Literature DB >> 26448924

Transcriptome Analysis of Interspecific Hybrid between Brassica napus and B. rapa Reveals Heterosis for Oil Rape Improvement.

Jinfang Zhang1, Guangrong Li2, Haojie Li1, Xiaobin Pu1, Jun Jiang1, Liang Chai1, Benchuan Zheng1, Cheng Cui1, Zujun Yang2, Yongqing Zhu3, Liangcai Jiang1.   

Abstract

The hybrid between Brassica napus and B. rapa displays obvious heterosis in both growth performance and stress tolerances. A comparative transcriptome analysis for B. napus (A(n)A(n)CC genome), B. rapa (A(r)A(r) genome), and its hybrid F1 (A(n)A(r)C genome) was carried out to reveal the possible molecular mechanisms of heterosis at the gene expression level. A total of 40,320 nonredundant unigenes were identified using B. rapa (AA genome) and B. oleracea (CC genome) as reference genomes. A total of 6,816 differentially expressed genes (DEGs) were mapped in the A and C genomes with 4,946 DEGs displayed nonadditively by comparing the gene expression patterns among the three samples. The coexistence of nonadditive DEGs including high-parent dominance, low-parent dominance, overdominance, and underdominance was observed in the gene action modes of F1 hybrid, which were potentially related to the heterosis. The coexistence of multiple gene actions in the hybrid was observed and provided a list of candidate genes and pathways for heterosis. The expression bias of transposable element-associated genes was also observed in the hybrid compared to their parents. The present study could be helpful for the better understanding of the determination and regulation of mechanisms of heterosis to aid Brassica improvement.

Entities:  

Year:  2015        PMID: 26448924      PMCID: PMC4581553          DOI: 10.1155/2015/230985

Source DB:  PubMed          Journal:  Int J Genomics        ISSN: 2314-436X            Impact factor:   2.326


1. Introduction

Brassica napus (rapeseed, AACC, 2n = 38) is one of the main oil crops used for human consumption and is widely grown in China, Canada, Europe, and Australia and increasingly grown in South America [1]. B. napus is likely derived from the natural hybridization and genome doubling from its two diploid parents, B. rapa (genome AA, 2n = 20) and B. oleracea (genome CC, 2n = 18) along the Mediterranean coastline in Southern Europe approximately 10,000 years ago [2]. However, there is evidence that the genetic diversity in rapeseed has been continuously reduced by extensive breeding efforts [3]. Approaches to increase the genetic variation of rapeseed have been made by introducing the genetic components from related species as B. napus can easily cross with one of its ancestral parents, B. rapa, to produce viable interspecies hybrids [4]. Due to the high crossability between B. napus and B. rapa, and low aneuploidy of their interspecific hybrids, different B. rapa accessions have been widely hybridized to rapeseed breeding program and novel agronomic traits from B. rapa have been successfully transmitted into commercial B. napus varieties [5]. Strong heteroses affecting both biomass and seed yield have been observed in hybrids derived from these interspecific crosses [6]. However, the genetic and molecular mechanism of heterosis in the interspecific hybrids has not been investigated. Heterosis is a prevalent phenomenon in evolution and breeding process of plants [7]. The hybrid offspring obtains the advantages in many agricultural and developmental traits including biomass yield, plant height, vigor, and stress tolerances from their parents, thereby improving the adaptation of the crop and subsequently increasing the global area sown [8]. Although heterosis has been widely utilized, the genetic and molecular basis of heterotic improvements remains unclear. Various genetic models have been proposed for explaining heterosis and include dominance, overdominance, and pseudo overdominance [9]. Heterotic interactions in the tetraploid B. napus can be derived from two types of allelic interactions, namely, those between the genomes of the two diploid progenitors as well as those between the two parental genomes making up a hybrid. Gene expression is potentially altered not only due to a dosage effect but also with gene functional divergence [8]. Epigenetic modification in hybrids genomes can also account for heterosis [10]. Emerging new technologies make it possible to investigate the DNA sequence, RNA transcripts, proteins, and metabolism products genome-wide, allowing for new insights into benefits of heterotic recombinations [7, 9]. Next generation sequencing technology utilizing RNA-seq has emerged as a powerful tool for investigating gene expression data at the whole genome level. Both the gene transcript and expression levels can be detected in RNA-seq which could provide new insights into the molecular mechanisms of heterosis [11]. Chinese cabbage, Brassica rapa (syn. B. campestris), contains two subspecies named pekinensis and chinensis. These two distinct groups are used as leafy vegetables widely across eastern Asia and have much genetic variation. In particular, B. rapa ssp. chinensis has wide morphological variation and is found in China, Korea, and Japan [12]. Recently, a number of genes responsible for developmental and stress tolerances were isolated [13-15], showing that B. rapa ssp. chinensis could be a novel resource for B. napus improvement. In this study, the transcriptomes of B. rapa ssp. chinensis Makino, B. napus, and their interspecific hybrid were sequenced to investigate the molecular basis of heterosis. Gene expression profiles were used to identify the number of differentially expressed genes, and gene expression levels were analyzed and compared among two parents and their hybrid. This data was used to give a better understanding of additive and nonadditive effects of genes and how these contribute to heterosis, thus providing new insights into the genetic and epigenetic mechanism of subgenomic heterosis in B. napus.

2. Materials and Methods

2.1. Sample Preparation and RNA Isolation

Three lines were grown in a green house at 22°C under 12 hours of light and 12 hours of darkness. Leaves of the seedling were harvested after 4 weeks by cutting off the sixth leaf of each seedling. The leaves of four plants were combined for RNA extraction. Samples were immediately frozen in liquid nitrogen and stored at −80°C until RNA was extracted. Total RNA of each sample was isolated using RNAprep Pure Plant Kit (Tiangen, Shanghai, China). RNA quality was characterized initially by NanoDrop ND1000 spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA) and then further assessed by RIN (RNA Integrity Number) value (>9.5) using Agilent 2100 Bioanalyzer (Santa Clara, CA, USA). Equal quantities of high-quality RNA from each sample were pooled for cDNA synthesis. Cytological observation of the F1 hybrid was performed as described by Zhan et al. [16].

2.2. cDNA Library Construction for Illumina Sequencing

The cDNA library was constructed following the manufacturer's instructions of mRNA-Seq Sample Preparation Kit (cat. number RS-930-1001, Illumina, Inc., San Diego, CA). Briefly, the poly(A) mRNA was isolated from total RNA samples with Magnetic Oligo (dT) Beads. The mRNA was then fragmented into small pieces using RNA fragmentation kit (Ambion). Using these short fragments as the templates, the first cDNA strand was synthesized using random hexamer primers and reverse transcriptase (Invitrogen), and the second-strand cDNA was synthesized using DNA polymerase I and RNase H. The cDNA fragments were purified using the QiaQuick PCR extraction kit (Qiagen) and resolved with EB buffer for end reparation and poly(A) addition. The short fragments were then connected with sequencing adapters, and the products were subsequently purified and amplified via PCR. Libraries were prepared from a 400–500 bp size-selected fraction following adapter ligation and agarose gel separation. The quality control analysis on the sample library was performed to quantify the DNA concentration and validate the library. After validation with an Eppendorf Mastercycler Real-Time PCR System, the cDNA libraries were sequenced on the Illumina Hiseq 2000 platform with read length of 2 × 100 bp. The sequencing-derived raw image data were transformed by base calling into sequence data using Illumina Pipeline Software v1.6. The raw sequencing reads have been submitted to NCBI Short Read Archive under the accession number of SRR2131203, SRR2134440, and SRR2134444.

2.3. Sequence Data Analysis and Expression Analysis

The raw reads were cleaned by removing adapter sequences, low-quality sequences (reads with ambiguous bases “N”), and reads with more than 10%  Q < 20 bases. To analyze transcript abundance levels, the uniquely mapped reads for a specific gene were counted by mapping reads to de novo assembled distinct sequences using SOAP2 software [17], and the RPKM (Reads Per Kb per Million reads) values were computed as proposed by Mortazavi et al. [18]. Gene transcript abundance differences were obtained from RPKM values using a method modified from Audic's proposal [19]. Gene expression levels were calculated with the RPKM method which is able to eliminate the influence of different gene lengths and sequencing discrepancy within the calculation of gene expression.

2.4. Statistics

Statistical analysis of the phenotypic data was performed with a Welch two-sample t-test in R (R Development Core Team 2005) [20]. Midparent heterosis (MPH) values were calculated using the formula MPH = (h − (P1 + P2)/2)/((P1 + P2)/2)∗100 + 100 (whereas h is the value of the hybrid and P1 and P2 are the values of the one and the other parental line). To test for significance of MPH values the contrast h − (P1 + P2)/2 was used [21].

2.5. Quantitative RT-PCR Validation of Differentiation Gene Expression

RNA-seq data were further validated using quantitative real-time PCR analysis (qRT-PCR) for a selected number of genes using gene-specific primer sets. The plant leaves and growth condition for total RNA extraction used for qRT-PCR were the same as these for RNA-seq experiments. Three independent RNA extractions per sample were performed for biological replicates. The reverse transcribed into cDNA using PrimeScritH RT reagent kit with gDNA Eraser (Takara, Dalian, China). Primer pairs of 10 unigenes were designed using Invitrogen's (Carlsbad, CA, USA) OligoPerfect Designer software [22]. Specificity of the primer sets and their product length was verified by agarose gel electrophoresis. The qRT-PCR reaction mixture consisted of the SYBR Premix EX-Taq II Kit (TakaRa, Japan) on iCycler iQ (BIO-RAD) for three repeats of each sample. The thermal cycling conditions were as follows: 95 uC 2 min and 40 cycles at 95°C for 10 s for denaturation and 65°C 20 s and 72°C 30 s for annealing and extension. The expression of TIPS-41 with primer sequences 5′-TGAAGAGCAGATTGATTTGGCT-3′ and 5′-ACACTCCATTGTC AGCCAGTT-3′ was used as an internal control for normalization to compare the gene expression level between the accessions. The relative levels of gene expression were calculated using the 2−ΔΔCt method.

3. Results

3.1. Sample Preparation, Sequencing, and Data Filtering

The hybridization of B. napus cv. CWH-2 (P1) and B. rapa ssp. chinensis cv. Qianjin (P2) was made in 2010-2011 oilseed growing season. Root-tip chromosome assessments of F1 showed that all F1 plants had a chromosome number of 29 (Figure 1), suggesting that they were hybrids. The seeds' sizes of F1 hybrids were intermediate to those of the parents, but the seed color resembled that of B. napus (Figure 2(a)). Root growth of the F1 over the first 24 h was similar to P1. Leaf morphology of the F1 was more similar to B. rapa than to B. napus (Figure 2). In 4-week-old seedlings, the F1 plant displayed stronger roots than either of the parents (Figure 2(b)) while adult F1 plants displayed the similar heading time to B. napus.
Figure 1

Root tip squash showing chromosomes from the F1 hybrid (chromosome number of 29).

Figure 2

Seed germination (a) and 2-week-old seedlings (b) of P1, P2, and F1 germplasm.

To identify transcripts of P1, P2, and F1, three cDNA libraries were constructed from their leaves and sequenced by Illumina paired-end sequencing. Sequence data from each of the libraries consisted of 6.0 Gb from B. rapa (AA genome), 5.2 Gb from B. napus (AACC genome), and 6.7 Gb from the hybrid (AAC genome). High-quality cleaned raw reads from all of those data were aligned to reference sequences. In total, 67,951,208 reads and 46,207,184 reads were mapped in the B. rapa and B. oleracea reference genomes, respectively. In the B. rapa genome, 38,522 unigenes were assembled with a minimum scaffold size of 200 bp and a total length of 51,995,312 bp, with an average length of 1,349 bp (Figure 3(a)). The B. oleracea genome had a total of 42,009 unigenes with a minimum scaffold size of 300 bp, a total length of 51,691,329 bp, and an average length of 1,230 bp (Figure 3(b)).
Figure 3

The size distribution of transcriptomic unigenes assembled by the B. rapa (a) and B. oleracea (b).

3.2. Heterosis of Differential Gene Expression in B. rapa, B. napus, and Their Hybrid

The numbers of expressed gene in each genome varied slightly. There were 29,579 (71.8%), 27,939 (67.9%), and 29,447 (71.7%) from B. rapa, B. napus, and the hybrid genome, respectively. The unique mapping rates were similar among three Brassica samples, suggesting that their genomes were quite alike. Some genes had expression that was germplasm specific. The B. rapa genome had approximately about 6% (1,639) of genes that were unique, whilst B. napus and the hybrid had only 2% (420) and 3% (951) unique sequences, respectively. There were 25,985 genes expressed in all three lines. A total of 489 genes were expressed in both B. rapa and B. napus but silenced in the hybrid. Gene expression profiles of the three lines revealed that the number of expressed genes did not show obvious difference in the three sets of material. The mode of gene action for the differentially expressed genes (DEGs) was analyzed. About 27.00% genes (1840 of 6816) exhibited an expression pattern that was not distinguishable from additivity, while the other 72.56% (4946 of 6816) of genes showed nonadditive expression patterns (Table 1). The nonadditive number of DEGs from the cross was further classified into five distinct classes: high-parent dominance (HPD), low-parent dominance (LPD), overdominance (ODO), underdominance (UDO), and partial-dominance. There were 7% of transcripts (545) that were absent in their parents, indicating that there was transcriptional activation of new genes in hybrid F1. There was also transcriptional silencing with 3.2% (218) of parentally expressed gene not being expressed in the hybrid.
Table 1

Summary of dominance patterns of differentially expressed genes.

DGs NumberPercentage
Additivity 184027
Nonadditivity 494672.56
Others300.44
High-parent dominance (HPD)3537.14
Low-parent dominance (LPD)1913.86
Overdominance (ODO)59311.99
Underdominance (UDO)1933.9
Positive partial-dominance (PPD)163533.06
Negative partial-dominance (NPD)198140.5
Total 6816 

Additivity: F1 ≈ 1/2(P1 + P2); nonadditivity: F1 > 1/2(P1 + P2) or F1 < 1/2(P1 + P2). High-parent dominance (HPD): F1 ≈ P1 > P2 or F1 ≈ P2 < P1; low-parent dominance (LPD): F1 ≈ P1 < P2 or F1 ≈ P2 < P1; overdominance (ODO): F1 > P1 and F1 > P2; underdominance (UDO): F1 < P1 and F1 < P2.

There were 2894 unigenes that mapped to the A genome, 2107 that mapped to the C genome (Figure 4), and 593 that were not assigned to either genome. Chromosomal distribution of DEG numbers in hybrids showed that low-parent domiance (LPD) genes were significantly accumulated on chromosomes A06 and C07 (P < 0.001), while high-parent dominance (HPD) genes were on chromosomes A09 and C08 (P < 0.01). Gene expression variation caused by interspecific hybridization was not randomly distributed along the chromosomes. Therefore, different B. napus-B. rapa chromosome introgression lines can be developed to the further study of heterosis pertaining to specific chromosomes.
Figure 4

Chromosomal distribution of nonadditive differentially expressed genes with high-parent dominance (HPD), low-parent dominance (LPD), overdominance (ODO), and underdominance (UDO) on the A genome (a) and C genome (b).

3.3. Contribution of A and C Subgenomes to Gene Differential Expression in the Hybrid

There were 1386 significant differentially expressed genes between P1 and F1 samples, 858 genes had increased expression in the F1, and 528 genes had decreased expression. There were 5077 significant differentially expressed genes between P2 and F1 samples, with 3241 genes having increased expression in the F1 and 1836 genes being decreased in expression (Figure 5). Changes to expression from P2 were approximately three times the number of genes compared to from P1. There were more genes with increased expression in the F1 (4098) than with decreased expression (2464) when compared to expression levels in the respective parents. We performed gene ontology (GO) enrichment analysis to test the functional categories for DEGs among P1, P2, and F1 (Figure 6) by AgriGO online tool [23] and R statistical software [20]. There were 10, 12, and 18 functional categories of these transcripts that belonged to the cell component (CC), molecular function (MF), and biological process (BP), respectively. The GO analysis showed that the composition of functional pathways associated with genes showing differential expression was similar when comparing changes from either P1 or P2 with F1.
Figure 5

Total numbers of differentially expressed genes between P1, P2, and F1 by Venn diagram analyses (a) and statistics of up- or downregulated genes (b).

Figure 6

The heat map from GO enrichment analysis of DEGs between the P1, P2, and F1 combinations. Color scale represents P values of enrichment test.

The biological process category was further subdivided into functional classes in those DEGs with high-parent dominance (HPD, P < 0.5) based on gene ontology. Table 2 highlights the 18 gene ontology classes that were differentially expressed in the F1. Combined with the results in Figure 6, we found that the GOs such as regulation of transcription, metabolic process, defense response, multicellular organismal development, and transporters were enriched in A genomes transcripts. The genes responsible for stress were striking enriched in the differential expressed genes from C genome. It possibly implied that the hybrid expressed protein-coding genes from A genomes of both B. rapa and B. napus potentially participated in metabolism and development, while those from C genome of B. napus were largely involved in stress resistance.
Table 2

Significant gene ontology terms of high-parent dominance (HPD) in the biological process category from A and C genomes.

Gene ID Gene O terms
Bra028791 Regulation of transcription (GO:0006355)
Bra005111 Metabolic process (GO:0008152)
Bra032185 Defense response (GO:0002679)
Bra010724 Multicellular organismal development (GO:0007275)
Bra007111 Metabolic process (GO:0010408)
Bra031515 Single-organism transport (GO:0044765)
Bra031678 Transport (GO:0006810)
Bra027171 Transmembrane transport (GO:0006855)
Bra024033 Peroxidase activity (GO:0004601)
Bra002550 Chromosome segregation (GO:0007059)
Bol015697Response to molecule of bacterial origin (GO:0002237)
Bol032712Defense response to insect (GO:0002213)
Bol014351Defense response to bacterium (GO:0042742)
Bol045822Defense response (GO:0002679)
Bol034224Response to wounding (GO:0009611)
Bol038369Single-organism process (GO:0044699)
Bol045822Regulation of transcription (GO:0006355)
Bol015697Response to molecule of bacterial origin (GO:0002237)

3.4. Transposon Active or Inactive in Hybrid

Compared to the B. rapa genome, there were 25 transposable elements (TE) like genes expressed in P1 and P2, while the 11 (44%) genes displayed differential expression in F1 (Table 3). The En/Spm type of transposon, and the retrotransposon-like transcript were significantly enriched. It is likely that the interspecific hybrids significantly modify the transcription of transposon-like genes, which may directly or indirectly influence gene expression of other genes in the heterotic material.
Table 3

The differential expressed transposon-like genes in hybrid F1.

Gene IDRegulationChromosome Similar to transposon
B.rapa.newgene.1068 InactiveA09Retrotransposon-like protein (Arabidopsis thaliana)
B.rapa.newgene.871 InactiveA07Putative transposon protein (Arabidopsis thaliana)
B.rapa.newgene.1142 InactiveA09Retrotransposon-like protein (Arabidopsis thaliana)
B.rapa.newgene.957 InactiveA08Retrotransposon (Arabidopsis thaliana)
Bra040302 UpA08Putative transposon protein (Arabidopsis thaliana)
B.rapa.newgene.307 UpA03En/Spm transposon protein (Arabidopsis thaliana)
B.rapa.newgene.726 UpA06En/Spm-like transposon protein (Arabidopsis thaliana)
Bra034711 ActiveA05hAT transposon superfamily protein (Arabidopsis thaliana)
Bra027867 ActiveA09Pol polyprotein transposon element Bs1 (Zea mays)
B.rapa.newgene.8 ActiveA01Tam1 transposon protein (Arabidopsis thaliana)
Bra035011 ActiveA07Putative transposon protein (Arabidopsis thaliana)
Bol019342InactiveC09Retrotransposon Tto1 DNA (Nicotiana tabacum)
Bol041429UpC07Putative Tam3-like transposon protein (Zea mays)
Bol035479DownC03En/Spm-related transposon protein (Brassica oleracea)
Bol005562DownC03En/Spm-related transposon protein (Brassica oleracea)
Bol019765DownC09En/Spm-related transposon protein (Brassica oleracea)
Bol006373DownC07Transposon protein-like (Arabidopsis thaliana)
Bol035958UpC02Transposon-like ORF (Brassica oleracea)
Bol030703ActiveC03Retrotransposon Tto1 DNA (Nicotiana tabacum)
Bol030374ActiveC09En/Spm-related transposon protein (Brassica oleracea)
Bol004880ActiveC04Retrotransposon Tto1 DNA (Nicotiana tabacum)
Bol043208ActiveC07Similar to retrotransposon (Arabidopsis thaliana)

3.5. Validation of Transcriptome Data by qRT-PCR

To assess the accuracy of RNA-seq data, ten differentially expressed unigenes including stress responsive genes, secondary metabolism biosynthesis genes, and epigenetic modifying genes were selected. Three genes belong to underdominance (UDO) and seven genes are belonging to overdominance (ODO) types, which are represented for heterosis analysis. Primer pairs of 10 unigenes for qRT-PCR were designed and listed in Table 4. We tested the similarity between differential gene expression identified by transcriptome and those identified by qRT-PCR. As shown in Figure 7, the qRT-PCR revealed that 8 of 10 genes (except Bol022348 and Bol026880) that showed the differential gene expression level agreed well with the expression patterns of DGE data. Hence, the qRT-PCR results showed general agreement with their transcript abundance changes determined by RNA-seq, which suggested the reliability of the transcriptomic profiling data among the three samples.
Table 4

The qPCR primers for selected genes.

UnigenesPrimersBiological processNonadditivity
Bra007087 FTGCAGCGCTTGATTTACCTOxidation-reduction processHPD
Bra007087 RGCAAACTCCAGAGCTATGT
Bra020376 FAGGTCATTCTGGTGAGCCACAChaperonesHPD
Bra020376 RTGGAGACTTTGGAAGGATACT
Bra031210 FACGAGGCTCAGTCTCGTGGTResponse to water deprivationODO
Bra031210 RTCCGCTGCGGTATCCACCA
Bra031666 FTGCCAAGGACAACAACTTGGACTLignin biosynthetic processHPD
Bra031666 RAGTTGGTTGTAGGACTGGTCCA
Bol016209 FTAACCTACCAGAAGCACGGTResponse to abscisic acidODO
Bol016209 RACAACTTCAACGGTGCACGACT
Bol022348 FAGGTACCTTACGAGTCTCGTResponse to karrikinHPD
Bol022348 RCACGAACCTGATAGAAGCTCGT
Bol026880 FTGTAAGGCTACGAAGGGACATDefense response to fungusHPD
Bol026880 RTCCAACATATCCATATGTCCGT
Bol026959 FTAGCTCTTCCTCTTCAAGCGATDefense response to fungusODO
Bol026959 RTCCTTCTTCCTCTTCTCACCA
Bol041012 FTGACACATTGTGGATGGAACTCellular hyperosmotic responseODO
Bol041012 RGGCATACCAATCATTGGAACT
Bol044348 FTACTACTGGACCTTTGGTGCTCalcium iontransportHPD
Bol044348 RGATCTTCATCTGAAGGTCACT
Figure 7

Genes with expression levels validated by qRT-PCR.

4. Discussion

Interspecific hybridization is an important approach to obtaining and utilizing novel agronomic traits from related species for crop improvement. Previous researches revealed strong heterosis between B. napus and B. rapa on biomass and seed yield [5-7]. Recently, Li et al. [24] reported that B. napus-like individuals in the F3 and F4 generations, from interspecific hybridization between B. napus and B. oleracea, showed diverse genetic variation relative to current B. napus and strong heterotic potential. We selected a number of backcrossed offspring derived from the F1 by being crossed with P1 (B. napus) and new traits such as wrinkle leaves, six sepals which different from their parents were observed in the progenies. In particular, we identified several lines which displayed high yield up to 4,500 kg per hectare in BC1F2 population. It suggested that the novel lines from interspecific hybridization between B. napus and B. rapa with high yield good quality can be potentially useful for oilseeds production in the near future. Intraspecific hybrids of Arabidopsis thaliana [25, 26], rice [27-29], and maize [30, 31] revealed that there are both additive and nonadditive effects of gene expression in hybrids, and heterosis is strongly influenced by genetic differences between two parents. A transcriptome approach has been utilized to investigate the heterosis of intraspecific hybrids of A. thaliana, rice, maize [29, 30]. Our research of the transcriptomes from B. napus and B. rapa demonstrated the genetic effect of interspecies heterosis at the gene expression level. More genes specific to certain pathways in further experiments are needed to fully validate the heterotic association between the gene expression patterns and the target agronomic traits. In the present study, we found that both additive and dominance effects contributed to interspecies heterosis between B. napus and B. rapa. Analysis of the number of DEGs in hybrid and parental germplasm revealed that the nonadditive effect contributed more than the additive effect. Previous research reveals interspecies heterosis between B. napus and B. rapa through genetic analysis but the main focus was on phenotypic variation [6, 32]. Our study provided evidence of differential gene expression and shed new insights on the molecular mechanism for this heterosis in the interspecific hybrids. Brassica species constitute an elite system for investigating the changes in genomic structure and functional divergence of duplicate genes in the process of hybridization and polyploidization among the diploid species and their amphidiploids [32, 33]. Subgenomes in Brassica species are designated with superscripts with An and Ar representing A genomes from B. napus and B. rapa, respectively [33]. We have shown intersubgenomic heterosis between Ar and An genomes, supporting work by others that show that such heterosis can be useful in creating genetic diversity and be used in breeding. Studies indicated that the midparent heterosis contributes intersubgenomic heterosis [8, 34, 35]. Therefore, the utilization of intersubgenomic heterosis can be creating genetic diversity and breeding. In the present study, we found that the nonadditive DEGs from the A genome in the hybrids mainly participated in metabolism and development, while those from the C genome were largely involved in stress resistance. It is likely that the neofunctionalization of subgenome contributes the heterosis or the genomic adaptation in hybrid. Recently, Li et al. [36] investigated the total homoeolog expression level of hexaploid wheat (AABBDD) and compared it to its ancestral parents T. turgidum (AABB) and Ae. tauschii (DD), finding that genes expressed from the AABB potentially participated in development and those from Ae. tauschii (DD) were more likely involved in adaptation. Differential contributions from the parental sources may also be occurring in the Brassica hybrids, and this may hint at the molecular mechanisms behind heterosis. Transposable elements (TEs) have major effects on different plant genomes and can significantly contribute differences in genome size of over 1,000-fold [37]. Recent sequencing of the B. rapa and B. oleracea genomes revealed that the amplification of TEs is one of the main factors inducing the difference in genome size [37]. The overall TEs in either Brassica genomes are expressed at very low levels, and the expression levels of different TE categories and families vary among different organs [38]. Recently, the variations in TE-associated sequences during the process of allopolyploidisation were detected between Brassica rapa (AA) and B. oleracea (CC), as well as in successive generations of self-pollinated progeny [39]. Our study revealed that the expression activities of TE categories or families were clearly modified in the hybrids between the two Brassica species, and different types of TEs showed different patterns of variation during the process of hybridization. Therefore, the association of activation and inactivation of TEs and of TE related genes expression in relation to heterotic gene expression needs to be further investigated.

5. Conclusions

Development of interspecific hybrids has been widely exploited for the heterosis breeding of Brassica crops. The interspecific hybrid between Brassica napus and B. rapa displayed obvious heterosis. In the present study, the comparative transcriptome analysis for the parents B. napus and B. rapa and its hybrid F1 was sequenced using the platform of Illumina/Solexa with de novo assemblage. The nonredundant unigenes were identified using B. rapa (A genome) and B. oleracea (C genome) as reference genomes. The nonadditively differentially expressed genes were potentially related to the heterosis. The results indicated that the differentially expressed genes in hybrids from the A genome mainly participated in metabolism and development, while those from the C genome were largely involved in stress resistance. The coexistence of multiple gene actions and transposable element-associated genes regulations in the hybrid were observed. The present study could be helpful for the better understanding of the mechanisms of heterosis, and a list of candidate genes will be used for future Brassica breeding.
  31 in total

1.  SOAP2: an improved ultrafast tool for short read alignment.

Authors:  Ruiqiang Li; Chang Yu; Yingrui Li; Tak-Wah Lam; Siu-Ming Yiu; Karsten Kristiansen; Jun Wang
Journal:  Bioinformatics       Date:  2009-06-03       Impact factor: 6.937

2.  Mapping and quantifying mammalian transcriptomes by RNA-Seq.

Authors:  Ali Mortazavi; Brian A Williams; Kenneth McCue; Lorian Schaeffer; Barbara Wold
Journal:  Nat Methods       Date:  2008-05-30       Impact factor: 28.547

3.  BcMF8, a putative arabinogalactan protein-encoding gene, contributes to pollen wall development, aperture formation and pollen tube growth in Brassica campestris.

Authors:  Sue Lin; Heng Dong; Fang Zhang; Lin Qiu; Fangzhan Wang; Jiashu Cao; Li Huang
Journal:  Ann Bot       Date:  2014-01-31       Impact factor: 4.357

4.  Genomewide nonadditive gene regulation in Arabidopsis allotetraploids.

Authors:  Jianlin Wang; Lu Tian; Hyeon-Se Lee; Ning E Wei; Hongmei Jiang; Brian Watson; Andreas Madlung; Thomas C Osborn; R W Doerge; Luca Comai; Z Jeffrey Chen
Journal:  Genetics       Date:  2005-09-19       Impact factor: 4.562

5.  agriGO: a GO analysis toolkit for the agricultural community.

Authors:  Zhou Du; Xin Zhou; Yi Ling; Zhenhai Zhang; Zhen Su
Journal:  Nucleic Acids Res       Date:  2010-04-30       Impact factor: 16.971

6.  Correlation between parental transcriptome and field data for the characterization of heterosis in Zea mays L.

Authors:  Alexander Thiemann; Junjie Fu; Tobias A Schrag; Albrecht E Melchinger; Matthias Frisch; Stefan Scholten
Journal:  Theor Appl Genet       Date:  2009-11-04       Impact factor: 5.699

7.  The genome of the mesopolyploid crop species Brassica rapa.

Authors:  Xiaowu Wang; Hanzhong Wang; Jun Wang; Rifei Sun; Jian Wu; Shengyi Liu; Yinqi Bai; Jeong-Hwan Mun; Ian Bancroft; Feng Cheng; Sanwen Huang; Xixiang Li; Wei Hua; Junyi Wang; Xiyin Wang; Michael Freeling; J Chris Pires; Andrew H Paterson; Boulos Chalhoub; Bo Wang; Alice Hayward; Andrew G Sharpe; Beom-Seok Park; Bernd Weisshaar; Binghang Liu; Bo Li; Bo Liu; Chaobo Tong; Chi Song; Christopher Duran; Chunfang Peng; Chunyu Geng; Chushin Koh; Chuyu Lin; David Edwards; Desheng Mu; Di Shen; Eleni Soumpourou; Fei Li; Fiona Fraser; Gavin Conant; Gilles Lassalle; Graham J King; Guusje Bonnema; Haibao Tang; Haiping Wang; Harry Belcram; Heling Zhou; Hideki Hirakawa; Hiroshi Abe; Hui Guo; Hui Wang; Huizhe Jin; Isobel A P Parkin; Jacqueline Batley; Jeong-Sun Kim; Jérémy Just; Jianwen Li; Jiaohui Xu; Jie Deng; Jin A Kim; Jingping Li; Jingyin Yu; Jinling Meng; Jinpeng Wang; Jiumeng Min; Julie Poulain; Jun Wang; Katsunori Hatakeyama; Kui Wu; Li Wang; Lu Fang; Martin Trick; Matthew G Links; Meixia Zhao; Mina Jin; Nirala Ramchiary; Nizar Drou; Paul J Berkman; Qingle Cai; Quanfei Huang; Ruiqiang Li; Satoshi Tabata; Shifeng Cheng; Shu Zhang; Shujiang Zhang; Shunmou Huang; Shusei Sato; Silong Sun; Soo-Jin Kwon; Su-Ryun Choi; Tae-Ho Lee; Wei Fan; Xiang Zhao; Xu Tan; Xun Xu; Yan Wang; Yang Qiu; Ye Yin; Yingrui Li; Yongchen Du; Yongcui Liao; Yongpyo Lim; Yoshihiro Narusaka; Yupeng Wang; Zhenyi Wang; Zhenyu Li; Zhiwen Wang; Zhiyong Xiong; Zhonghua Zhang
Journal:  Nat Genet       Date:  2011-08-28       Impact factor: 38.330

8.  Heterosis in early maize ear inflorescence development: a genome-wide transcription analysis for two maize inbred lines and their hybrid.

Authors:  Haiping Ding; Cheng Qin; Xirong Luo; Lujiang Li; Zhe Chen; Hongjun Liu; Jian Gao; Haijian Lin; Yaou Shen; Maojun Zhao; Thomas Lübberstedt; Zhiming Zhang; Guangtang Pan
Journal:  Int J Mol Sci       Date:  2014-08-11       Impact factor: 5.923

9.  Resynthesized lines from domesticated and wild Brassica taxa and their hybrids with B. napus L.: genetic diversity and hybrid yield.

Authors:  Tobias Jesske; Birgit Olberg; Antje Schierholt; Heiko C Becker
Journal:  Theor Appl Genet       Date:  2013-01-18       Impact factor: 5.699

10.  Transcriptome analysis of rice root heterosis by RNA-Seq.

Authors:  Rongrong Zhai; Yue Feng; Huimin Wang; Xiaodeng Zhan; Xihong Shen; Weiming Wu; Yingxin Zhang; Daibo Chen; Gaoxing Dai; Zhanlie Yang; Liyong Cao; Shihua Cheng
Journal:  BMC Genomics       Date:  2013-01-16       Impact factor: 3.969

View more
  10 in total

1.  IntroMap: a signal analysis based method for the detection of genomic introgressions.

Authors:  Daniel J Shea; Motoki Shimizu; Namiko Nishida; Eigo Fukai; Takashi Abe; Ryo Fujimoto; Keiichi Okazaki
Journal:  BMC Genet       Date:  2017-12-04       Impact factor: 2.797

2.  Transcriptome and functional analysis reveals hybrid vigor for oil biosynthesis in oil palm.

Authors:  Jingjing Jin; Yanwei Sun; Jing Qu; Rahmad Syah; Chin-Huat Lim; Yuzer Alfiko; Nur Estya Bte Rahman; Antonius Suwanto; Genhua Yue; Limsoon Wong; Nam-Hai Chua; Jian Ye
Journal:  Sci Rep       Date:  2017-03-27       Impact factor: 4.379

3.  Effects of parental genetic divergence on gene expression patterns in interspecific hybrids of Camellia.

Authors:  Min Zhang; Yi-Wei Tang; Ji Qi; Xin-Kai Liu; Dan-Feng Yan; Nai-Sheng Zhong; Nai-Qi Tao; Ji-Yin Gao; Yu-Guo Wang; Zhi-Ping Song; Ji Yang; Wen-Ju Zhang
Journal:  BMC Genomics       Date:  2019-11-08       Impact factor: 3.969

4.  Potential of the C Genome of the Different Variants of Brassica oleracea for Heterosis in Spring B. napus Canola.

Authors:  Azam Nikzad; Berisso Kebede; Jaime Pinzon; Jani Bhavikkumar; Xin Wang; Rong-Cai Yang; Habibur Rahman
Journal:  Front Plant Sci       Date:  2020-01-17       Impact factor: 5.753

5.  Comparative Transcriptomic Analysis of Gene Expression Inheritance Patterns Associated with Cabbage Head Heterosis.

Authors:  Shengjuan Li; Charitha P A Jayasinghege; Jia Guo; Enhui Zhang; Xingli Wang; Zhongmin Xu
Journal:  Plants (Basel)       Date:  2021-01-31

6.  Transcriptome-Wide Analyses Identify Dominant as the Predominantly Non-Conservative Alternative Splicing Inheritance Patterns in F1 Chickens.

Authors:  Xin Qi; Hongchang Gu; Lujiang Qu
Journal:  Front Genet       Date:  2021-12-03       Impact factor: 4.599

7.  Genome-Wide Identification and Analysis of the Ascorbate Peroxidase (APX) Gene Family of Winter Rapeseed (Brassica rapa L.) Under Abiotic Stress.

Authors:  Li Ma; Weiliang Qi; Jing Bai; Haiyun Li; Yan Fang; Jia Xu; Yaozhao Xu; Xiucun Zeng; Yuanyuan Pu; Wangtian Wang; Lijun Liu; Xuecai Li; Wancang Sun; Junyan Wu
Journal:  Front Genet       Date:  2022-01-21       Impact factor: 4.599

8.  Identification of the Exercise and Time Effects on Human Skeletal Muscle through Bioinformatics Methods.

Authors:  Mufang Feng; Jie Ji; Xiaoliu Li; Xinming Ye
Journal:  Genet Res (Camb)       Date:  2022-08-21       Impact factor: 1.375

9.  Comparative transcriptomic analysis of maize ear heterosis during the inflorescence meristem differentiation stage.

Authors:  Xia Shi; Weihua Li; Zhanyong Guo; Mingbo Wu; Xiangge Zhang; Liang Yuan; Xiaoqian Qiu; Ye Xing; Xiaojing Sun; Huiling Xie; Jihua Tang
Journal:  BMC Plant Biol       Date:  2022-07-18       Impact factor: 5.260

10.  Cross-kingdom transcriptomic trends in the evolution of hybrid gene expression.

Authors:  Anna H Behling; David J Winter; Austen R D Ganley; Murray P Cox
Journal:  J Evol Biol       Date:  2022-07-13       Impact factor: 2.516

  10 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.