and 119 children <18 years) with a female/male ratio of 199/155 (56.2 %) were analyzed for mycobacteria (mean of 13.1 collected specimen/patient).

In our series, 25/354 (7.1 %) cystic fibrosis patients (twelve children and thirteen adults) had at least one respiratory tract specimen that yielded NTM, including twelve (48 %) patients with M. abscessus complex mycobacteria, eight (32 %) patients with M. avium complex mycobacteria and six (24 %) patients with M. lentiflavum (Fig. 1); one patient had both M. avium and M. lentiflavum successively isolated during the study. A total of thirteen M. lentiflavum isolates were identified on the basis of 99.6 % ± 0.003 % similarity with the reference M. lentiflavum CIP 105465T partial rpoB sequence [GenBank:EU109300]. The six M. lentiflavum patients were co-infected by Staphylococcus aureus, Gram-negative bacilli and fungi and were all under azithromycin long-term low-dose prophylaxis (250 mg three times a week). In two patients, M. avium had been previously isolated in 2004 and 2012 from respiratory tract specimens (Table 2).

Fig. 1

Nontuberculous mycobacteria (NTM) isolated from 25/354 cystic fibrosis (CF) patients, January 2010 to September 2014, in Marseille, France. a The number of the patients with at least one respiratory tract specimen that yielded NTM is shown in bars. NTM are color-coded. M. hominissuis, Mycobacterium avium subsp. hominissuis; M. massiliense, Mycobacterium abscessus subsp. massiliense; M. bolletii: Mycobacterium abscessus subsp. bolletii. b Proportion of the pediatric (<18 years) and adult (>18 years) CF patients (nCF = 354) including 25 who yielded NTM including M. lentiflavum, M. avium complex and M. abscessus complex

Table 2

Clinical presentation of the six cystic fibrosis patients who yielded Mycobacterium lentiflavum isolates

	Mean	Standard deviation	Limits
Age, y	22.2	+/−11.4	[14.6 - 44.1]
Pedatric/Adults	3/3
Male, %	100
FEV, % predicted	67 %	+/−19 %	[46 – 93 %]
BMI, kg/m2	20	+/−1.9	[17.2 – 22.4]
Infected (met ATS criteria)a	2/6
Diabetes	3/6
Exocrine pancreatic disease	6/6
Pseudomonas aeruginosa	5/6
Stenotrophomonas maltophilia	4/6
Previous NTM isolationb	2/6
MS Staphylococcus aureus	6/6
Aspergillus sp.	5/6
Other co-infectionc	4/6
Azithromycin prophylaxisd	6/6
Lung transplanted after isolation	1/6

FEV forced expiratory volume, ATS American Thoracic Society, BMI body mass index, NTM nontuberculous mycobacteria, MS methicillin susceptible

aPatients who fulfilled the American Thoracic Society’s microbiological and clinical criteria for NTM pulmonary disease [12]

b Mycobacterium avium complex

c Nocardia sp., Penicillium sp., Serratia sp., Achromobacter sp., Scedosporium sp

d250mg per os three times a week

The female/male sex ratio of M. lentiflavum patients (0/6) significantly differed from that of the NTM positive cohort (199/155; 56.2 %) (p = 0.007, Fisher exact test) and from that of patients with another NTM (11/9; 55 %) (p = 0.02). It further differed from that of M. avium complex patients (5/3; 63 %) (p = 0.03) and that of M. abscessus complex patients (6/6; 50 %) (p = 0.054) (Fig. 2a). The six M. lentiflavum patients were aged 22.2 ± 11.4 y; the patients with another NTM were aged 22.1 ± 15.1 y; the M. avium complex patients were aged 26.5 ± 19.9 y; and the M. abscessus complex patients were aged 19.2 ± 10.9 y (no statistical significance; p = 0.56; ANOVA) (Fig. 2b).

Fig. 2

Sex-ratio (a) and age distribution (b) of the 354 cystic fibrosis (CF) patients and 25 patients who yielded nontuberculous mycobacteria (NTM) including Mycobacterium lentiflavum (n = 6), Mycobacterium avium complex (n = 8) and Mycobacterium abscessus complex (n = 12). * p < 0.05; ** p = 0.053; NS, p > 0.1

Two M. lentiflavum patients were clinically stable, had only one positive specimen and were classified as ‘colonized’ [12]. The four other M. lentiflavum patients had between two and four positive sputum specimens and in two of them, M. lentiflavum isolation occurred contemporaneously to the decline of their lung function and thus may fulfill the American Thoracic Society’s (ATS) criteria for NTM lung infection [12] (Additional file 2: Figure S1). Thereafter, the forced expiratory volume improved during antibiotic treatment for M. lentiflavum. One of these two infected patients, aged 17, underwent a double lung-transplant because of poor progression of cystic fibrosis, two years after M. lentiflavum infection had been treated with combined rifabutin, clarithromycin and ethambutol for fourteen months and amikacin for one week. At the four-month follow-up after transplantation, microbiological surveys did not yield any further M. lentiflavum from four separate bronchoalveolar lavages.

In this study, we confirmed the identification of M. lentiflavum, a fastidious organism usually isolated over a period of three weeks, using rpoB partial sequencing [10] and a specific real-time PCR assay targeting the M. lentiflavum smpB gene. Indeed, M. lentiflavum shares <96 % similarity regarding the rpoB gene sequence with closely related species, including Mycobacterium stomatepiae DSM 45059, Mycobacterium florentinum DSM 44852, Mycobacterium genavense FI-06288 and Mycobacterium triplex ATCC 700071 [GenBank:HM022213, HM022205, HM022216 and GQ153311]. Moreover, the routinely used 16S-23S rRNA intergenic spacer sequencing [5], hsp65 restriction fragment length polymorphism and sequencing [13], and commercial probes for M. avium complex [7, 8, 13] may not be sufficiently discriminative as, for example, M. lentiflavum shares > 99 % similarity in the 16S rRNA gene sequence with M. simiae [1].

M. lentiflavum has emerged over a five-year period as the third most prevalent NTM isolated from the respiratory tract in our cystic fibrosis cohort. Furthermore, we observed an unexpectedly higher prevalence of patients (6 out of 354; 1.7 %) showing M. lentiflavum isolation than other reported epidemiological surveys. Indeed, only one out of 2912 (0.03 %) French patients [5] and two out of 2970 (0.06 %) American patients [7] were reported in previous studies. In addition, a recent epidemiology survey of NTM isolated in cystic fibrosis patients in Turkey revealed nine M. lentiflavum isolates collected from one young male teenager out of 130 (0.8 %) cystic fibrosis patients [8]. The reason why M. lentiflavum has only been isolated in male cystic fibrosis patients remains unexplained. As reported by Bryant et al. [14], patient-to-patient contamination may be suspected although this type of cross-contamination is very rare and whole genome sequence analyses would probably be required to satisfactorily conclude a phylogenetic link and track transmission events. Moreover, the six patients described here were treated in two distinct centers (adult and pediatric) for cystic fibrosis. Environmental transmission is another hypothesis for such prevalence.

An in-lab contamination hypothesis has been proposed, and eleven non-cystic fibrosis patients yielded M. lentiflavum isolates (out of more than 800 patients (≈1.3 %) who yielded at least one mycobacterial isolate) during the same five-year period. This demonstrates that M. lentiflavum was isolated every two months on average and that the probability of in-lab cross-contamination does exist but remains low.

In order to detect M. lentiflavum rapidly in cystic fibrosis patients, we developed an ‘in-lab’ real-time PCR targeting the M. lentiflavum smpB gene. This real-time PCR proved its ability to identify all M. lentiflavum isolates specifically. Moreover, our preliminary results indicate that this real-time PCR may be used as a first screening step directly performed on heat-inactivated sputum specimens with good sensitivity and 100 % specificity. These results have to be compared with traditional laboratory tools (culture and AFB smears) to clarify its relevance for clinical practice [15] and have to be validated on larger series of prospectively-collected sputum specimens, including from patients who had previously yielded M. lentiflavum in sputum cultures.

M. lentiflavum had been considered to be a harmless organism. However, this interpretation was recently challenged by the publication of a few cases with disseminated M. lentiflavum infections [16-18]. In one case, hemophagocytic lymphohistiocytosis and disseminated M. lentiflavum infection in a heart-transplanted patient led to the death of this immune-compromised patient within ten days [18].

In the present study, two out of six patients fulfilled the ATS clinical and microbiological criteria for NTM lung disease [12] and had improved respiratory function while receiving specific antibiotic therapy. However, ATS criteria, while they continue to be applied to cystic fibrosis patients, are far from specific for such patients where radiographic findings, which are often associated with NTM, are commonplace irrespective of colonization. Moreover, clinical decline occurs in cystic fibrosis for a multitude of reasons. The antibiotic therapy our patient received is, moreover, active against a wide range of respiratory tract pathogens.

In our series, all patients were receiving long-term azithromycin therapy (Table 2). This use of macrolide in CF patients was shown to be a risk factor for NTM infection, especially with M. abscessus [19], by inhibiting intracellular killing of mycobacteria in macrophage by impairing autophagic and phagosomal degradation [20]. Such mechanisms may have played a role in the increase of M. lentiflavum isolation. However, as M. lentiflavum is usually susceptible to clarithromycin [8], the fact that patients were receiving macrolide and M. lentiflavum developed further supports the theory that this is either an environmental contaminant or a transient colonizer which has not been exposed to macrolide for prolonged periods.

Conclusion

M. lentiflavum was the third most common NTM isolated from male cystic fibrosis patients, although few respiratory cases had been previously reported, particularly in such patients. We propose monitoring cystic fibrosis patients’ respiratory tract samples for mycobacteria detection, to achieve this goal, we propose the use and development of specific molecular tools such as rpoB partial sequencing (or a specific real-time PCR which needs to be fully validated against traditional laboratory tools) to monitor the presence of M. lentiflavum in each cystic fibrosis center and reference laboratories for mycobacteria.