Literature DB >> 26484234

Transcriptomic analyses of maize ys1 and ys3 mutants reveal maize iron homeostasis.

Tomoko Nozoye1, Hiromi Nakanishi2, Naoko K Nishizawa3.   

Abstract

To acquire iron (Fe), graminaceous plants secrete mugineic acid family phytosiderophores (MAs) (Takagi, 1976 [1]) through the MAs efflux transporter TOM1 (Nozoye et al., 2011 [2]) and take up Fe in the form of Fe(III)-MAs complexes through the Fe(III)-MAs transporter YS1 (Curie et al., 2001 [3]). Yellow stripe 1 (ys1) and ys3 are recessive mutants of maize (Zea mays L.) that result in symptoms typical of Fe deficiency, i.e., interveinal chlorosis of the leaves. The ys1 mutant is defective in the YS1 transporter and is therefore unable to take up Fe(III)-MAs complexes. While the ys3 mutant has been shown to be defective in MA release, the causative gene has not been identified. The objective of the present work was to identify the genes responsible for the ys1 and ys3 phenotypes, so as to extend our understanding of Fe homeostasis in maize by qRT-PCR. In agreement with previous reports, the expression level of YS1 was decreased in the ys1 mutant. Moreover, we identified that the expression level of a homolog of TOM1 in maize (ZmTOM1) was significantly decreased in the ys3 mutant. Here described the quality control and analysis that were performed on the dataset. The data is publicly available through the GEO database with accession number GSE44557. The interpretation and description of these data are included in a manuscript (Nozoye et al., 2013 [4]).

Entities:  

Keywords:  Iron; Maize; Mugineic acid family phytosiderophores; Plant; qRT-PCR

Year:  2015        PMID: 26484234      PMCID: PMC4583638          DOI: 10.1016/j.gdata.2015.05.021

Source DB:  PubMed          Journal:  Genom Data        ISSN: 2213-5960


Direct link to deposited data

http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE44557.

Experimental design, materials and methods

Plant materials

The homozygous seeds of Yellow stripe 1 (ys1) and ys3 mutant plants were used to identify the genes responsible for the ys1 and ys3 phenotypes, and to extend our understanding of Fe homeostasis in maize. A WT cultivar (Alice) was used as a control, as even though it has a different genetic background from ys1 [3] and ys3 [4], this line was previously used in a study of the ys1 mutant [5]. Seedlings germinated for 4 days in the dark at 25 °C were grown hydroponically in a nutrient solution that contained 0.7 mM K2SO4, 0.1 mM KCl, 0.1 mM KH2PO4, 2.0 mM Ca(NO3)2, 0.5 mM MgSO4, 10 mM H3BO3, 0.5 mM MnSO4, 0.2 mM CuSO4, 0.5 mM ZnSO4, 0.05 mM Na2MoO4, and 0.1 mM Fe(III)-EDTA. Fe deficiency was initiated 8 days after germination by transfer of the plants to Fe(III)-EDTA-free culture medium. Maize plants grown hydroponically under Fe-sufficient or Fe-deficient conditions for 5 days were harvested at the same time.

RNA preparation

The maize plants grown hydroponically were immediately frozen in liquid nitrogen. Total RNA was extracted from the shoots and roots of three plants per treatment using an RNeasy Plant Kit (Qiagen, Hilden, Germany) in accordance with the manufacturer's instructions. The yield and purity of the RNA were determined spectrophotometrically. To confirm the biological replicates, RNA was separately extracted from the shoots and roots of three to five plants per treatment.

Quantitative real-time PCR

Total RNA (3 μg) was treated with RNase-free DNase I (Takara, Kyoto, Japan) to remove contaminating genomic DNA. First-strand cDNA was synthesized using ReverTra Ace reverse transcriptase (Toyobo, Tokyo, Japan) by priming with oligo-d(T)30. For quantitative RT-PCR, a fragment was amplified by PCR in a StepOnePlus Real-Time PCR system (Applied Biosystems, Foster City, CA) with SYBR Green I and ExTaq™ Real-Time PCR Version (Takara) according to the manufacturers' instructions. The template concentration was adjusted to 30 ng per reaction. The primers used for real-time PCR are described in Table 1. The primers used as the internal control (ZmUbiquitin, GRMZM2G118637) in RT-PCR were as follows: ZmUbiquitin forward, 5′-GTTGAAGCTGCTGCTGTATCTGG-3′ and ZmUbiquitin reverse, 5′-GCGGTCGCACGATAGTTTTG-3′.
Table 1

Primers used for quantitative real-time PCR.

Gene nameGene ID in GrameneFW (3′–5′)RV (3′–5′)
ZmMTNGRMZM2G171111GCTAGGCTACGAACAATACAACATCTGGATTAGGAGTAGG
ZmAPTGRMZM2G093347ACAAACTTGGGGACAGGCCAACTCTAACTCTCTGAGAAGA
ZmMTKGRMZM2G464137CCTGCCTGATATATACAACACTTGCTGGCATCCTTGATTG
ZmIDI2GRMZM2G139533CTCTTCATTCGGGGGGAGTTGGAGAGATCAATGGAAGTTA
ZmFDHGRMZM2G049811CTGATTCTGCTCAGGAACTTTCTCCGTAAGAGGTGTGTTG
ZmIDI4GRMZM2G067265CTGAGGCAATAGCTGCAACCAGACCTCATCTGAGAACAGC
ZmRPIGRMZM2G035599GGCGTCGTCGAGCACGGCATCTTCCTTTCCATGACTGCGA
ZmPRPPsGRMZM2G065030GACCTCCGTTTGAGGTTCTGCGAGCATCGACAGTAAGTAC
ZmIRO2GRMZM2G057413AACGACCTCTACTCCTCGCTCTGCAGCTCCGGGATGTACT
ZmIRO3GRMZM2G350312AGATTCATAAGGCTGAGAGGTCGAAGAGAGTCTACTTGAA
ZmNAS1GRMZM2G034956ATCCTGAGGACATTCGTCGCCAGCGATTTGTAACTATTAT
ZmNAS3GRMZM2G478568CGTGTCTACACCACATGCGTGAGCTAAGCTACATGCTAA
ZmDMAS1GRMZM2G060952CTGATCGTGAAGAGCTTCGAGCAGGGCAGTGGCACGCATT
YS1GRMZM2G156599CACTCATCAGCAAGCAGAAATGCAGACTCTTAACAGTGAC
ZmTOM1GRMAM2G063306AAGTGTAAATTCATGCCGTGGATCCCCTGGAAAGAAGGCA
ZmTOM2GRMZM5G877788GTTTCGTCGGCGCTATCCATAAGAACGCGGCATGCTGGCG
ZmTOM3GRMZM2G141081GTGCTTTCAGTCACAGGCGTATAGGTCCAAGGATTTTGTT
ZmIRT1GRMZM2G118821CTCAGATACGAATACGATCATCCAGCTCCTCTGCTTCCTC
ZmNRAMP1GRMZM2G178190GAGCAAATCATGGGGTCGTTTGGATCTACAGCACTGTTCC
ZmMATE2/ZmPEZ1GRMZM2G170128CTCCTAGGCTTCTACTTTGAAGTTGGTCCTGAATGTAACC

Data normalization

Because the maize genes analyzed in this study were not cloned, normalization of quantitative real-time PCR was performed by the comparative Ct method calculation according to the manufacturer's instructions (Applied Biosystems StepOnePlus™ Real-Time PCR system). Briefly, relative quantitation was calculated as follows. The threshold cycle (Ct) indicates the fractional cycle number at which the quantity of amplified target reaches a specified threshold. First, the amount of target was normalized to endogenous reference. There is a relation between the amount of the endogenous reference and the amount of PCR products by Ct value as follows: the amounts of PCR products by Ct value = the amount of the endogenous reference X 2Ct. Therefore, △Ct value is calculated as follows: △Ct = Ct value of the target – Ct value of the endogenous reference. Secondly, the difference between the calibrator which is used as base and the △Ct is calculated as follows: △△Ct = △Ct value of the target - △Ct value of the endogenous reference. Finally, the relative quantitative value is calculated as follows: the relative quantitative value = 2-△△Ct. Since the relative quantitative value of the calibrator is 20 = 1, the other samples are calculated as the relative quantitative value when the value of calibrator is 1.The principle of the comparative Ct method calculation is described in ABI PRISMⓇ 7700 Sequence Detection Systems User Bulletin #2 (www.appliedbiosystems.co.jp).

Data validation

The data show the relative increase or decrease of the gene expression level in each sample compared to the gene expression levels in Fe-sufficient shoots of the non-transformant (NT) in three experimental replicates and three to five biological replicates. Because the cultivar among ys1, ys3 and WT were different from each other, it was possible that there are polymorphisms in the analyzed genes and the efficiency of PCR are different from each other. Therefore, the sizes and sequences of the amplified fragments were confirmed by agarose gel electrophoresis (Fig. 1) and with an automated sequencer (3130 Genetic Analyzer; Applied Biosystems), respectively. Analysis of variance with the Tukey–Kramer HSD test was used to compare data.
Fig. 1

Agarose gel electrophoresis of the amplified fragments by RT-PCR.

Discussion

Herein we described transcriptional profiling of Fe recessive mutants ys1 and ys3 in the different cultivars. In this dataset, we confirmed the decrease of YS1 expression level in ys1 compared to WT as described previously. The expression level of YS1 was not altered in ys3. In addition, we found that the expression level of ZmTOM1 was decreased in ys3 compared to WT, but not in ys1. Both YS1 [3] and TOM1 [2] are important transporter of MAs [1] which is involved in not only Fe acquisition from soil but also Fe homeostasis in the plant body. We believe that this dataset could provide insights into the characteristics of the YS1 and TOM1 transporters which involved in MAs transport to maintain Fe homeostasis in maize. We believed that the method in this dataset may assist in elucidation of the various mutants which are from different cultivars.

Disclosures

All authors possess no conflicts of interests.
Specifications
Organism/cell line/tissueZea mays
SexN/A
Sequencer or array typeStepOnePlus Real-Time PCR system (Applied Biosystems, Foster City, CA, USA)
Data formatNormalized with housekeeping genes: ZmUbiquitin; GRMZM2G118637.
Experimental factorsys1 mutant vs. WT, ys3 mutant vs. WT under Fe-sufficient or Fe-deficient condition
Experimental featuresqRT-PCR gene expression profiling to identify the genes responsible for the ys1 and ys3 phenotypes.
ConsentN/A
Sample source locationThe University of Tokyo, Tokyo, Japan
  4 in total

1.  Maize yellow stripe1 encodes a membrane protein directly involved in Fe(III) uptake.

Authors:  C Curie; Z Panaviene; C Loulergue; S L Dellaporta; J F Briat; E L Walker
Journal:  Nature       Date:  2001-01-18       Impact factor: 49.962

2.  Iron Inefficiency in Maize Mutant ys1 (Zea mays L. cv Yellow-Stripe) Is Caused by a Defect in Uptake of Iron Phytosiderophores.

Authors:  N. Von Wiren; S. Mori; H. Marschner; V. Romheld
Journal:  Plant Physiol       Date:  1994-09       Impact factor: 8.340

3.  Phytosiderophore efflux transporters are crucial for iron acquisition in graminaceous plants.

Authors:  Tomoko Nozoye; Seiji Nagasaka; Takanori Kobayashi; Michiko Takahashi; Yuki Sato; Yoko Sato; Nobuyuki Uozumi; Hiromi Nakanishi; Naoko K Nishizawa
Journal:  J Biol Chem       Date:  2010-12-14       Impact factor: 5.157

4.  Characterizing the crucial components of iron homeostasis in the maize mutants ys1 and ys3.

Authors:  Tomoko Nozoye; Hiromi Nakanishi; Naoko K Nishizawa
Journal:  PLoS One       Date:  2013-05-08       Impact factor: 3.240

  4 in total
  2 in total

1.  Identification of Quantitative Trait Loci Associated With Iron Deficiency Tolerance in Maize.

Authors:  Jianqin Xu; Xiaoyang Zhu; Fang Yan; Huaqing Zhu; Xiuyu Zhou; Futong Yu
Journal:  Front Plant Sci       Date:  2022-04-14       Impact factor: 6.627

2.  Genome-resolved metagenomics reveals role of iron metabolism in drought-induced rhizosphere microbiome dynamics.

Authors:  Ling Xu; Zhaobin Dong; Dawn Chiniquy; Grady Pierroz; Siwen Deng; Cheng Gao; Spencer Diamond; Tuesday Simmons; Heidi M-L Wipf; Daniel Caddell; Nelle Varoquaux; Mary A Madera; Robert Hutmacher; Adam Deutschbauer; Jeffery A Dahlberg; Mary Lou Guerinot; Elizabeth Purdom; Jillian F Banfield; John W Taylor; Peggy G Lemaux; Devin Coleman-Derr
Journal:  Nat Commun       Date:  2021-05-28       Impact factor: 14.919

  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.