Simone Hettmer1,2,3,4,5, Anna C Schinzel6,7, Daria Tchessalova1,5, Michaela Schneider4, Christina L Parker8,9, Roderick T Bronson10, Nigel Gj Richards11, William C Hahn6,7, Amy J Wagers1,5. 1. Department of Stem Cell and Regenerative Biology, Harvard Stem Cell Institute, Harvard University, Cambridge, United States. 2. Department of Pediatric Oncology, Dana-Farber Cancer Institute, Boston, United States. 3. Pediatric Hematology/Oncology, Charité, University Hospital Berlin, Berlin, Germany. 4. Division of Pediatric Hematology and Oncology, Department of Pediatric and Adolescent Medicine, University Medical Center Freiburg, University of Freiburg, Freiburg, Germany. 5. Joslin Diabetes Center, Harvard Medical School, Boston, United States. 6. Department of Medical Oncology, Dana-Farber Cancer Institute, Boston, United States. 7. Broad Institute of Harvard and MIT, Cambridge, United States. 8. Summer Honors Undergraduate Program, Harvard Medical School, Boston, United States. 9. University of Maryland, Baltimore County, Baltimore, United States. 10. Department of Biomedical Sciences, Tufts University Veterinary School, North Grafton, United States. 11. Department of Chemistry and Chemical Biology, Indiana University - Purdue University Indianapolis, Indianapolis, United States.
Abstract
Current therapies for sarcomas are often inadequate. This study sought to identify actionable gene targets by selective targeting of the molecular networks that support sarcoma cell proliferation. Silencing of asparagine synthetase (ASNS), an amidotransferase that converts aspartate into asparagine, produced the strongest inhibitory effect on sarcoma growth in a functional genomic screen of mouse sarcomas generated by oncogenic Kras and disruption of Cdkn2a. ASNS silencing in mouse and human sarcoma cell lines reduced the percentage of S phase cells and impeded new polypeptide synthesis. These effects of ASNS silencing were reversed by exogenous supplementation with asparagine. Also, asparagine depletion via the ASNS inhibitor amino sulfoximine 5 (AS5) or asparaginase inhibited mouse and human sarcoma growth in vitro, and genetic silencing of ASNS in mouse sarcoma cells combined with depletion of plasma asparagine inhibited tumor growth in vivo. Asparagine reliance of sarcoma cells may represent a metabolic vulnerability with potential anti-sarcoma therapeutic value.
Current therapies for sarcomas are often inadequate. This study sought to identify actionable gene targets by selective targeting of the molecular networks that support sarcoma cell proliferation. Silencing of asparagine synthetase (ASNS), an amidotransferase that converts aspartate into asparagine, produced the strongest inhibitory effect on sarcoma growth in a functional genomic screen of mousesarcomas generated by oncogenic Kras and disruption of Cdkn2a. ASNS silencing in mouse and humansarcoma cell lines reduced the percentage of S phase cells and impeded new polypeptide synthesis. These effects of ASNS silencing were reversed by exogenous supplementation with asparagine. Also, asparagine depletion via the ASNS inhibitor amino sulfoximine 5 (AS5) or asparaginase inhibited mouse and humansarcoma growth in vitro, and genetic silencing of ASNS in mousesarcoma cells combined with depletion of plasma asparagine inhibited tumor growth in vivo. Asparagine reliance of sarcoma cells may represent a metabolic vulnerability with potential anti-sarcoma therapeutic value.
Soft-tissue sarcomas (STS) are a heterogeneous group of non-hematopoietic, mesodermal cancers. Certain STS types present with tissue-specific features, such as skeletal muscle differentiation in rhabdomyosarcoma (RMS) (Parham and Barr, 2013). For most STS tumors, cure depends on radical resection and/or radiation of the tumor, and therapeutic options for tumors that have spread regionally and/or systemically are limited (Linch et al., 2014). The genetic spectrum of STS is heterogeneous. Many tumors carry complex karyotypes with variable genetic changes; others express specific oncogenic mutations or exclusive chromosomal translocations within a relatively simple karyotype (Bovee and Hogendoorn, 2010). For RMS, two main genotypes have been described: those characterized by expression of the fusion oncogenes PAX3:FOXO1 or PAX7:FOXO1 and those that lack these fusions. The most common oncogenic mutations in the latter group of fusion-negative RMS tumors are in the Ras pathway (Shern et al., 2014; Chen et al., 2013).We previously reported rapid sarcoma induction by intramuscular implantation of Kras (G12V)-expressing, Cdkn2a (p16p19) deficient mouse myofiber-associated (MFA) cells into the extremity muscles of NOD. SCIDmice (Hettmer et al., 2011). Transcriptional profiling of Kras; p16p19sarcomas identified a cluster of sarcoma-relevant candidate genes. These genes are enriched in mousesarcomas and in human RMS as compared to normal mouse or human skeletal muscle (Hettmer et al., 2011), and may include transcripts of fundamental importance for sarcoma growth. To examine the contributions of each of these candidate genes to sarcoma growth, we performed a customized shRNA-based proliferation screen. The strongest inhibitory effect on sarcoma cell proliferation was observed after silencing of asparagine synthetase (ASNS), the enzyme that catalyzes cellular synthesis of the non-essential amino acid asparagine. We found that adequate availability of asparagine is required in rapidly proliferating sarcomas cells, likely to support nascent polypeptide synthesis, and that asparagine starvation impedes sarcoma growth. Thus, small molecules targeting asparagine availability (Richards and Kilberg, 2006) could be useful as anti-sarcoma therapeutics.
Results
Kras;p16p19mouse sarcomas identify a cluster of sarcoma-relevant genes
In prior work, we showed that ex-vivo lentiviral transduction with oncogenic Kras (G12v) of Cdkn2a (p16p19)-deficient myofiber-associated (MFA) cells, isolated by fluorescence activated cell sorting (FACS) from muscle tissue of Cdkn2amice, drives rapid sarcoma formation upon transplantation of these cells into the muscle of immunocompromised mice (Hettmer et al., 2011) (Figure 1—figure supplement 1). The myogenic differentiation status of the Ras-driven sarcomas generated in this system depends largely on the cell type transduced, also known as the “cell-of-origin”: Kras; p16p19 satellite cells typically gave rise to RMS, whereas the identical oncogenetic lesions introduced into fibroadipogenic precursors within the MFA cell pool almost always produced sarcomas lacking myogenic differentiation features (non-myogenic sarcomas, NMS) (Hettmer et al., 2011)(Figure 1—figure supplement 1). We previously showed that Kras;p16p19mouse sarcomas from each of these cellular origins recapitulate transcriptional profiles across the entire spectrum of human RMS and used this information to identify 141 genes of potential significance for sarcoma growth (Hettmer et al., 2011). To evaluate the functional contributions of each of the previously identified sarcoma-relevant genes, we designed a customized shRNA proliferation screen, using 5 distinct shRNAs per candidate gene (Supplementary files 1–4). The screen was carried out in one Kras;p16p19RMS and one Kras;p16p19NMS cell line, and shRNAs were delivered in puromycin-selectable pLKO lentiviral vectors. Correlation coefficients of 0.8348 and 0.9501 between puromycin-treated and untreated cells confirmed adequate transduction efficiencies (Figure 1A,F). As shRNA mediated silencing of Kras (G12v)-IRES-GFP, the driver oncogene used to initiate the mousesarcomas, markedly inhibits the growth of Kras;p16p19sarcoma cells (Figure 2A–B, Figure 2—figure supplement 1A–B), shRNAs directed against either GFP or KRAS served as positive controls in this screen and showed clear growth-inhibitory effects (Figure 1C–D, 1H-I). Control shRNAs (cntrl-shRNA) directed against LACZ, red fluorescent protein (RFP) and luciferase (LUC) served as negative controls, and showed no growth-inhibitory effects (Figure 1C–D, 1H-I). Receiver operator curve (ROC) analysis, using an external control set of shGFP-infected and cntrl-shRNA-infected RMS and NMS cells (Supplementary files 3–4), validated the ability of this system to distinguish between shRNAs with and without growth-inhibitory effects on sarcoma cell proliferation (Figure 1B,G). ROC analysis also determined a false discovery rate of <30% for shRNAs associated with a reduction in proliferation to <52% of the average of cntrl-shRNA-infected RMS cells (Figure 1B–C) and <40% of cntrl-shRNA-infected NMS cells (Figure 1G–H). In both RMS and NMS cells, silencing of ASNS (Asparagine Synthetase) produced by far the strongest anti-proliferative effect (p<0.0001, q<0.01, 4–5 of 5 shRNAs with FDR<30%; Figure 1D,I and Supplementary files 5–6). ASNS silencing reduced the growth of Kras;p16p19RMS and NMS cells to 30.16% and 6.69% of the average of control RMS and NMS cells, respectively. Effective depletion of ASNS protein by the target-specific shRNAs employed in our screen was confirmed by Western Blot (Figure 1E,J).
Figure 1—figure supplement 1.
Sarcoma induction strategy.
Muscle satellite cells and fibroadipogenic precursor cells were isolated by FACS according to the indicated cell surface markers from mouse skeletal muscle freshly dissected from Cdkn2a(p16p19 mice. Freshly sorted cells were transduced with oncogenic Kras using a Kras (G12v)-IRES-GFP lentivirus, and transduced cells were implanted into the cardiotoxin pre-injured extremity muscles of NOD. SCID mice by intramuscular (i.m.) injection within 36–48 h from cell isolation. The myogenic differentiation status of the resulting Ras-driven sarcomas generated in this system was largely dependent on the cell type transduced: satellite cells typically gave rise to rhabdomyosarcoma (RMS; MyoD +, Myogenin + ), whereas the identical oncogenetic lesions introduced into fibroadipogenic precursors within the MFA cell pool almost always produced sarcomas lacking myogenic differentiation features (MyoD-, Myogenin-; non-myogenic sarcomas, NMS) (Hettmer et al., 2011).
DOI:
http://dx.doi.org/10.7554/eLife.09436.004
Figure 1.
Functional genomic screening identified asparagine synthetase (ASNS) as a high-priority sarcoma target.
141 sarcoma-relevant genes were identified by prior transcriptional profiling of genetically engineered Kras;p16p19 mouse rhabdomyosarcomas (RMS) and non-myogenic sarcomas (NMS) (Hettmer et al., 2011). (A–D, F) The contributions of each of the 141 sarcoma-relevant genes to sarcoma cell proliferation were determined by customized shRNA screening. (B–D, G). The screen contained a control set, including cells exposed to shLUC, shRFP, shLACZ (cntrl; predicted to have no effect on cell proliferation) and cells exposed to shGFP (GFP; predicted to silence Kras (G12V)-IRES-GFP and reduce cell proliferation). (B,G) Receiver operator curve analysis using cntrl-shRNA-infected cells as negative and shGFP-infected cells as positive controls determined a false discovery rate of <30% for shRNAs associated with a reduction in proliferation to <52% of the average of cntrl-shRNA-infected RMS cells (grey line in panel C) and to <40% of cntrl-shRNA-infected NMS cells (grey line in panel H). (D, I) The shRNA screen included cells exposed to shLUC, shRFP, shLACZ (cntrl), shKRAS and shRNAs directed against each of the 141 candidate genes (5 shRNAs per gene). ShRNAs directed against the gene encoding Asparagine Synthetase (Asns) showed the strongest effect on NMS and RMS proliferation (p<0.0001, q<0.01, 4–5 of 5 shRNAs with FDR<30%). (E–J) Effective ASNS knockdown by the shRNAs used in the screen was confirmed by Western blot. See Supplementary files 1–4 for raw data from the shRNA screen, and Supplementary files 5–6 for scores for each of the 141 candidate genes. Significance levels were defined as follows: 1, 5 shRNAs with FDR<30%; 2, 4 shRNAs with FDR<30%; 3, 3 shRNAs with FDR<30%.
DOI:
http://dx.doi.org/10.7554/eLife.09436.003
Muscle satellite cells and fibroadipogenic precursor cells were isolated by FACS according to the indicated cell surface markers from mouse skeletal muscle freshly dissected from Cdkn2a(p16p19 mice. Freshly sorted cells were transduced with oncogenic Kras using a Kras (G12v)-IRES-GFP lentivirus, and transduced cells were implanted into the cardiotoxin pre-injured extremity muscles of NOD. SCID mice by intramuscular (i.m.) injection within 36–48 h from cell isolation. The myogenic differentiation status of the resulting Ras-driven sarcomas generated in this system was largely dependent on the cell type transduced: satellite cells typically gave rise to rhabdomyosarcoma (RMS; MyoD +, Myogenin + ), whereas the identical oncogenetic lesions introduced into fibroadipogenic precursors within the MFA cell pool almost always produced sarcomas lacking myogenic differentiation features (MyoD-, Myogenin-; non-myogenic sarcomas, NMS) (Hettmer et al., 2011).
DOI:
http://dx.doi.org/10.7554/eLife.09436.004
Figure 2.
Reduced growth of mouse Kras;p16p19 RMS cells after Asns silencing is associated with inhibition of polypeptide synthesis.
(A–B) ShRNA-mediated silencing of Asns and Kras in a mouse Kras;p16p19 RMS cell line reduced proliferation activity compared to shLUC-infected control cells as measured by MTT uptake. Asparagine supplementation (100 mg/L) in the tissue culture medium reversed the anti-proliferative effects of shASNS but not shKRAS. (C–F) Asns silencing increased the (C–D) percentage of apoptotoc (PI-/Annexin5+) cells and reduced the (E–F) percentage of S phase cells as determined by BrdU staining, compared to shLUC-infected control cells. Both effects were reversed by exogenous Asparagine supplementation (100 mg/L). (G) Polypeptide synthetic activity was determined by OP-puromycin staining. Absent OP-puromycin staining in cells treated with cycloheximide (right panels), an inhibitor of protein translation, validated the experimental approach. Asns silencing reduced polypeptide synthesis in Kras;p16p19 RMS cells (top left panel), and polypeptide synthesis was restored in shASNS RMS cells by Asparagine supplementation (bottom left panel). (A–F) Data were evaluated for statistical significance by T-tests (ns p≥0.05, *p<0.05, **p<0.01, ***p <0.001). See Figure 2—figure supplement 1 for similar effects of Asns silencing in mouse Kras;p16p19 NMS cells.
DOI:
http://dx.doi.org/10.7554/eLife.09436.005
(A–B) ShRNA-mediated silencing of Asns and Kras in a mouse Kras;p16p19 NMS cell line reduced proliferation activity compared to shLUC-infected control cells as measured by MTT uptake. Asparagine supplementation (100 mg/L) in the tissue culture medium reversed the anti-proliferative effects of shASNS, but not shKRAS. (C–D) Asns silencing did not change the percentage of PI-/Annexin5+ apoptotic cells. (E–F) Asns silencing reduced the percentage of cells in S phase as determined by BrdU staining, compared to shLUC-infected control cells. This effect was reversed by exogenous Asparagine supplementation. (G) Polypeptide synthetic activity was determined by OP-puromycin staining. Absent OP-puromycin staining in cells treated with cycloheximide (right panels) validated the experimental approach. Asns silencing reduced polypeptide synthesis in Kras;p16p19 NMS cells (top left panel), and polypeptide synthesis was restored in shASNS RMS cells by Asparagine supplementation (bottom left panel) (ns p≥0.05, * p<0.05, ** p<0.01, *** p <0.001; as determined by T-tests).
DOI:
http://dx.doi.org/10.7554/eLife.09436.006
Kras;p16p19 RMS and NMS cells were transduced with shASNS- and shLUC-lentivirus. Transduced cells were cultured in the presence of increasing concentrations of asparagine (0.01 – 100 mg/L). Asparagine at 10 or 100 mg/L reversed the growth-inhibitory effects of ASNS silencing on Kras;p16p19 RMS (A) and NMS cells (B; ns p≥0.05, * p<0.05, ** p<0.01, *** p <0.001; as determined by T-tests).
DOI:
http://dx.doi.org/10.7554/eLife.09436.007
Mouse Kras;p16p19RMS and NMS cells express 7- to 11-fold higher Glutaminase levels compared to mouse skeletal muscle (SM; ns p≥0.05, * p<0.05, ** p<0.01, *** p <0.001; as determined by T-tests compared to normal muscle sample SM1).
DOI:
http://dx.doi.org/10.7554/eLife.09436.008
Figure 2—figure supplement 1.
Reduced mouse Kras;p16p19 NMS cell growth after Asns silencing was associated with reduced polypeptide synthesis.
(A–B) ShRNA-mediated silencing of Asns and Kras in a mouse Kras;p16p19 NMS cell line reduced proliferation activity compared to shLUC-infected control cells as measured by MTT uptake. Asparagine supplementation (100 mg/L) in the tissue culture medium reversed the anti-proliferative effects of shASNS, but not shKRAS. (C–D) Asns silencing did not change the percentage of PI-/Annexin5+ apoptotic cells. (E–F) Asns silencing reduced the percentage of cells in S phase as determined by BrdU staining, compared to shLUC-infected control cells. This effect was reversed by exogenous Asparagine supplementation. (G) Polypeptide synthetic activity was determined by OP-puromycin staining. Absent OP-puromycin staining in cells treated with cycloheximide (right panels) validated the experimental approach. Asns silencing reduced polypeptide synthesis in Kras;p16p19 NMS cells (top left panel), and polypeptide synthesis was restored in shASNS RMS cells by Asparagine supplementation (bottom left panel) (ns p≥0.05, * p<0.05, ** p<0.01, *** p <0.001; as determined by T-tests).
DOI:
http://dx.doi.org/10.7554/eLife.09436.006
Functional genomic screening identified asparagine synthetase (ASNS) as a high-priority sarcoma target.
141 sarcoma-relevant genes were identified by prior transcriptional profiling of genetically engineered Kras;p16p19 mouserhabdomyosarcomas (RMS) and non-myogenic sarcomas (NMS) (Hettmer et al., 2011). (A–D, F) The contributions of each of the 141 sarcoma-relevant genes to sarcoma cell proliferation were determined by customized shRNA screening. (B–D, G). The screen contained a control set, including cells exposed to shLUC, shRFP, shLACZ (cntrl; predicted to have no effect on cell proliferation) and cells exposed to shGFP (GFP; predicted to silence Kras (G12V)-IRES-GFP and reduce cell proliferation). (B,G) Receiver operator curve analysis using cntrl-shRNA-infected cells as negative and shGFP-infected cells as positive controls determined a false discovery rate of <30% for shRNAs associated with a reduction in proliferation to <52% of the average of cntrl-shRNA-infected RMS cells (grey line in panel C) and to <40% of cntrl-shRNA-infected NMS cells (grey line in panel H). (D, I) The shRNA screen included cells exposed to shLUC, shRFP, shLACZ (cntrl), shKRAS and shRNAs directed against each of the 141 candidate genes (5 shRNAs per gene). ShRNAs directed against the gene encoding Asparagine Synthetase (Asns) showed the strongest effect on NMS and RMS proliferation (p<0.0001, q<0.01, 4–5 of 5 shRNAs with FDR<30%). (E–J) Effective ASNS knockdown by the shRNAs used in the screen was confirmed by Western blot. See Supplementary files 1–4 for raw data from the shRNA screen, and Supplementary files 5–6 for scores for each of the 141 candidate genes. Significance levels were defined as follows: 1, 5 shRNAs with FDR<30%; 2, 4 shRNAs with FDR<30%; 3, 3 shRNAs with FDR<30%.DOI:
http://dx.doi.org/10.7554/eLife.09436.003
Sarcoma induction strategy.
Muscle satellite cells and fibroadipogenic precursor cells were isolated by FACS according to the indicated cell surface markers from mouse skeletal muscle freshly dissected from Cdkn2a(p16p19 mice. Freshly sorted cells were transduced with oncogenic Kras using a Kras (G12v)-IRES-GFP lentivirus, and transduced cells were implanted into the cardiotoxin pre-injured extremity muscles of NOD. SCIDmice by intramuscular (i.m.) injection within 36–48 h from cell isolation. The myogenic differentiation status of the resulting Ras-driven sarcomas generated in this system was largely dependent on the cell type transduced: satellite cells typically gave rise to rhabdomyosarcoma (RMS; MyoD +, Myogenin + ), whereas the identical oncogenetic lesions introduced into fibroadipogenic precursors within the MFA cell pool almost always produced sarcomas lacking myogenic differentiation features (MyoD-, Myogenin-; non-myogenic sarcomas, NMS) (Hettmer et al., 2011).DOI:
http://dx.doi.org/10.7554/eLife.09436.004
Reduced growth of mouse Kras;p16p19 RMS cells after Asns silencing is associated with inhibition of polypeptide synthesis.
(A–B) ShRNA-mediated silencing of Asns and Kras in a mouseKras;p16p19 RMS cell line reduced proliferation activity compared to shLUC-infected control cells as measured by MTT uptake. Asparagine supplementation (100 mg/L) in the tissue culture medium reversed the anti-proliferative effects of shASNS but not shKRAS. (C–F) Asns silencing increased the (C–D) percentage of apoptotoc (PI-/Annexin5+) cells and reduced the (E–F) percentage of S phase cells as determined by BrdU staining, compared to shLUC-infected control cells. Both effects were reversed by exogenous Asparagine supplementation (100 mg/L). (G) Polypeptide synthetic activity was determined by OP-puromycin staining. Absent OP-puromycin staining in cells treated with cycloheximide (right panels), an inhibitor of protein translation, validated the experimental approach. Asns silencing reduced polypeptide synthesis in Kras;p16p19 RMS cells (top left panel), and polypeptide synthesis was restored in shASNS RMS cells by Asparagine supplementation (bottom left panel). (A–F) Data were evaluated for statistical significance by T-tests (ns p≥0.05, *p<0.05, **p<0.01, ***p <0.001). See Figure 2—figure supplement 1 for similar effects of Asns silencing in mouseKras;p16p19 NMS cells.DOI:
http://dx.doi.org/10.7554/eLife.09436.005
Reduced mouse Kras;p16p19 NMS cell growth after Asns silencing was associated with reduced polypeptide synthesis.
(A–B) ShRNA-mediated silencing of Asns and Kras in a mouseKras;p16p19 NMS cell line reduced proliferation activity compared to shLUC-infected control cells as measured by MTT uptake. Asparagine supplementation (100 mg/L) in the tissue culture medium reversed the anti-proliferative effects of shASNS, but not shKRAS. (C–D) Asns silencing did not change the percentage of PI-/Annexin5+ apoptotic cells. (E–F) Asns silencing reduced the percentage of cells in S phase as determined by BrdU staining, compared to shLUC-infected control cells. This effect was reversed by exogenous Asparagine supplementation. (G) Polypeptide synthetic activity was determined by OP-puromycin staining. Absent OP-puromycin staining in cells treated with cycloheximide (right panels) validated the experimental approach. Asns silencing reduced polypeptide synthesis in Kras;p16p19 NMS cells (top left panel), and polypeptide synthesis was restored in shASNS RMS cells by Asparagine supplementation (bottom left panel) (ns p≥0.05, * p<0.05, ** p<0.01, *** p <0.001; as determined by T-tests).DOI:
http://dx.doi.org/10.7554/eLife.09436.006
Asparagine concentrations of 10 or 100 mg/L reverse the effects of ASNS silencing on sarcoma growth.
Kras;p16p19 RMS and NMS cells were transduced with shASNS- and shLUC-lentivirus. Transduced cells were cultured in the presence of increasing concentrations of asparagine (0.01 – 100 mg/L). Asparagine at 10 or 100 mg/L reversed the growth-inhibitory effects of ASNS silencing on Kras;p16p19 RMS (A) and NMS cells (B; ns p≥0.05, * p<0.05, ** p<0.01, *** p <0.001; as determined by T-tests).DOI:
http://dx.doi.org/10.7554/eLife.09436.007
Glutaminase expression in mouse Kras;p16p19sarcoma cells.
MouseKras;p16p19RMS and NMS cells express 7- to 11-fold higher Glutaminase levels compared to mouse skeletal muscle (SM; ns p≥0.05, * p<0.05, ** p<0.01, *** p <0.001; as determined by T-tests compared to normal muscle sample SM1).DOI:
http://dx.doi.org/10.7554/eLife.09436.008
ASNS silencing inhibits growth of mouse Kras;p16p19sarcoma cells by asparagine starvation
ASNS encodes the enzyme asparagine synthetase, which converts aspartate into asparagine using glutamine as a nitrogendonor. Therefore, we next tested if the growth-inhibitory effects of genetic ASNS inhibition (Figure 1D,I) on mousesarcoma growth were reversed by exogenous supplementation with the ASNS product asparagine. Supplementation of the culture media with 100 mg/L asparagine reversed the growth inhibition observed in shASNS-infected Kras;p16p19RMS (Figure 2A-2B) and NMS (Figure 2—figure supplement 1A-1B) cells. Dose response analysis revealed that reversal of growth inhibiton of shASNS-transduced Kras;p16p19RMS and NMS cells was also observed at 10 mg/L asparagine, whereas 0.01, 0.1 or 1 mg/L asparagine were insufficient (Figure 2—figure supplement 2). Asparagine supplementation did not reverse the growth inhibitory effect of shRNA-mediated silencing of Kras in Kras;p16p19RMS cells (Figure 2A-2B). Taken together, we conclude that the growth-inhibitory effects of ASNS silencing on mousesarcoma cells result from cellular asparagine starvation.
Figure 2—figure supplement 2.
Asparagine concentrations of 10 or 100 mg/L reverse the effects of ASNS silencing on sarcoma growth.
Kras;p16p19 RMS and NMS cells were transduced with shASNS- and shLUC-lentivirus. Transduced cells were cultured in the presence of increasing concentrations of asparagine (0.01 – 100 mg/L). Asparagine at 10 or 100 mg/L reversed the growth-inhibitory effects of ASNS silencing on Kras;p16p19 RMS (A) and NMS cells (B; ns p≥0.05, * p<0.05, ** p<0.01, *** p <0.001; as determined by T-tests).
DOI:
http://dx.doi.org/10.7554/eLife.09436.007
Asparagine starvation reduces cell proliferation, increases cell death and impedes nascent polypeptide synthesis in mouse Kras;p16p19sarcoma cells
Asns silencing in mouseKras;p16p19RMS cells caused an increase in the fraction of sarcoma cells undergoing apoptosis, as determined by staining with propidium iodide (PI) and Annexin V (p<0.001, Figure 2C-2D). Moreover, Asns silencing reduced the percentage of BrdU + cells in S phase (p<0.001, Figure 2E-2F). Both effects were reversed by exogenous asparagine supplementation (Figure 2D,F). To evaluate whether cellular asparagine starvation due to Asns silencing impedes sarcoma cell proliferation by interfering with the cells’ ability to generate nascent polypeptide chains, Kras;p16p19RMS cells were exposed to O-propargyl-puromycin (OP-puromycin). OP-puromycin forms covalent conjugates with newly synthesized polypeptides, which can be visualized by azide-alkyne cycloaddition. Rapidly proliferating shLUC-infected Kras;p16p19 RMS cells exhibited strong OP-puromycin staining, indicating brisk polypeptide synthesis (Figure 2G, middle panels). However, blockade of protein translation by exposure to cycloheximide abrogated OP-puromycin staining (Figure 2G, far right panels). Similarly, shASNS-infected cells exhibited only minimal OP-puromycin staining (Figure 2G, upper left panel), while synthesis of new polypeptides was restored in shASNS-infected sarcoma cells grown in medium supplemented with asparagine (Figure 2G, lower left panel). Similar effects of ASNS silencing on apoptosis, cell cycle and synthesis of nascent peptide chains were observed in Kras;p16p19 NMS cells (Figure 2—figure supplement 1).
Asparagine starvation impedes human RMS growth and polypeptide synthesis
ASNS expression was evaluated in primary humansarcoma tissue by immunohistochemistry (IHC) using a commercially available tissue array (US Biomax SO2081). ASNS was detected in 16 of 22 (73%) human RMS cores (Figure 4—figure supplement 1A) and in 12 of 27 (44%) humanleiomyosarcoma cores (Figure 4—figure supplement 1B). Also, increased expression of ASNS compared to normal human muscle was detected in 9 of 9 humansarcoma cell lines analyzed by PCR (Figure 4—figure supplement 1C), including the PAX3:FOXO1-positive human RMS cell line Rh30. To evaluate the impact of ASNS silencing on human RMS cells, we transduced Rh30 cells with lentiviruses encoding shASNS or control (shLACZ) shRNAs (Figure 3). ShRNA-mediated knockdown of ASNS in Rh30 cells (Figure 3A) reduced proliferation (p<0.001; Figure 3B–C), increased the percentage of apoptotic cells (p<0.01; Figure 3D–E), reduced the percentage of cells in S phase (p<0.001; Figure 3F–G) and impeded nascent polypeptide synthesis (Figure 3H). The effects of ASNS silencing on Rh30 growth and peptide synthesis were reversed by asparagine supplementation (Figure 3B–H). Thus, ASNS silencing in humanRh30 cells recapitulated the inhibitory effects on cell growth and polypeptide synthesis observed in mouseKras;p16p19sarcoma cells.
Figure 4—figure supplement 1.
Expression of candidate sarcoma targets in human sarcoma tissue.
(A-B) Immunohistochemical (IHC) staining of commercially available sarcoma tissue arrays (US Biomax SO2081) detected ASNS expression in (A) 73% of human RMS cores (22 tumors evaluated) and in (B) 44% of human leiomyosarcoma (LMS) cores (27 tumors evaluated). Representative stains are shown. (C) ASNS expression was detected in human sarcoma cell lines by qRT-PCR (ns p≥0.05, * p<0.05, ** p<0.01, *** p <0.001; as determined by T-tests compared to target gene expression in adult muscle).
DOI:
http://dx.doi.org/10.7554/eLife.09436.011
Figure 3.
Reduced growth of human Rh30 RMS cells after ASNS silencing is associated with reduced polypeptide synthesis.
(A) ShRNA-mediated silencing of ASNS in Rh30 cells was validated by Western Blot. (B–C) ASNS silencing reduced proliferation compared to shLACZ-infected control cells as measured by MTT uptake. Asparagine supplementation (100 mg/L) in the tissue culture medium reversed the anti-proliferative effects of shASNS. (D–G) ASNS silencing increased the (D–E) percentage of apoptotic (PI-/Annexin5+ ) cells and reduced the (F–G) percentage of S-phase cells , as compared to shLACZ-infected control cells. (F–G) Exogenous Asparagine supplementation reversed shASNS effects on cell cycle progression. (H) Polypeptide synthetic activity was determined by OP-puromycin staining. Absent OP-puromycin staining in Rh30 cells treated with cycloheximide (right panels) validated the experimental approach. ASNS silencing reduced polypeptide synthesis (top left panel), and polypeptide synthesis was restored in shASNS RMS cells by Asparagine supplementation (bottom left panel). (B–G) Data were evaluated for statistical significance by T-tests (ns p≥0.05, * p<0.05, ** p<0.01, *** p <0.001).
DOI:
http://dx.doi.org/10.7554/eLife.09436.009
Reduced growth of human Rh30 RMS cells after ASNS silencing is associated with reduced polypeptide synthesis.
(A) ShRNA-mediated silencing of ASNS in Rh30 cells was validated by Western Blot. (B–C) ASNS silencing reduced proliferation compared to shLACZ-infected control cells as measured by MTT uptake. Asparagine supplementation (100 mg/L) in the tissue culture medium reversed the anti-proliferative effects of shASNS. (D–G) ASNS silencing increased the (D–E) percentage of apoptotic (PI-/Annexin5+ ) cells and reduced the (F–G) percentage of S-phase cells , as compared to shLACZ-infected control cells. (F–G) Exogenous Asparagine supplementation reversed shASNS effects on cell cycle progression. (H) Polypeptide synthetic activity was determined by OP-puromycin staining. Absent OP-puromycin staining in Rh30 cells treated with cycloheximide (right panels) validated the experimental approach. ASNS silencing reduced polypeptide synthesis (top left panel), and polypeptide synthesis was restored in shASNS RMS cells by Asparagine supplementation (bottom left panel). (B–G) Data were evaluated for statistical significance by T-tests (ns p≥0.05, * p<0.05, ** p<0.01, *** p <0.001).DOI:
http://dx.doi.org/10.7554/eLife.09436.009
Chemical targeting of Asparagine availability reduces sarcoma growth
Asparagine homeostasis represents an actionable cellular process. Amino sulfoximines directly inhibit ASNS activity (Ikeuchi et al., 2012; Richards and Kilberg, 2006), whereas asparaginase, an FDA-approved drug widely used in the treatment of leukemia, hydrolyzes asparagine to aspartate and ammonia. Both amino sulfoximine 5 (AS5) and asparaginase reduced the proliferation of mouse and humansarcoma cell lines in vitro (Figure 4A–C). For asparaginase, EC50 concentrations were estimated at 0.2–0.5 IU/ml in mouseKras;p16p19sarcoma cells, 0.8–0.9 IU/ml in humanHT1080, Rh30 and Rh41 cells and 6 IU/ml in human RD cells (Figure 4A–B). For the ASNS inhibitor AS5, EC50 concentrations were estimated at 80–150 μM in mouseKras;p16p19sarcoma cells and 200–300 μM in the humansarcoma cell lines tested (Figure 4A,C). Similar to previous observations in cells that underwent genetic inhibition of ASNS, the growth-inhibitory effects of chemical ASNS inhibition by AS5 were reversed by exogenous asparagine supplementation (Figure 4D). These findings strongly suggest that the growth inhibitory effects of AS5 result from asparagine deprivation of sarcoma cells.
Figure 4.
Inhibition of mouse and human sarcoma cell growth in vitro by chemical compounds interfering with Asparagine homeostasis.
(A–C) Proliferation assays of mouse (Ms RMS, Ms NMS) and human (HT1080, RD, Rh41, Rh30) sarcoma cell lines exposed to the indicated doses of chemical modulators of Asparagine homeostasis: (A–B) Asparaginase or (A,C) AS5. Both chemicals were diluted in 0.9% NaCl (Normal Saline (NS)) as vehicle. (D) Chemical and genetic ASNS inhibition was reversed by exogenous supplementation with 100 mg/L asparagine in the tissue culture medium (100 mg/L, which corresponds to 757 μM; compared to normal asparagine concentrations in mouse and human plasma of 29 μM and 55 μM, respectively (Cooney et al., 1970)). Data were evaluated for statistical significance by T-tests (ns p≥0.05, * p<0.05, ** p<0.01, *** p <0.001). See Figure 4—figure supplement 1 for ASNS expression in human sarcoma cells.
DOI:
http://dx.doi.org/10.7554/eLife.09436.010
(A-B) Immunohistochemical (IHC) staining of commercially available sarcoma tissue arrays (US Biomax SO2081) detected ASNS expression in (A) 73% of human RMS cores (22 tumors evaluated) and in (B) 44% of human leiomyosarcoma (LMS) cores (27 tumors evaluated). Representative stains are shown. (C) ASNS expression was detected in human sarcoma cell lines by qRT-PCR (ns p≥0.05, * p<0.05, ** p<0.01, *** p <0.001; as determined by T-tests compared to target gene expression in adult muscle).
DOI:
http://dx.doi.org/10.7554/eLife.09436.011
Inhibition of mouse and human sarcoma cell growth in vitro by chemical compounds interfering with Asparagine homeostasis.
(A–C) Proliferation assays of mouse (Ms RMS, Ms NMS) and human (HT1080, RD, Rh41, Rh30) sarcoma cell lines exposed to the indicated doses of chemical modulators of Asparagine homeostasis: (A–B) Asparaginase or (A,C) AS5. Both chemicals were diluted in 0.9% NaCl (Normal Saline (NS)) as vehicle. (D) Chemical and genetic ASNS inhibition was reversed by exogenous supplementation with 100 mg/L asparagine in the tissue culture medium (100 mg/L, which corresponds to 757 μM; compared to normal asparagine concentrations in mouse and human plasma of 29 μM and 55 μM, respectively (Cooney et al., 1970)). Data were evaluated for statistical significance by T-tests (ns p≥0.05, * p<0.05, ** p<0.01, *** p <0.001). See Figure 4—figure supplement 1 for ASNS expression in humansarcoma cells.DOI:
http://dx.doi.org/10.7554/eLife.09436.010
Expression of candidate sarcoma targets in human sarcoma tissue.
(A-B) Immunohistochemical (IHC) staining of commercially available sarcoma tissue arrays (US Biomax SO2081) detected ASNS expression in (A) 73% of human RMS cores (22 tumors evaluated) and in (B) 44% of humanleiomyosarcoma (LMS) cores (27 tumors evaluated). Representative stains are shown. (C) ASNS expression was detected in humansarcoma cell lines by qRT-PCR (ns p≥0.05, * p<0.05, ** p<0.01, *** p <0.001; as determined by T-tests compared to target gene expression in adult muscle).DOI:
http://dx.doi.org/10.7554/eLife.09436.011
Asparagine depletion impedes mouse sarcoma growth in vivo
Due to the poor cell permeability of AS5, its growth-inhibitory effects on sarcoma cells required EC50 concentrations greater than 80 μM, making in vivo testing infeasible. Thus, to determine the effects of reduced ASNS activity on sarcoma growth in vivo, 100 shASNS-infected and 100 shLUC-infected Kras; p16p19RMS cells were implanted into the cardiotoxin-preinjured gastrocnemius muscles of 1- to 3-months old NOD. SCIDmice (Figure 5). IHC showed that tumors arising from shASNS cells expressed less ASNS than tumors arising from shLUC cells (Figure 5A). However, there was no difference in latency of shASNS- and shLUC-tumors (p = 0.3; Figure 5B).
Figure 5.
Asns silencing delayed Kras;p16p19 RMS growth in Asparagine-depleted mice.
(A) Tumors arising from shASNS RMS cells expressed less ASNS than tumors arising from shLUC cells as shown by IHC staining. Of 6 tumors arising from shASNS cells, cytoplasmic ASNS positivity was observed in 50–75% of cells in one tumor, in 25–50% of cells in 3 tumors and in <25% of cells in 2 tumors. Of 5 tumors arising from control shLUC-cells, cytoplasmic ASNS staining was detected in >75% of cells in 3 tumors and in 25–50% of cells in 2 tumors. Representative images are shown. (B) Effects of Asns silencing on tumor growth in vivo were evaluated by transplantation. One subgroup of recipient mice was treated with Asparaginase (Elspar) by daily intraperitoneal (IP) injections at a dose of 1500 IU/kg. ShASNS silencing delayed tumor onset in recipient mice treated with Asparaginase compared to shLUC-infected RMS cells (p<0.0001). (C) Asparaginase-treated mice maintained their weight over the course of a 19-day exposure. Each experimental group included 5 mice, and findings were replicated in 2 independent transplantation experiments. (D) Daily IP injection of Asparaginase results in a 13-fold reduction in serum Asparagine levels from 52 ± 7 to 4 ± 1 μmol/L. Differences in tumor latency were evaluated for statistical significance by logrank (Mantel-Cox) test. Differences in serum amino acid concentrations were determined by T-test (ns p≥0.05, *p<0.05, **p<0.01, ***p <0.001). See Figure 5—figure supplement 1 for similar effects of Asns silencing in Kras;p16p19NMS cells on secondary tumor induction and Supplementary file 7 for changes in serum amino acid levels in Asparaginase-treated versus control mice.
DOI:
http://dx.doi.org/10.7554/eLife.09436.012
Mouse Kras;p16p19 NMS cells were transplanted into 1- to 3-months old NOD. SCID recipient mice. (A) Tumors arising from shASNS NMS cells expressed less ASNS than tumors arising from shLUC cells as shown by IHC staining. (B) Effects of Asns silencing on tumor growth in vivo were evaluated by transplantation. One subgroup of recipient mice was treated with Asparaginase (Elspar) by daily intraperitoneal (IP) injections at a dose of 1500IU/kg. ShASNS silencing delayed tumor onset in recipient mice treated with asparaginase compared to shLUC-infected NMS cells (p = 0.005). Transplantation of shASNS cells into recipients that were not exposed to asparaginase, or transplantation of shLUC cells into asparaginase-treated recipients did not delay tumor onset. Each experimental group included 5 mice, and findings were replicated in 2 independent transplantation experiments. Differences in tumor latency were evaluated for statistical significance by logrank (Mantel-Cox) test.
DOI:
http://dx.doi.org/10.7554/eLife.09436.013
Asns silencing delayed Kras;p16p19 RMS growth in Asparagine-depleted mice.
(A) Tumors arising from shASNS RMS cells expressed less ASNS than tumors arising from shLUC cells as shown by IHC staining. Of 6 tumors arising from shASNS cells, cytoplasmic ASNS positivity was observed in 50–75% of cells in one tumor, in 25–50% of cells in 3 tumors and in <25% of cells in 2 tumors. Of 5 tumors arising from control shLUC-cells, cytoplasmic ASNS staining was detected in >75% of cells in 3 tumors and in 25–50% of cells in 2 tumors. Representative images are shown. (B) Effects of Asns silencing on tumor growth in vivo were evaluated by transplantation. One subgroup of recipient mice was treated with Asparaginase (Elspar) by daily intraperitoneal (IP) injections at a dose of 1500 IU/kg. ShASNS silencing delayed tumor onset in recipient mice treated with Asparaginase compared to shLUC-infected RMS cells (p<0.0001). (C) Asparaginase-treated mice maintained their weight over the course of a 19-day exposure. Each experimental group included 5 mice, and findings were replicated in 2 independent transplantation experiments. (D) Daily IP injection of Asparaginase results in a 13-fold reduction in serum Asparagine levels from 52 ± 7 to 4 ± 1 μmol/L. Differences in tumor latency were evaluated for statistical significance by logrank (Mantel-Cox) test. Differences in serum amino acid concentrations were determined by T-test (ns p≥0.05, *p<0.05, **p<0.01, ***p <0.001). See Figure 5—figure supplement 1 for similar effects of Asns silencing in Kras;p16p19NMS cells on secondary tumor induction and Supplementary file 7 for changes in serum amino acid levels in Asparaginase-treated versus control mice.
Figure 5—figure supplement 1.
Asns silencing delayed Kras;p16p19 NMS growth in Asparagine-depleted mice.
Mouse Kras;p16p19 NMS cells were transplanted into 1- to 3-months old NOD. SCID recipient mice. (A) Tumors arising from shASNS NMS cells expressed less ASNS than tumors arising from shLUC cells as shown by IHC staining. (B) Effects of Asns silencing on tumor growth in vivo were evaluated by transplantation. One subgroup of recipient mice was treated with Asparaginase (Elspar) by daily intraperitoneal (IP) injections at a dose of 1500IU/kg. ShASNS silencing delayed tumor onset in recipient mice treated with asparaginase compared to shLUC-infected NMS cells (p = 0.005). Transplantation of shASNS cells into recipients that were not exposed to asparaginase, or transplantation of shLUC cells into asparaginase-treated recipients did not delay tumor onset. Each experimental group included 5 mice, and findings were replicated in 2 independent transplantation experiments. Differences in tumor latency were evaluated for statistical significance by logrank (Mantel-Cox) test.
DOI:
http://dx.doi.org/10.7554/eLife.09436.013
DOI:
http://dx.doi.org/10.7554/eLife.09436.012
Asns silencing delayed Kras;p16p19 NMS growth in Asparagine-depleted mice.
MouseKras;p16p19 NMS cells were transplanted into 1- to 3-months old NOD. SCID recipient mice. (A) Tumors arising from shASNSNMS cells expressed less ASNS than tumors arising from shLUC cells as shown by IHC staining. (B) Effects of Asns silencing on tumor growth in vivo were evaluated by transplantation. One subgroup of recipient mice was treated with Asparaginase (Elspar) by daily intraperitoneal (IP) injections at a dose of 1500IU/kg. ShASNS silencing delayed tumor onset in recipient mice treated with asparaginase compared to shLUC-infected NMS cells (p = 0.005). Transplantation of shASNS cells into recipients that were not exposed to asparaginase, or transplantation of shLUC cells into asparaginase-treated recipients did not delay tumor onset. Each experimental group included 5 mice, and findings were replicated in 2 independent transplantation experiments. Differences in tumor latency were evaluated for statistical significance by logrank (Mantel-Cox) test.DOI:
http://dx.doi.org/10.7554/eLife.09436.013Our in vitro data suggested that growth inhibition induced by ASNS silencing can be rescued by provision of exogenous aparagine at concentrations between 1 and 10 mg/L (Figure 2—figure supplement 2). As normal asparagine concentrations in mouse and human plasma were previously reported to be between 3.8 mg/L and 7.3 mg/L (Cooney et al., 1970), these data suggest that freely available asparagine in mouse serum and tissue might counteract the effects of tumor-specific ASNS silencing. To examine this possibility, we treated subgroups of animals transplanted with shASNS- or shLUC-tumor cells with asparaginase (1500 IU/kg; (Szymanska et al., 2012)) by daily intraperitoneal (IP) injection. Asparaginase treatment was initiated on the day of tumor cell injection and continued for 35–41 days. This dosage was well tolerated by the animals without significant weight loss (Figure 5C). Serum asparagine levels were reduced 13-fold in asparaginase-treated mice (0.53 mg/L (4 μM) versus 6.87 mg/L (52 μM) in untreated mice, p<0.001; Figure 5D and Supplementary file 7). Daily exposure to asparaginase did not change the latency of shLUC-tumors (p = 0.5; Figure 5B); however, asparaginase treatment significantly prolonged tumor latency in mice implanted with shASNS-RMS cells (p<0.001; Figure 5B). Moreover, 2 out of 8 mice in this experimental group did not develop tumors during 4 months of follow up after tumor cell injection. Similar effects were observed when NOD. SCIDmice were transplanted with shASNS-infected and shLUC-infected Kras; p16p19NMS cells (Figure 5—figure supplement 1). Thus, ASNS inhibition combined with depletion of plasma asparagine reduces sarcoma growth in vivo.
Discussion
Cancer cells depend on biological mechanisms that guarantee adequate provision of energy and biosynthetic precursors to support cell growth. Functional genomic screening of genetically engineered mousesarcomas revealed that asparagine synthetase (ASNS) exerted the strongest observed effect on sarcoma cell proliferation within a small group of genes upregulated in both mouse and humansarcomas. ASNS is the amidotransferase that converts L-aspartic acid into L-asparagine in an energy-consuming enzymatic reaction requiring ATP and a nitrogen source that is L-glutamine in eukaryotic cells (Richards and Kilberg, 2006). Depletion of functional ASNS in both mouse and human RMS cells reduced the proportion of cells in S phase and impeded synthesis of nascent polypetide chains. Similarly, ASNS silencing in melanoma cells was recently reported to result in cell cycle arrest (Li et al., 2015). The effects of ASNS reduction in sarcoma cells were reversed by exogenous supplementation with asparagine, supporting the notion that rapidly growing sarcoma cells depend on adequate availability of intrinsic or extrinsic asparagine to support tumor growth. Moreover, ASNS inhibition significantly slowed mousesarcoma growth in vivo only when combined with depletion of plasma asparagine, likely reflecting the ability of systemic asparagine in the tumor environment to replenish intracellular asparagine availability after ASNS inhibition. We speculate that asparagine reliance of sarcoma cells represents a metabolic vulnerability that could be exploited therapeutically to inhibit rapid tumor growth.Previously published metabolic profiling studies have identified a number of metabolites that are heavily consumed by cancer cell lines, including glycine and asparagine (Jain et al., 2012). Glycine starvation prolonged the G1 phase of the cell cycle and reduced proliferation, in part because sufficient amounts of this amino acid are required to support de novo purine biosynthesis in rapidly dividing cells. Unlike purine synthesis, protein synthesis in glycine-starved cells remained relatively intact (Jain et al., 2012). In contrast, we found that asparagine starvation of mouse and humansarcoma cells impedes synthesis of nascent polypeptide chains thereby slowing cell proliferation. These results are consistent with observations in soybean, barley and maize where free asparagine levels in developing seeds correlate positively with higher protein levels at maturity (Pandurangan et al., 2012). Moreover, limiting the extracellular supply or blocking the synthesis of single amino acids is known to suppress global translation initiation via activation of GCN2 and phosphorylation of the translation initiation factor EIF2α (Sood et al., 2000). Thus, asparagine in the tumor cell environment may have important functions in controlling the synthesis and turnover of protein in sarcoma cells.Impaired peptide biosynthesis may not be the only mechanism contributing to the asparagine dependence of sarcoma cells described in this study. For instance, our data do not exclude the possibility that glutamate deprivation and/or aspartate excess resulting from changes in asparagine biosynthesis negatively impact cell survival and proliferation. However, aspartate carries reducing equivalents in the malate-aspartate shuttle (Son et al., 2013), and increased aspartate levels after ASNS knockdown might be predicted to benefit the redox state of sarcoma cells. In addition, it has been suggested that increased glutaminase expression in cancer cells can counterbalance decreased glutamate levels, especially in a glutamine-rich environment (Huang et al., 2014). Consistent with this notion, we found that glutaminase expression was increased by 7- to 11-fold in mousesarcoma cells compared to normal mouse muscle (Figure 2—figure supplement 3), suggesting that this mechanism may be used by sarcoma cells to counteract glutamate reductions that may result from ASNS silencing.
Figure 2—figure supplement 3.
Glutaminase expression in mouse Kras;p16p19sarcoma cells.
Mouse Kras;p16p19RMS and NMS cells express 7- to 11-fold higher Glutaminase levels compared to mouse skeletal muscle (SM; ns p≥0.05, * p<0.05, ** p<0.01, *** p <0.001; as determined by T-tests compared to normal muscle sample SM1).
DOI:
http://dx.doi.org/10.7554/eLife.09436.008
Finally, a recent report demonstrated, unexpectedly, that asparagine supplementation can suppress cell death in glutamine-deprived cells (Zhang et al., 2014), implicating asparagine in promoting cellular adaptation to metabolic stresses such as glutamine depletion. This study also noted that asparagine is the last amino acid synthesized in the TCA cycle and that its amination depends exclusively on glutamine (Zhang et al., 2014). Amino acid availability is known to stimulate mechanistic target of rapamycin (mTOR) complex 1, which integrates environmental and intracellular signals to regulate cell growth (Jewell et al., 2015). Taken together, these observations suggest that asparagine may serve a central role as a cellular sensor of TCA cycle intermediate/ reduced nitrogen availability and, ultimately, as a metabolic regulator of cell behavior.While our studies demonstrate a clear dependence of sarcoma cell growth and survival on cellular asparagine levels, they certainly do not exclude the possibility that adequate availability of amino acids other than asparagine may also be important. The shRNA proliferation screen we performed was designed to evaluate the functional contributions of a particular group of sarcoma signature genes identified by their high level expression in both Ras-driven mousesarcomas and humansarcomas, and thus did not comprehensively evaluate all amino acid biosynthetic pathways. Indeed, within the cluster of sarcoma genes evaluated, the top-scoring cellular functions were cell cycle control and cell division (Hettmer et al., 2011). However, we note that in addition to ASNS, our list of candidate targets included genes encoding 3 other enzymes relevant for amino acid biosynthesis: branched chain aminotransferase 1 (BCAT1), phosphoserine aminotransferase (PSAT1) and phosphoglycerate dehydrogenase (PHGDH). Both PHGDH and PSAT1 contribute to serine/ glycine biosynthesis, which plays an important role in supporting nucleotide synthesis in rapidly proliferating cells (Jain et al., 2012; Labuschagne et al., 2014), and recent publications indicate that high expression of PHGDH in tumor tissue is required for cell growth in epithelial malignancies (Locasale et al., 2011; Possemato et al., 2011). However, in our screen, silencing of PSAT1, PHGDH or BCAT1 did not inhibit sarcoma cell growth (Supplementary files 5–6), suggesting that these biosynthetic pathways may be of lesser importance for the sarcomatous malignancies studied here.ASNS expression among tissues in adult animals varies considerably (Balasubramanian et al., 2013). ASNS in tumor tissue has been linked to the transactivating effects of oncogenic effectors such as TP53 (Scian et al., 2004) and metabolic stress (Balasubramanian et al., 2013; Cui et al., 2007). For example, in pancreatic cancer, glucose deprivation upregulated ASNS expression, which, in turn, protected tumor cells from apoptosis induced by glucose deprivation itself (Cui et al., 2007). Similarly, upregulation of ASNS in response to amino acid restriction, such as plasma asparagine depletion by treatment with asparaginase (Cui et al., 2007), is part of a normal physiological adaptation response to counteract nutrient deprivation (Balasubramanian et al., 2013). As sarcomas outgrow the existing vasculature, tumor cells are continuously exposed to a microenvironment in which the supply of nutrients is limited. Increased Asns mRNA expression in Kras;p16p19mouse sarcomas as compared to normal muscle could occur in response to amino acid and glucose deprivation in rapidly growing sarcomas.Cellular asparagine reliance has been exploited successfully in the treatment of acute lymphoblastic leukemia (ALL) with bacterially derived asparaginase (Haskell et al., 1969; Jaffe et al., 1971; Richards and Kilberg, 2006). Lymphoblasts are thought to be exquisitely sensitive to asparaginase treatment due to their low ASNS expression (Richards and Kilberg, 2006). Growth inhibitory effects of asparaginase on sarcoma cells in vitro were previously reported by Tardito et al (Tardito et al., 2006). However, the response of sarcoma cells to asparaginase alone is moderate to poor (Figure 4A, (Tardito et al., 2006)) when compared to the published spectrum of asparaginase sensitivity of primary lymphoblasts (EC50 concentrations between <0.002 and >10 IU/ml; (Fine et al., 2005)). One published report on the efficacy of asparaginase as a single agent documented remissions in 7 of 32 children with ALL, but there was no objective response in a single patient with RMS (Jaffe et al., 1971). Yet, asparaginase is a well-characterized drug with a relatively favorable toxicity profile that does not overlap with the toxicities of conventional cytostatics used in RMS treatment (Haskell et al., 1969), and the further development of specific, cell-permeable chemical inhibitors of ASNS may open additional therapeutic opportunities (Richards and Kilberg, 2006), especially when combined with systemic asparagine depletion.Understanding the molecular networks that support sarcoma cell proliferation may enable the development of therapies based on selective targeting of proliferation-relevant cellular pathways. This study identified asparagine starvation as a candidate intervention that impedes sarcoma growth. Yet, it is highly unlikely that any interventions will have noticeable anti-sarcoma effects in vivo when used alone. For future studies and clinical development, it will be important to rationally select combinations of interventions that target multiple proliferation-relevant cellular processes including Asparagine reliance of sarcoma cells.
Materials and methods
Kras;p16p19 mouse sarcomas
Primary Kras;p16p19 mousesarcomas were induced by ex-vivo transduction of freshly sorted Cdkn2a-/- (p16p19 mouse skeletal muscle precursor cells (CD45-CD11b-TER119-Sca1-CXCR4+ β1integrin+) or Sca1+ fibroadipogenic precursor cells CD45-CD11b-TER119-Sca1+) with pGIPZ-Kras (G12V)-IRES-GFP lentivirus followed by intramuscular transplantation of Kras-expressing, p16p19cells into the cardiotoxin-preinjured gastrocnemius muscles of 1- to 3-months old NOD/SCIDmice, as previously described (Hettmer et al., 2011). Secondary Kras;p16p19 mousesarcomas were generated by implanting 100 Kras;p16p19 mouse RMS or NMS cells into the cardiotoxin-preinjured gastrocnemius muscles of 1- to 3-months old NOD/SCIDmice.
Human skeletal muscle
Use of human muscle was approved by the Institutional Review Board at Joslin Diabetes Center. Human fetal muscle was obtained from 20–23 week gestation fetuses and adult muscle from deceased volunteers. Tissue was homogenized in TRIzol using a tissue homogenizer prior to RNA isolation.
Mice
C57BL6, NOD/CB17-Prkdcscid/J (NOD/SCID) and p16p19mice (B6.129 background) mice were obtained from Jackson Laboratory and the National Institutes of Health/Mouse Models of HumanCancer Consortium, respectively. Mice were bred and maintained at the Joslin Diabetes Center Animal Facility. All animal experiments were approved by the Joslin Diabetes Center Institutional Animal Care and Use Committee.
Sarcoma cell lines
Mousesarcoma cell lines were established from 2 Kras;p16p19 mouseRMS tumors (T14-R, SMP-01) and one Kras;p16p19 mouseNMS tumor (Sca1-01). The human RMS cell line RD (translocation-negative) and the humanfibrosarcoma line HT1080 were purchased from ATCC. Human RMS cell lines Rh3, Rh5, Rh10, Rh28, Rh30, Rh41 (all PAX3:FOXO1-positive) and Rh36 (translocation-negative) were gifts from Dr. Peter Houghton (Nationwide Children’s Hospital, Columbus, OH). All cell lines were maintained in DMEM supplemented with 10% FBS and 1% Penicillin-Streptomycin. To evaluate the effects of asparagine supplementation on sarcoma cells in vitro, 4.15 g DMEM (D5030, Sigma, St. Louis, MO), 2.25 g Glucose (Sigma), 1.85 g NaHCO3 (Sigma), 292 mg Glutamine (Sigma), 10% FBS and 1% PenicillinStreptomycin (Life Technologies, Carlsbad, CA) were reconstituted in 500 ml dH2O and supplemented with or without Asparagine at a concentration of 0 to 100 mg/L (A4159, Sigma).
Customized shRNA proliferation screen
The screen was performed using the Kras;p16p19 RMS line T14R and the Kras;p16p19 NMS line Sca1-01. Cells were plated in DMEM supplemented with 10% FBS and 1% Penicillin-Streptomycin on day -1 and infected with lentiviruses in the presence of 8 μg/ml Polybrene (Millipore, Billerica, MA) on day 0. Infected cells were selected by adding Puromycin (Santa Cruz, Biotechnology, Dallas, TX) to a final concentration of 2 μg/ml on day +1. Cell growth was evaluated by CellTiter Glo (Promega, Fitchburg, WI) on day 8. RMS cells were plated at 900 cells per well and infected with 6 μl virus in 3 replicates exposed to Puromycin and 2 replicates maintained without Puromycin. NMS cells were plated at 450 cells per well and infected with 4 μl virus in 2 replicates exposed to Puromycin and 2 replicates maintained without Puromycin.For each cell line, raw data obtained from cells exposed to Puromycin ( + Puromycin, y axis) were plotted against raw data from cells grown without Puromycin (- Puromycin, x-axis; Figure 1B,G). Raw data obtained from cells exposed to PGW or medium only were excluded from the analysis. Standard deviations (SD) from the mean were calculated for each data point, and those with SDs above the upper adjacent limit also were excluded from further analysis. Correlation coefficients between + Puromycin and - Puromycin data were 0.8348 (RMS) and 0.9501 (NMS), thereby confirming adequate transduction efficiency.For each shRNA, replicate data were pooled and relative cell growth was quantified as the percentage proliferation of shRNA infected cells compared to the mean proliferation of cells infected with cntrl-shRNAs on the same plate. Receiver operator curve analysis using CTR01 data confirmed the ability of the screen to distinguish between the growth-inhibitory effects of shGFP and the neutral effects of cntrl-shRNAs (Figure 1C,H). For RMS and NMS, relative growth of less than 52% or less than 40% of cells infected with cntrl-shRNAs (light gray line in Figure 1D,E, and I, J), respectively, was associated with a false discovery rate less than 30%. Growth differences between cells subjected to silencing of one specific candidate gene and cntrl-shRNA-infected cells were tested for statistical significance using T-tests. Q-values were estimated using the algorithm published by J. W. McNicol and G. Hogan (McNicol, 2013). The growth-inhibitory effects of shRNA-mediated silencing of individual candidate genes were considered significant if p<0.0001 and q<0.01 and 3 shRNAs scored with an FDR<30%.Candidate gene contributions to Kras;p16p19 sarcoma growth were tested using a customized, in vitro shRNA proliferation screen designed using shRNAs from The RNAi Consortium (TRC) delivered in puromycin-selectable pLKO lentiviral vectors. The screen was performed in ten 96-well-plates (DAS36-DAS45, Supplementary files 3–4) using one shRNA per well. Five discrete shRNAs were used for each of the 141 candidate genes. The screen also included 3 shRNAs directed against KRAS (shKRAS; positive control) and control shRNAs directed against RFP, LUC or LACZ (cntrl; negative control). Additionally, two 96-well-plates (CTR01, Supplementary files 5–6) were infected with shRNAs directed against GFP (shGFP; silencing KRAS-IRES-GFP and thereby serving as a positive control) and control shRNAs directed against RFP, LUC and LACZ. Empty pLKO lentiviral vectors (designated PGW; did not contain shRNAs) and medium (medium; did not contain any virus) served as transduction and puromycin controls, respectively. TRC clone IDs and viral titers are listed in Supplementary files 1–4. The screen was performed using the Kras;p16p19 RMS line T14R and the Kras;p16p19 NMS line Sca1-01.
Immunohistochemistry
Primary humansarcoma tissue was evaluated using commercially available sarcoma tissue arrays (SO2081, US Biomax, Rockville, MD). Humansarcoma sections were stained for ASNS (1 in 100, HPA029318, Sigma; human brain served as positive and muscle as negative control tissue). Mousetumors were stained for ASNS (1 in 200, HPA029318, Sigma). Antigen retrieval was performed in 10 mM sodium citrate buffer pH6, and tissue sections were blocked in PBS, 5% BSA, pH7.4.
RNA isolation and qRT-PCR
RNA was isolated from fetal and adult whole skeletal muscle, human RD, HT1080, Rh3, Rh5, Rh10, Rh28, Rh30, Rh41 and Rh36 cells by TRIzol extraction followed by DNAse digestion and purification using the RNeasy Plus Micro Kit. RNA was reverse transcribed using Superscript III First-Strand Synthesis System (Life Technologies) for RT-PCR (Invitrogen). qRT-PCR was performed using an ABI 7900 RT-PCR system (Applied Biosystem) with SYBR-green PCR reagents (Life Technologies). HumanASNS and mouseGls detected using the following primer sequences (Eurofins MWG Operon, Huntsville, AL): GGAAGACAGCCCCGATTTACT (ASNS, fw), AGCACGAACTGTTGTAATGTCA (ASNS, rev), TTCGCCCTCGGAGATCCTAC (Gls, fw), CCAAGCTAGGTAACAGACCCT (Gls, rev).
Western blot
Cells were lysed for 10 min on ice in 50 mM HEPES (4-(2- hydroxyethyl)-1-piperazineethanesulfonic acid), pH7.4, 40 mM NaCl, 2 mM EDTA, 10 mM sodium pyrophosphate, 10 mM sodium beta-glycerophosphate, 1% Triton X containing complete mini protease inhibitor cocktail (Roche, Indianapolis, IN), 50mM NaF and 1 mM sodium orthovanadate. Equal amounts of extract were processed for Western blot using rabbit polyclonal anti-ASNS antibody (1 in 250, HPA029318, Sigma). ASNS protein expression was evaluated using rabbit polyclonal anti-ASNS antibody (1 in 250, HPA029318, Sigma). Immune complexes were detected by chemiluminescence (ECL, 32132, Thermo Fisher Scientific, Waltham, MA).
Proliferation assays
Sarcoma cells were exposed to asparaginase (0.1-10 IU/ml, stock 5 IU/ml in 0.9% NaCl, MyBioSource, San Diego, CA) and AS5 (50-500 mM, stock 10 mM in 0.9% NaCl, synthesized by Nigel G Richards). Proliferation assays were performed as previously described (Hettmer et al., 2011). Cells were plated at 1000–7000 cells per well on day -1 and exposed to chemicals or vehicle on days 0 and 2. Cell growth was determined by MTT assay (Cayman Chemicals, Ann Arbor, MI) on day 4 and quantified as fold-increase in MTT uptake compared with baseline. All assays were performed in triplicate and replicated in two to four independent experiments. Estimated EC50 concentrations were calculated using GraphPad Prism.
ASNS silencing
ASNS expression was silenced using TRC shRNAs delivered in pLKO vectors. TRC clones TRCN0000324779, TRCN0000031703 and TRCN0000031702 were used to silence mouseAsns. TRC clones TRCN0000045875 and TRCN0000045877 were used to silence humanASNS. TRC clones TRCN0000033260 and TRCN0000033262 were used to silence Kras in mousesarcoma lines. Control cells were infected with lentiviruses carrying TRCN0000072250 (shLUC) and TRCN0000072250 (shLUC) or TRCN0000072231 (shLACZ) and TRCN0000072240 (shLACZ) to control for off-target effects.MouseKras;p16p19RMS and NMS cells were plated at 1000 cells per well on day -1, infected with lentiviruses in the presence of 8 μg/ml polybrene on day 0 and selected with puromycin at a final concentration of 2 μg/ml starting day 1. Effects of ASNS silencing were evaluated on days 3–5. HumanRh30 cells were plated at 5000 cells per well on day -1, infected with lentiviruses in the presence of 8μg/ml polybrene on day 0 and selected with puromycin at a final concentration of 0.5 μg/ml starting day 1. Transduced Rh30 cells were passaged and re-plated at 5000 cells per well. Effects of ASNS silencing were evaluated 3–5 days after replating.
Annexin V staining
Annexin V staining was performed according to the manufacturer’s instructions using Annexin V-APC (550474, BD Biosciences, Franklin Lakes, NJ) and PI.
BrdU assay
Cells were incubated with 10 mM BrdU (552598, BD Biosciences, Franklin Lakes, NJ) for one hour at 37oC. The BD BrdU flow kit (552598, BD Biosciences) was used to fix and permeabilize cells prior to DNAse treatment and staining with anti-BrdU-APC (1 in 20, 17-5071-42, eBioscience, San Diego, CA) and Dapi (1 in 1000).
OP-puromycin staining
OP-puromycin (MedChemExpress, Monmouth Junction, NJ) was reconstituted in PBS pH6.4 and stored at minus 20 degrees centigrade. Cells were incubated with 50 μM OP-puromycin for 1 hr at 37 degrees centigrade, fixed and stained with Alexa Fluor 555-Azide (Life Technologies) as previously described (Liu et al., 2012). Control cells were treated with 50 μg/ml cycloheximide for 15 min immediately prior to OP-puromycin exposure. Alexa Fluor 555 labeling was analyzed using an Olympus IX51 microscope at 20X.In vivo asparaginase treatment. Asparaginase was reconstituted in 0.9% normal saline (NS) and stored at 4oC up to 3 weeks. Mice were treated daily with Asparaginase (Elspar, Lundbeck Inc, Deerfield, IL) by intraperitoneal injection at 1500 IU/kg (Szymanska et al., 2012).
Serum amino acid levels
Amino acid levels in mouse serum were determined by HPLC.
Statistics
Differences in cell growth, tumor growth, Annexin staining, BrdU staining and serum amino acid levels were tested for statistical significance using T-tests. Differences in tumor latency were evaluated by logrank (Mantel-Cox) test (ns p≥0.05, *p<0.05, **p<0.01, ***p <0.001).eLife posts the editorial decision letter and author response on a selection of the published articles (subject to the approval of the authors). An edited version of the letter sent to the authors after peer review is shown, indicating the substantive concerns or comments; minor concerns are not usually shown. Reviewers have the opportunity to discuss the decision before the letter is sent (see review process). Similarly, the author response typically shows only responses to the major concerns raised by the reviewers.Thank you for submitting your work entitled "Functional genomic screening reveals asparagine dependence as a metabolic vulnerability in sarcoma" for peer review at eLife. Your submission has been favorably evaluated by Fiona Watt (Senior Editor) and three reviewers, one of whom is a member of our Board of Reviewing Editors.The following individuals responsible for the peer review of your submission have agreed to reveal their identity: Hideyuki Okano (Reviewing Editor) and Yoji Minamishima (peer reviewer).The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission.The manuscript by Hettmer and colleagues presents the results of an shRNA-based proliferation screen in a p1619 KRAS (G12v) model of RMS and identifies asparagine synthethase (ASNS) as a main contributor to proliferation in the screened cells. It further shows a decrease in cell proliferation, increase in cell death and decrease of polypeptide synthesis after ASNS silencing in the model cells and human RMS cell line, effects that can be reversed by addition of exogenous asparagine.All the experiments seemed to be well designed. All the data seems to be firm, have adequate controls and looks reliable. Although Asn requirement was already known in other malignant tumors such as ALL, it would be still valuable knowledge that Asn could be therapeutic target in sarcomas, which have fewer therapeutic options.The authors need to address the following issues before the manuscript is acceptable for publication:1) The authors clearly showed that Asn depletion suppressed nascent polypeptide synthesis, which might suppress tumor growth. If it is the cause of the tumor growth suppression, depletion of other amino acids would do the same. It would be very nice for the readers if the authors have some comments or discussion on why only Asn is required or why other amino acid metabolism pathway were not picked up by their screening. Furthermore, are the rescuing effects of Asn dose-dependent?2) Similarly, ASNS reaction is coupled with Gln-Glu conversion. Asparaginase treatment or ASNS-knockdown might reduce Glu abundance. On the other hand, supplementation of Asn will interfere with ASNS enzyme activity, which might suppress Glu production. The authors should briefly comment on why Gln or Glu is not involved in this context. For example, Gln/Glu could be generated by other metabolic pathways, or something like that. Thus, evaluation of asparagine, aspartate, glutamine, glutamate levels before and after the treatment would be required.3) Based on these data, the authors need to provide some mechanistic insight revealing why the combination of asparagine depletion and ASNS inhibition is required for inhibition of tumor growth in vivo. Is the inhibitory effect on polypeptide chain synthesis the only underlying mechanism for the observed metabolic vulnerability in sarcoma (i.e. tumor growth suppression)?1) The authors clearly showed that Asn depletion suppressed nascent polypeptide synthesis, which might suppress tumor growth. If it is the cause of the tumor growth suppression, depletion of other amino acids would do the same. It would be very nice for the readers if the authors have some comments or discussion on why only Asn is required or why other amino acid metabolism pathway were not picked up by their screening. Furthermore, are the rescuing effects of Asn dose-dependent?We agree with the reviewers that it is very well possible that sarcoma growth and survival require adequate availability of amino acids other than asparagine. Unfortunately, the design of the shRNA proliferation screen described in this study did not allow for comprehensive functional testing of genes encoding for enzymes relevant in amino acid biosynthesis. Instead, the screen was designed to evaluate the functional contributions of a particular group of sarcoma signature genes that were expressed at higher levels in both Ras-driven mousesarcomas and humansarcomas. Within this cluster of sarcoma genes, top-scoring cellular functions were cell cycle control and cell division (Hettmer et al., 2011).Nonetheless, in addition to ASNS, the candidate group of sarcoma genes we evaluated in this study did include 3 other transcripts encoding for enzymes relevant in amino acid biosynthesis. These enzymes were phosphoserine aminotransferase (PSAT1), phosphoglycerate dehydrogenase (PHGDH) and branched chain aminotransferase 1 (BCAT1). Recently published findings indicate that high expression of PHGDH in tumor tissue is a requirement for cell growth in epithelial malignancies (Locasale et al., 2011; Possemato et al., 2011), and both PHGDH and PSAT1 contribute to serine/glycine biosynthesis which plays an important role in supporting nucleotide synthesis in rapidly proliferating cells (Labuschagne et al., 2014; Jain et al., 2012). Branched chain amino acids provide anaplerotic substrates for the TCA cycle (Boroughs and DeBerardinis, 2015). However, in our screen, silencing of PSAT1, PHGDH or BCAT1 did not result in growth inhibition, suggesting that sarcoma cells show lesser dependence on these pathways.To provide a more comprehensive discussion of amino acid metabolism pathways in tumor cell growth, we have revised manuscript to include the above considerations (Discussion, fourth and fifth paragraphs). We also included a new series of experiments documenting the effects of increasing concentrations of asparagine on the growth of shASNS and sh-LUC-transduced mouseKras;p16p19 RMS and NMS cells. These experiments revealed that ≥ 10mg/L asparagine was needed to rescue the growth-inhibitory effects of ASNS silencing, whereas 0.01 – 1mg/L asparagine were insufficient. Interestingly, normal asparagine concentrations in mouse and human plasma are 3.8mg/L and 7.3mg/L, respectively (Cooney et al., 1970). Thus, even slight reductions in physiologic asparagine levels make sarcoma cells vulnerable to ASNS silencing (see Figure 2–figure supplement 2 and subsections “ASNS silencing inhibits growth of mouseKras;p16p19 sarcoma cells by asparagine starvation” and”Asparagine depletion impedes mousesarcoma growth in vivo”).2) Similarly, ASNS reaction is coupled with Gln-Glu conversion. Asparaginase treatment or ASNS-knockdown might reduce Glu abundance. On the other hand, supplementation of Asn will interfere with ASNS enzyme activity, which might suppress Glu production. The authors should briefly comment on why Gln or Glu is not involved in this context. For example, Gln/Glu could be generated by other metabolic pathways, or something like that. Thus, evaluation of asparagine, aspartate, glutamine, glutamate levels before and after the treatment would be required.Asparagine synthetase catalyzes the biosynthesis of asparagine from aspartate through an ATP-dependent transamination reaction. In this reaction, glutamine (Gln) acts as amino group donor and is converted into glutamate (Glu). As noted by the reviewers, ASNS inhibition or exogenous Asparaginase treatment should result in increased aspartate and glutamine, as well as decreased glutamate levels. As suggested, we confirmed this by measuring amino acid levels before and after treatment in Asparaginase treated mice (Supplementary file 7).As the reviewer correctly points out, we cannot exclude that glutamate deprivation and/or aspartate excess negatively impact sarcoma cell survival/proliferation in addition to the growth inhibitory effects of asparagine withdrawal. However, increased glutaminase expression in cancer cells (Huang et al., 2014) could counterbalance glutamate reduction, especially in a glutamine-rich environment. Aspartate, on the other hand, carries reducing equivalents in the malate-aspartate shuttle (Chen et al., 2013), and increased aspartate levels after ASNS knockdown conceivably would benefit the redox state of sarcoma cells. Nonetheless, we recognize that disruption of Gln/Glu metabolism may represent an additional mechanism by which modulation of asparagine availability disrupts sarcoma cell growth.We have addressed all of these important points in the revised manuscript, including an explicit discussion of the potential effects of altered glutamate/aspartate availability after Asparagine depletion (Discussion, third paragraph). We also demonstrated increased expression of Glutaminase transcripts in Kras;p16p19 sarcoma cells compared to normal mouse skeletal muscle (see Figure 2–figure supplement 3 and the aforementioned paragraph), which, as noted above, may counterbalance glutamate reduction due to ASNS inhibition.3) Based on these data, the authors need to provide some mechanistic insight revealing why the combination of asparagine depletion and ASNS inhibition is required for inhibition of tumor growth in vivo. Is the inhibitory effect on polypeptide chain synthesis the only underlying mechanism for the observed metabolic vulnerability in sarcoma (i.e. tumor growth suppression)?In our experiments, ASNS silencing in sarcoma cells did not impede sarcoma growth in vivo unless systemic asparagine was depleted by treatment with asparaginase. One could argue that limited nutrient availability within a rapidly enlarging solid tumor and slow asparagine uptake speak against repletion of tumor cell asparagine content from systemic sources. Nevertheless, our data support the notion that exogenous asparagine in the cell environment restores intracellular asparagine availability after ASNS silencing. This is discussed more extensively in the revised manuscript (Discussion, first paragraph).Up until recently, the only known use of asparagine in mammalian cells was in protein synthesis, Asparagine does not contain the reducing equivalents of certain other amino acids, and Aspartate consumption due to Asparagine biosynthesis may diminish the reducing power of the malate-aspartate shuttle (Boroughs and DeBerardinis, 2015. Metabolic pathways promoting cancer cell survival and growth. Nat Cell Biol, 17, 351-9.; Chen et al., 2013; Huang et al., 2014). However, we agree with the reviewers that impaired peptide biosynthesis may not be the only mechanism responsible for the asparagine dependence of sarcoma cells observed in this study. Recently published data revealed that, surprisingly, asparagine supplementation suppressed cell death in glutamine-deprived cells (although it did not restore TCA anaplerosis and proliferation) (Huang et al., 2014). Thus, Asparagine appears to promote cellular adaptation to metabolic stress such as glutamine depletion. Zhang et al. also noted that asparagine is the last amino acid synthesized in the TCA cycle and that its amination exclusively depends on glutamine (Huang et al., 2014). Amino acid availability is known to stimulate mechanistic target of rapamycin (mTOR) complex 1, which integrates environmental and intracellular signals to regulate cell growth (Jewell et al., 2015). Taken together, these observations by ourselves and others suggest that Asparagine may serve a central role as a cellular sensor of TCA cycle intermediate/reduced nitrogen availability and, ultimately, as a metabolic regulator of cell behavior.An in-depth discussion of potential other mechanisms responsible for sarcoma cell asparagine dependence was added to the revised manuscript (Discussion, fourth paragraph).
Authors: Jason W Locasale; Alexandra R Grassian; Tamar Melman; Costas A Lyssiotis; Katherine R Mattaini; Adam J Bass; Gregory Heffron; Christian M Metallo; Taru Muranen; Hadar Sharfi; Atsuo T Sasaki; Dimitrios Anastasiou; Edouard Mullarky; Natalie I Vokes; Mika Sasaki; Rameen Beroukhim; Gregory Stephanopoulos; Azra H Ligon; Matthew Meyerson; Andrea L Richardson; Lynda Chin; Gerhard Wagner; John M Asara; Joan S Brugge; Lewis C Cantley; Matthew G Vander Heiden Journal: Nat Genet Date: 2011-07-31 Impact factor: 38.330
Authors: Simone Hettmer; Jianing Liu; Christine M Miller; Melissa C Lindsay; Cynthia A Sparks; David A Guertin; Roderick T Bronson; David M Langenau; Amy J Wagers Journal: Proc Natl Acad Sci U S A Date: 2011-11-30 Impact factor: 11.205
Authors: Mukundh N Balasubramanian; Elizabeth A Butterworth; Michael S Kilberg Journal: Am J Physiol Endocrinol Metab Date: 2013-02-12 Impact factor: 4.310
Authors: Xiang Chen; Elizabeth Stewart; Anang A Shelat; Chunxu Qu; Armita Bahrami; Mark Hatley; Gang Wu; Cori Bradley; Justina McEvoy; Alberto Pappo; Sheri Spunt; Marcus B Valentine; Virginia Valentine; Fred Krafcik; Walter H Lang; Monika Wierdl; Lyudmila Tsurkan; Viktor Tolleman; Sara M Federico; Chris Morton; Charles Lu; Li Ding; John Easton; Michael Rusch; Panduka Nagahawatte; Jianmin Wang; Matthew Parker; Lei Wei; Erin Hedlund; David Finkelstein; Michael Edmonson; Sheila Shurtleff; Kristy Boggs; Heather Mulder; Donald Yergeau; Steve Skapek; Douglas S Hawkins; Nilsa Ramirez; Philip M Potter; John A Sandoval; Andrew M Davidoff; Elaine R Mardis; Richard K Wilson; Jinghui Zhang; James R Downing; Michael A Dyer Journal: Cancer Cell Date: 2013-12-09 Impact factor: 31.743
Authors: Barbara Szymanska; Urszula Wilczynska-Kalak; Min H Kang; Natalia L M Liem; Hernan Carol; Ingrid Boehm; Daniel Groepper; C Patrick Reynolds; Clinton F Stewart; Richard B Lock Journal: PLoS One Date: 2012-03-29 Impact factor: 3.240
Authors: Richard Possemato; Kevin M Marks; Yoav D Shaul; Michael E Pacold; Dohoon Kim; Kıvanç Birsoy; Shalini Sethumadhavan; Hin-Koon Woo; Hyun G Jang; Abhishek K Jha; Walter W Chen; Francesca G Barrett; Nicolas Stransky; Zhi-Yang Tsun; Glenn S Cowley; Jordi Barretina; Nada Y Kalaany; Peggy P Hsu; Kathleen Ottina; Albert M Chan; Bingbing Yuan; Levi A Garraway; David E Root; Mari Mino-Kenudson; Elena F Brachtel; Edward M Driggers; David M Sabatini Journal: Nature Date: 2011-08-18 Impact factor: 49.962
Authors: Dana M Gwinn; Alex G Lee; Marcela Briones-Martin-Del-Campo; Crystal S Conn; David R Simpson; Anna I Scott; Anthony Le; Tina M Cowan; Davide Ruggero; E Alejandro Sweet-Cordero Journal: Cancer Cell Date: 2018-01-08 Impact factor: 31.743
Authors: Marielle E Yohe; Christine M Heske; Elizabeth Stewart; Peter C Adamson; Nabil Ahmed; Cristina R Antonescu; Eleanor Chen; Natalie Collins; Alan Ehrlich; Rene L Galindo; Berkley E Gryder; Heidi Hahn; Sharon Hammond; Mark E Hatley; Douglas S Hawkins; Madeline N Hayes; Andrea Hayes-Jordan; Lee J Helman; Simone Hettmer; Myron S Ignatius; Charles Keller; Javed Khan; David G Kirsch; Corinne M Linardic; Philip J Lupo; Rossella Rota; Jack F Shern; Janet Shipley; Sivasish Sindiri; Stephen J Tapscott; Christopher R Vakoc; Leonard H Wexler; David M Langenau Journal: Pediatr Blood Cancer Date: 2019-06-21 Impact factor: 3.167
Authors: H Helen Lin; Yiyin Chung; Chun-Ting Cheng; Ching Ouyang; Yong Fu; Ching-Ying Kuo; Kevin K Chi; Maryam Sadeghi; Peiguo Chu; Hsing-Jien Kung; Chien-Feng Li; Kirsten H Limesand; David K Ann Journal: Autophagy Date: 2018-08-21 Impact factor: 16.016
Authors: Laura Hulea; Simon-Pierre Gravel; Masahiro Morita; Marie Cargnello; Oro Uchenunu; Young Kyuen Im; Camille Lehuédé; Eric H Ma; Matthew Leibovitch; Shannon McLaughlan; Marie-José Blouin; Maxime Parisotto; Vasilios Papavasiliou; Cynthia Lavoie; Ola Larsson; Michael Ohh; Tiago Ferreira; Celia Greenwood; Gaëlle Bridon; Daina Avizonis; Gerardo Ferbeyre; Peter Siegel; Russell G Jones; William Muller; Josie Ursini-Siegel; Julie St-Pierre; Michael Pollak; Ivan Topisirovic Journal: Cell Metab Date: 2018-09-20 Impact factor: 27.287
Authors: Abigail S Krall; Peter J Mullen; Felicia Surjono; Milica Momcilovic; Ernst W Schmid; Christopher J Halbrook; Apisadaporn Thambundit; Steven D Mittelman; Costas A Lyssiotis; David B Shackelford; Simon R V Knott; Heather R Christofk Journal: Cell Metab Date: 2021-02-19 Impact factor: 27.287