Literature DB >> 26442670

Role of JAK-STAT signaling in maturation of phagosomes containing Staphylococcus aureus.

Fei Zhu1,2, Yadong Zhou1, Chunxia Jiang1, Xiaobo Zhang1.   

Abstract

Phagocytosis is a required mechanism for the defense against pathogens. Staphylococcus aureus, an important bacterial pathogen, can promptly escape from phagosomes and proliferate within the cytoplasm of host. However, the mechanism of phagocytosis against S. aureus has not been intensively investigated. In this study, the S. aureus was engulfed by macrophages (RAW264.7 cells) but not digested by the cells, suggesting that the phagosomes did not maturate in macrophages. Further investigation revealed that peptidoglycan (PG) induced the phagosome maturation of macrophages, resulting in the eradication of S. aureus. Genome-wide analysis and quantitative real-time PCR indicated that the JAK-STAT pathway was activated by PG during the phagosome maturation of macrophages against S. aureus. This finding presented that the PG-activated JAK-STAT pathway was required for phagosome maturation. Therefore, our study contributed evidence that revealed a novel aspect of PG-triggered JAK-STAT pathway in the phagosome maturation of macrophages.

Entities:  

Mesh:

Substances:

Year:  2015        PMID: 26442670      PMCID: PMC4595848          DOI: 10.1038/srep14854

Source DB:  PubMed          Journal:  Sci Rep        ISSN: 2045-2322            Impact factor:   4.379


Staphylococcus aureus is a major human pathogen causing significant morbidity and mortality due to both community- and hospital-acquired infections1. This pathogen causes a variety of diseases, including impetigo, cellulitis, food poisoning, toxic shock syndrome, necrotizing pneumonia, and endocarditis. The ability of S. aureus to cause disease is based partly on its ability to subvert the innate immune system of hosts. Increasing evidence indicates that S. aureus may be a facultative intracellular pathogen2. Recent reports suggest that S. aureus can persist inside macrophages for several days without affecting the viability of these cells3. At present, the interactions between S. aureus and host innate immunity become important issues to be addressed. The innate immunity in vertebrates and invertebrates is of central importance as the first-line defense against pathogenic challenges4. In the innate immunity of animals, phagocytosis is one of the most powerful and immediate ways to eliminate pathogens5. Phagocytosis, an evolutionarily conserved process, can be utilized by cells to ingest microbial pathogens, and apoptotic and necrotic corpses6. Macrophages, possessing phagocytic activity, play a key role in host defense by recognizing, engulfing and killing microorganisms. However, some pathogens can persist inside these cells, evading host defense7. As a member of gram-positive bacteria, S. aureus can induce a cytoprotective effect in macrophages, which can prevent host cell elimination and thus allow intracellular bacterial survival8. In murine macrophages, the expression of CXCR1 (interleukin-8 receptor) induced by S. aureus is implicated in the intracellular survival of bacteria via cytokines and bacterial anti-oxidant enzymes9. As reported, S. aureus has developed many antiphagocytic properties. Protein A, a major cell wall component of S. aureus, may cause polysaccharide-independent biofilm formation and prevent macrophage phagocytosis1011. Lipoteichoic acid (LTA) and clumping factor A (ClfA), a fibrinogen-binding surface protein of S. aureus, can interfere and inhibit the phagocytosis of leucocytes against S. aureus12. However, the interactions between S. aureus and host phagocytosis remain to be characterized. It is well known that some kinds of polysaccharides from bacteria can activate the phagocytosis of macrophages against bacteria. Lipopolysaccharide (LPS), a major component of the cell walls of gram-negative bacteria, can induce macrophages to phagocytose gram-negative bacteria through the pattern recognition receptor Toll-like receptor 4 (TLR4)13. Peptidoglycan (PG), a major component of the cell walls of gram-positive bacteria, plays very important roles in phagocytosis against gram-positive bacteria through Toll-like receptor 2 (TLR2), which is recruited to phagosomes and discriminates between pathogens141516. For phagocytosing S. aureus, PG must be particulated and internalized via phagocytosis17. The heat-inactivated S. aureus is a common model to investigate the phagocytosis process, the phagosome acidification, the bacterial recognition and the cytokine production in response to S. aureus in phagocytes1819. At present, the role of polysaccharides in the regulation of phagocytosis against S. aureus is not clear. To address this issue, the phagocytosis of Mus musculus RAW264.7 cell, a macrophage-derived cell line, was evaluated using S. aureus in this study. The results revealed that the PG-triggered JAK-STAT signaling pathway contributed to the phagosome maturation of macrophages against S. aureus.

Results

Peptidoglycan induces phagocytosis of inactivated S. aureus in RAW264.7 cells

To evaluate the phagocytic activity of RAW264.7 cells against Staphylococcus aureus, the bacteria were inactivated and then subjected to phagocytosis assay in RAW264.7 cells. The use of inactivated bacteria in the evaluations of phagocytic activity of macrophages could exclude the effects of bacterium infection on phagocytosis. The heat-inactivated S. aureus was engulfed, but not digested by RAW264.7 cells (Fig. 1A,B). We hypothesized that the receptors on the surface of macrophages were not activated to recognize and subsequently induce the digestion of S. aureus.
Figure 1

Peptidoglycan induces phagocytosis after inoculation with inactivated S. aureus.

(A) RAW264.7 cells were induced with LPS or PG inoculated with inactivated S. aureus and inactivated S. aureus. One day later, the cells were examined with transmission electron microscope. RAW264.7 cells only and PG alone were used as controls. Lane headings indicated the treatments. The box indicated the enlarged image. Scale bar, 5 μm (up) or 1 μm (down). (B) RAW264.7 cells were treated with LPS or PG and then with FITC-labeled inactivated S. aureus. After incubation for 1 day, the cells were subjected to phagocytosis assays. The filamentous actin was stained with rhodamine phalloidin and the cellular DNA with DAPI. The green spots indicated the internalized S. aureus. Non-treated cells and PG alone were used as controls. Scale bar, 10 μm (up) or 5 μm (down). (C) RAW264.7 cells were incubated with LPS or PG and pHrodo-labeled heat-inactivated S. aureus. The treatment chloroquine + heat-inactivated S. aureus +PG was included in the incubations. At 1 h after incubation, the cells were examined with confocal microscopy. The red spots showed the formation of phagolysosome. RAW264.7 cells and PG alone were used as controls. Scale bar, 10 μm (up) or 5 μm (down). (D) The detection of the total S. aureus using a pH-insensitive PCR. The RAW 264.7 cells were treated with PG/LPS and S. aureus. At 2 h after treatments, the cells were subjected to PCR with the S. aureus nuc gene-specific primers. M indicates the DNA marker. (E) The percentage of phagocytosed pHrodo-labeled inactivated S. aureus in RAW264.7 cells. The RAW264.7 cells were incubated with LPS or PG and pHrodo-labeled inactivated S. aureus. At 1 h after incubation, the cells were evaluated using flow cytometry. Non-treated cells and PG alone were used as controls. Statistically significant differences between treatments were indicated with asterisks (**P < 0.01).

In order to activate phagocytosis of RAW264.7 cells against S. aureus, lipopolysaccharide (LPS) and peptidoglycan (PG) were added into cells respectively. The results showed that the heat-inactivated S. aureus was completely phagocytosed by RAW264.7 cells induced with PG (Fig. 1A,B). However, LPS did not induce the complete phagocytosis of inactivated S. aureus (Fig. 1A,B). After PG treatment, we determined that the RAW264.7 cells became acidic (Fig. 1C), which is an indicator of phagosome maturation. However, after LPS treatment, the pH of the RAW264.7 cells was similar to the un-treated cells (Fig. 1C). As a control, we treated RAW264.7 cells with PG alone (no S. aureus) and found no change in pH (Fig. 1A–C). To explore the effects of specific inhibitors on the phagosomal acidification, chloroquine was used in the phagosomal acidification assays. It was found that phagosomal acidification was inhibited after treatment with chloroquine (Fig. 1C). We also wanted to detect the total S. aureus with a pH-independent method, and PCR using the S. aureus nuc gene was conducted. The results showed that S. aureus was detected in the LPS-treated RAW 264.7 cells, but not in the PG-treated cells (Fig. 1D), confirming our previous results (Fig. 1A–C). The percentage of phagocytosed S. aureus was significantly higher (P < 0.01) in PG-treated cells than in any of the other treatments (Fig. 1E). Taken together, these findings indicated that PG could efficiently activate the phagocytic activity of phagocytes against S. aureus.

The JAK-STAT pathway is altered after PG and S. aureus treatment

To determine which genes and pathways were involved in phagosome maturation in RAW264.7 cells, a genome-wide analysis using oligonucleotide microarray was conducted after the cells were incubated with PG and inactivated S. aureus. The gene expression profiles of RAW264.7 cells treated with inactivated S. aureus and PG or inactivated S. aureus differed from untreated cells) (Fig. 2A). This finding suggested that PG could induce various receptors and pathways.
Figure 2

Analysis of signaling pathways required for the phagosome maturation.

(A) The gene expression profiles were conducted with a DNA microarray using RAW264.7 cells treated with heat-inactivated S. aureus or heat-inactivated S. aureus and PG. Non-treated RAW264.7 cells were used as a control. Red indicated up-regulation of gene expression and green showed down-regulation of gene expression. (B) Venn diagram of differentially expressed genes. The differentially expressed genes were evaluated using DNA microarray data. The numbers represented the genes up-regulated or down-regulated (more than twofold) compared with the control. Arrows indicated up- or down-regulated genes. (C) Hierarchical cluster analysis of DNA microarray data. Clustering of 32 genes in JAK-STAT pathway in response to the challenge of heat-inactivated S. aureus or heat-inactivated S. aureus and PG. (D) The biological processes mediated by the differentially expressed genes. The 524 up-regulated genes in RAW264.7 cells treated with heat-inactivated S. aureus and PG were analyzed. The JAK-STAT pathway represented the key pathway. The red, blue and purple lines indicated the IntAct, MINT and DIP databases, respectively. The numbers indicated a protein’s interaction degree. (E) The expressions of genes from JAK-STAT pathway in RAW264.7 cells in response to PG challenge. At 1 h after challenge with heat-inactivated S. aureus, heat-inactivated S. aureus + PG and PG alone, the expression profiles of Jak2, Stat3, Stat5a, Cish, Csf1, IL-6, Socs3, Nfkb1, TNF-α and IFN-γ genes in RAW264.7 cells were characterized by quantitative real-time PCR. The GAPDH gene was used as a control. Statistically significant differences between treatments were indicated with asterisks (**P < 0.01). Control, RAW264.7 cells only.

The microarray revealed that 380 and 162 genes were significantly (P < 0.01) up-regulated and down-regulated, respectively in the RAW264.7 cells treated with heat-inactivated S. aureus, compared with the untreated control (Fig. 2B). After S. aureus and PG treatment, 870 and 897 genes were significantly up-regulated and down-regulated (P < 0.01), respectively (Fig. 2B). The comparison analysis indicated that 1278 genes were differentially expressed in the RAW264.7 cells treated with inactivated S. aureus and PG (Fig. 2B). Among these genes, 524 genes were up-regulated in response to the PG treatment, suggesting that PG played an important role in the phagocytosis against S. aureus. The gene network analysis of 524 up-regulated genes showed that the JAK-STAT pathway represented the key pathway in the RAW264.7 cells treated with inactivated S. aureus and PG (Fig. 2C,D). This indicated that PG might induce the JAK-STAT pathway, which may be necessary in phagosome maturation. Genes in the JAK-STAT pathway that were significantly (P < 0.01) up-regulated were JAK2, Stat1, Stat3, Stat5a, IL-6, IL-10, IL10ra, IL13ra2, IL-15, IRF9, Csf1, Csf3, Cish, Lif, Socs3, Myc, Pim1 and Tslp, but Ifngr1, Spred2, Il6ra, Ccnd1, Pias3 and Pik3r1 were significantly (P < 0.01) down-regulated (Fig. 2C). To confirm the gene expression data from the microarray, the quantitative real-time PCR was performed. The relative expressions of JAK2, Stat3, Stat5a, Cish, Csf1, IL-6, Socs3 and Nfkb1 genes was significantly (P < 0.01) up-regulated in the RAW264.7 cells after treatment with inactivated S. aureus and PG or PG alone compared to cells treated with inactivated S. aureus alone (Fig. 2E). In addition, the expression of TNF (tumor necrosis factor)-α was significantly (P < 0.01) up-regulated in cells treated with inactivated S. aureus and PG, whereas the expression of IFN (Inteferon)-γ was not affected (Fig. 2E). These findings demonstrated that PG could activate the JAK-STAT signaling pathway in the phagocytosis against inactivated S. aureus.

The JAK-STAT pathway is necessary for phagosome maturation

To determine the role of JAK-STAT pathway in the maturation of phagosomes, RAW264.7 cells were treated with the JAK2 inhibitor, followed by the phagocytosis assays using pHrodo-labeled inactivated S. aureus. Phagosome maturation was evident after the inoculation of PG and inactivated S. aureus but not in the control (inactivated S. aureus alone) (Fig. 3A). After the addition of the JAK2 inhibitor to cells inoculated with inactivated S. aureus and PG, phagosome maturation was abolished (Fig. 3A), indicating that the PG-triggered JAK-STAT signaling pathway was essential for the phagosome maturation during phagocytosis. For colocalization of phagosome and S. aureus, we labeled LAMP1 (Lysosomal-associated membrane protein 1) with PE-modified rat antibody which shows the red fluorescence. As expected, the LAMP1 proteins localized to most lysosomes in cells treated with PG and inactivated S. aureus but not in cells treated with inactivated S. aureus alone (Fig. 3B). After the addition of the JAK2 inhibitor, the LAMP1 did not significantly localize with FITC-labeled inactivated S. aureus (Fig. 3B). We also determined the presence of S. aureus by PCR. S. aureus was detected in the RAW264.7 cells treated with the JAK2 inhibitor (Fig. 3C), which further confirmed our previous findings. The percentage of phagocytosed pHrodo-labeled inactivated S. aureus in PG-induced RAW264.7 cells was significantly higher (P < 0.01) than in PG-induced cells treated with the JAK2 inhibitor (Fig. 3D). The pH detection of phagosomes also showed that phagosomes acidified to pH < 5.0 by 30min in PG-treated cells (Fig. 3E). These findings demonstrate that the JAK-STAT pathway was required for phagosome maturation.
Figure 3

The role of JAK-STAT pathway in phagosome maturation.

(A) Confocal microscopy of phagocytosis of inactivated S. aureus by RAW264.7 cells. RAW264.7 cells were inoculated with the JAK2 inhibitor, followed by the incubation with the FITC-labeled inactivated S. aureus (up) or the pHrodo-labeled S. aureus (down) in the presence or absence of PG. One hour later, the cells were examined with confocal microscopy. The cells without the JAK2 inhibitor were used as controls. Scale bar, 10 μm. (B) Localization of LAMP1 protein expressed in RAW 264.7 cells. The green points indicated the FITC-labeled S. aureus. Scale bar, 10 μm. (C) The evaluation of the total S. aureus with a pH-independent strategy. The RAW 264.7 cells were treated with PG, the JAK2 inhibitor and S. aureus. At 2 h after treatments, the total S. aureus in cells were detected with PCR using the S. aureus nuc gene-specific primers. M indicates the DNA marker. (D) The percentage of phagocytosed pHrodo-labeled inactivated S. aureus in RAW264.7 cells. The number of cells phagocytosing the pHrodo-labeled inactivated S. aureus was quantified using flow cytometry at 1 h after inoculation of S. aureus. The cells without the JAK2 inhibitor were used as controls. Statistically significant differences between treatments were indicated with asterisks (**P < 0.01). (E) The measurement of pH values. The phagosome pH was measured in RAW 264.7 cells using the dual-labeled S. aureus ratiometric assay. (F) Effects of the inhibition of JAK2 activity on expressions of genes of JAK-STAT pathway. RAW264.7 cells were treated with the JAK2 inhibitor. Six hours later, the expressions of STAT3 and STAT5a genes were evaluated using real-time PCR. Statistically significant differences between treatments were indicated with asterisks (*P < 0.05). (G) The influence of the inhibition of JAK activity on the STAT3 phosphorylation. The JAK2-inhibitor-treated RAW264.7 cells were analyzed with Western blot using phosphorylated STAT3-specific antibody. Actin was used as a control. (H) The model of PG-triggered JAK-STAT signaling pathway in the phagosome maturation.

Inhibition of JAK2 activity led to a significant decrease in Stat3 and Stat5a gene expression in RAW264.7 cells (Fig. 3F). The protein expression of phosphorylated STAT3, the active form of STAT3, was significantly (P < 0.01) decreased after JAK2 inhibition (Fig. 3G), indicating that JAK2 was required for STAT3 phosphorylation. Considering all the above data, the PG induced JAK-STAT signalling pathway played an essential role in phagosome maturation (Fig. 3H).

Phagosome maturation requires the JAK-STAT pathway after inoculation with live S. aureus

We next determined the effects of PG on phagosome maturation after RAW264.7 cells were inoculated with live S. aureus. Using transmission electron microscopy, we observed no bacteria in the cells at 1 hour after inoculation (Fig. 4A). At one day after inoculation, the cells treated with live S. aureus alone were dead and many bacteria were present (Fig. 4A). However, the cells treated with live S. aureus and PG grew normally and no bacteria were present (Fig. 4A). The LAMP1 proteins were colocalized with many lysosomes in cells treated with PG and S.aureus but not in cells treated with S. aureus alone (Fig. 4B). These data suggested that PG could activate phagosome maturation in order to phagocytose bacteria.
Figure 4

The effect of PG-induced JAK-STAT pathway on phagocytosis against live S. aureus.

(A) RAW264.7 cells were activated by PG, followed by incubation with live S. aureus. One hour or one day later, the cells were examined with transmission electron microscope. The black arrows indicate the intracellular S. aureus. Lane headings indicated the treatments. The box indicated the enlarged image. Scale bar, 2 μm (up) or 1 μm (down). (B) Localization of LAMP1 expressed in RAW 264.7 cells. The green points showed the FITC-labeled S. aureus. Scale bar, 10 μm. (C) The expressions of genes from the JAK-STAT pathway in RAW264.7 cells in response to PG challenge. At 1 h after challenge with live S. aureus or live S. aureus + PG or PG alone, the expression profiles of Jak2, Stat3, Stat5a, Cish, Csf1, IL-6, Socs3 and Nfkb1, TNF-α and IFN-γ genes in RAW264.7 cells were examined with real-time PCR. The GAPDH gene was used as a control. Statistically significant differences between treatments were indicated with asterisks (**P < 0.01). Control, RAW264.7 cells only. (D) RAW264.7 cells were inoculated with the JAK2 inhibitor, followed by incubation with the FITC-labeled S. aureus (up) or the pHrodo-labeled S. aureus (down) in the presence or absence of PG. One hour later, the cells were examined with confocal micrscopy. The cells without the JAK2 inhibitor were used as controls. Scale bar, 10 μm. (E) The pH values in macrophages. The phagosome pH was measured in RAW 264.7 cells using the dual-labeled S. aureus ratiometric assay. (F) The examination of the total S. aureus in RAW 264.7 cells. The RAW 264.7 cells were treated with PG, the JAK2 inhibitor and S. aureus. At 2 h after treatments, the total S. aureus in cells were detected with PCR using the S. aureus nuc gene-specific primers. M indicates the DNA marker. (G) The percentage of phagocytosed pHrodo-labeled S. aureus in RAW264.7 cells. The number of cells phagocytosed the pHrodo-labeled S. aureus was quantified using flow cytometry at 1 h after inoculation of S. aureus. The cells without the JAK2 inhibitor were used as controls. Statistically significant differences between treatments were indicated with asterisks (**P < 0.01).

The quantitative real-time PCR was conducted to characterize the expression of key genes of JAK-STAT pathway. The results showed that the relative expressions of JAK2, Stat3, Stat5a, Cish, Csf1, IL-6, Nfkb1, Socs3 and TNF-α were significantly (P < 0.01) up-regulated and IFN-γ expression was significantly (P < 0.01) down-regulated in the RAW264.7 cells treated with live S. aureus and PG or PG alone compared to cells treated with live S. aureus alone (Fig. 4C). These findings were similar to those observed when cells were inoculated with inactivated S. aureus. The role of JAK-STAT pathway was characterized by inhibiting JAK2 in RAW264.7 cells incubated with the pHrodo-labeled live S. aureus. Using confocal microscopy, we observed phagosome maturation at one hour after inoculation with PG and live S. aureus (Fig. 4D). The pH detection of phagosomes also showed that phagosomes acidified to pH < 5.0 by 30min in PG-treated cells (Fig. 4E). Western blot showed the significant knockdown of STAT3 in JAK inhibitor treated RAW cells (Fig. 3G). As the control, the expression of β-actin was detected by anti-actin antibodies and showed no difference among all treatments (Fig. 3G). However, the JAK2 inhibitor inhibited the phagosome maturation even in the presence of PG (Fig. 4B,D), indicating that the JAK-STAT pathway plays an important role in phagosome maturation. The PCR result showed that S. aureus was detected in the JAK2 inhibitor-treated RAW264.7 cells (Fig. 4F), suggesting that the PG-induced JAK-STAT pathway may be required to phagocytose live S. aureus. The percentage of phagocytosed pHrodo-labeled live S. aureus in PG-activated RAW264.7 cells was significantly higher (P < 0.01) than that in PG-treated cells treated with the JAK2 inhibitor (Fig. 4G). Taken together, PG can induce the JAK-STAT pathway, which plays an important role in phagosome maturation.

Discussion

As reported, the pathogenic microbes are internalized and rapidly delivered into a mature phagolysosome where they are killed and degraded67. A study shows that the bacterial killing occurs in S. aureus-infected neutrophils without apparent degradation of bacteria20, suggesting that lack of degradation of bacteria may not indicate defects in phagosome maturation or bacterial killing. However, the phagosome maturation is one of the key steps of phagocytosis. It is found that numerous pathogens have evolved complex mechanisms to manipulate host intracellular organelles in order to survive21. S. aureus, an important pathogen in humans, can invade host cells and persist intracellularly in cell culture models22. This strategy allows S. aureus to evade the host’s professional phagocytes and extracellular antibiotics, which promotes ongoing infection23. Likewise, S. aureus can survive in human epithelial cells for prolonged periods of time24. It is believed that phagocytosis is required for the host defense against Gram-negative microbes as well as Gram-positive pathogens67. However, the phagocytosis of S. aureus has not been intensively investigated. In this study, PG induced the JAK-STAT signaling pathway to activate phagosome maturation in order to eradicate both inactivated and live S. aureus. Our data indicated that the expressions of cytokines in RAW264.7 cells were significantly up-regulated in response to exogenous PG in the presence or absence of inactivated S. aureus. This suggests that PG, not heat-inactivated S. aureus, was responsible for the secretion of cytokines from the activated phagosomes. This finding was consistent with other data1718. RAW264.7 cells do not express the apoptotic speck protein, which is one of the key molecules in the inflammasome complex. Thus S. aureus peptidoglycan must be particulate and internalized via phagocytosis to activate the NLRP3 inflammasomes and IL-1β secretion17. Although RAW264.7 cells will not undergo NLRP3-dependent pyroptosis in response to S. aureus25, PG stimulation could induce effective phagocytosis to clear S. aureus. In this context, our study presented novel aspects of PG and the JAK-STAT signaling pathway in phagocytosis of Gram-positive bacteria. The Janus kinases (JAKs) play critical roles in several important intracellular signaling pathways, including the JAK-STAT pathway and the mediation of cytokine signaling2627. And 40 cytokine receptors may perform signal transductions through the combinations of four JAK and seven STAT family members28. JAK1, JAK2, JAK3 and Tyk2 are involved in cell growth, survival, development, and differentiation of cells28. JAK2, a member of the JAKs family of protein tyrosine kinases, is an important intracellular mediator of cytokine signaling29. JAK2 can induce the activation of macrophages, the inflammatory response and the inhibition of apoptosis3031. It has been reported that protein A from S. aureus is endocytosed by airway epithelial cells and subsequently activates the JAK-STAT signaling pathway32. Our data showed that PG from Gram-positive bacteria could activate the JAK-STAT pathway, leading to phagosome maturation. It is evidenced that S. aureus can promptly escape from the endosomes/phagosomes and proliferate within the host cytoplasm and quickly leads to host cell death3334. These data have provided evidence to test potential therapeutic strategies to reduce pathogenicity of Gram-positive bacteria such as S. aureus.

Materials and Methods

Strain and cell culture

The Staphylococcus aureus strain ATCC25923, widely used for phagpocytosis assays, was obtained from Honghui hospital (Hangzhou, China). S. aureus was grown overnight in Columbia medium (Oxoid, UK) with 2% NaCl at 37 °C. Mus musculus RAW264.7 cells (Cell Bank of Chinese Academy of Science, China) were cultured in RPMI 1640 media (Hyclone, USA) supplemented with 10% heat-inactivated/refiltered fetal bovine serum (FBS) (Gibco, USA), 10 mM HEPES (4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid) (Invitrogen, USA), 0.11 mg/mL sodium pyruvate (Sigma, USA), 0.002 M L-glutamine (Sigma, USA) and pen/strep (1 mg/mL, 100 U/mL) (Invitrogen, USA).

Phagocytosis assay

The cultures of S. aureus were suspended in phosphate-buffered saline (PBS) and inactivated by heat at 85 °C for 60 min. Then the inactivated or live S. aureus were added into RAW264.7 cells at a density of 5 × 106/mL, followed by incubation for 1 h. To determine whether lipopolysaccharide (LPS) or peptidoglycan (PG) enhanced the efficient phagocytosis, RAW264.7 cells were plated at a concentration of 1 × 106 cells per plate in six-well plates and were allowed to adhere for at least 30 min. LPS or PG (Sigma, USA) was sonicated for 1 h and then added to each well at a concentration of 1 ng/ml for LPS or 10 μg/ml for PG. The cells containing LPS or PG were incubated for 5 h. Subsequently the cells were treated with the heat-inactivated or live S. aureus. At different time after inoculation of bacteria, RAW264.7 cells were collected for later use.

The detection of the total S. aureus in Raw264.7 cells

Raw264.7 cells were treated with S. aureus and/or PG, LPS and the JAK2 inhibitor. At 2 h after treatments, the total DNA in Raw264.7 cells was extracted using QlAamp DNA Mini Kit (Qiagen, Germany). Then PCR was conducted using S. aureus nuc gene-specific primers (5′-GCGATTGATGGTGATACGGTT-3′ and 5′-G CGTTGTCTTCGCTCCAAAT-3′) according to the previous study35.

Transmission electron microscopy

RAW264.7 cells were treated as previously described36. Sections were cut in a Reichert Ultracut OMU3 microtome (Leica, Germany) at 100 nm thickness, followed by staining with uranyl acetate/70% methanol. The images were obtained on a Hitachi 7650 transmission electron microscope (Hitachi, Japan) operating at 70 kV.

Confocal microscopy

RAW264.7 cells were plated in 6-well plastic tissue culture plates in 1 ml of Schneider’s medium with 10% FBS (Gibco, USA). The inactivated S. aureus was labeled with FITC (Invitrogen, USA) and then added into RAW264.7 cells at a density of 5 × 106/mL. The cells were incubated for different time at 37 °C. After washes with PBS, the cells were transferred to poly-prep glass slides (Sigma, USA). The filamentous actin and DNA of RAW264.7 cells were separately stained with rhodamine phalloidin (Invitrogen, USA) and DAPI (Sigma, USA). The LAMP1 (Lysosomal-associated membrane protein 1) proteins were labeled with PE Rat anti-Mouse CD107a (BD Pharmingen, USA). Fluorescent images were taken with a Zeiss Laser scanning systems LSM 510 Meta (Carl Zeiss, Germany). Images were processed using Zeiss LSM Image Examiner Version software.

The measurement of phagosomal acidification

To evaluate the phagosomal acidification, the S. aureus was labeled with pHrodo dye (Invitrogen, USA), which could dramatically increases the fluorescence as the microenvironment of its surroundings becomes more acidic37. RAW264.7 cells (1 × 106/mL) were incubated with pHrodo-labeled bacteria for 1 h at 37 °C, followed examination by confocal microscopy. To characterize the effects of specific inhibitors on the phagosomal acidification of macrophages, chloroquine was used (Shimada et al., 2010). RAW264.7 cells were added with 200 μM of chloroquine (Sigma-Aldrich, USA). Thirty min later, the cells were treated with pHrodo-labeled S. aureus for 1 h at 37 °C. Subsequently the cells were examined with confocal microscopy.

The activation of RAW264.7 cell phagocytosis with LPS or PG

To activate the phagocytic activity of RAW264.7 cells, lipopolysaccharide (LPS) or peptidoglycan (PG) was added into RAW264.7 cells, followed the detection of phagocytosis against S. aureus. LPS and PG were purchased from Sigma (USA). RAW264.7 cells were treated as previously described38. Subsequently the heat-inactivated S. aureus was added into RAW264.7 cells. As controls, PG only and LPS only were included in the assays. At different time, the cells were collected and examined with transmission electron microscope and confocal microscopy.

The analyses of mRNA expression using oligonucleotide arrays and biological pathways

Total RNAs were extracted from RAW264.7 cells (1×106) using Trizol reagent (Invitrogen, USA) according to the manufacturer’s instructions. The total RNAs were then subjected to the Affymetrix Mouse Genome 430 2.0 array GeneChip (CapitalBio Corp., CA, USA) for gene expression analysis. Microarray data were analyzed using Bio MAS (molecule annotation system) 3.0 software (CapitalBio Corp.). Using the criterion of cutoff limitation as a fold change ≥2 or ≤0.5 and q-value ≤5%, differentially expressed genes were screened and clustered. Based on DNA microarray, the differently altered genes were subjected to biological pathway analysis. The selected genes were analyzed in the context of Kyoto Encyclopaedia of Genes and Genomes (KEGG) using MAS 3.0 software.

Quantitative real-time RT–PCR

Total RNAs were extracted from RAW264.7 cells (1 × 106) with Trizol reagent (Invitrogen, USA) according to the manufacturer’s manual. Then the total RNAs were reversely transcribed to synthesize cDNAs using reverse transcriptase M-MLV (Takara, Japan). Quantitative real-time PCR was performed using gene-specific primers and TaqMan probes (Table 1). Relative gene expression levels were calculated according to the previous method39, using GAPDH as an internal control. Real-time PCR amplification reactions were carried out in a final volume of 20 μl, which contained 10 μl Premix Ex Taq (TaKaRa, Japan), 1 μl diluted cDNA template, 7.2 μl dH2O, 0.3 μl of each TaqMan probe and 0.4 μl of each primer. PCR conditions were as follows, 95 °C for 30 seconds, followed by 50 cycles of 95 °C for 5 seconds and 60 °C for 30 seconds.
Table 1

Sequences of primers and TaqMan probes used for quantitative real-time PCR.

GeneForward primer (5′-3′)Reverse primer (5′-3′)TaqMan probe (5′-3′)
GAPDHcaatgtgtccgtcgtggatctgtcctcagtgtagcccaagatgcgtgccgcctggagaaacctgcc
Jak2cttccacatagacgagtcaaccacatcaagcagaggagcttcagcatctgtaggttctgctgctgccact
Stat3ccgatgcctgtgggaagagtctgtcactacggcggctgttgcctccagacggcagccacggca
Stat5agcagtcctggtgtgagaagctgagatgatgtccgtgatggtgacctcagccagcatctcctccacg
Cishccctgcctatgtctaagcaagatgccaccagacggttgatgaccctagtgactcggtgctgcctatcc
Socs3ccactacatgccgcctccagcggctcagtaccagcggaatctctttgccacccacggaaccctcg
Csf1cgctgcccttcttcgacatgccttcaggtgtccattcccaatccggctgctgctggtctgtctcctc
IL-6ctctgcaagagacttccatccagtctcctctccggacttgtgaagcaccagcatcagtcccaagaag
Nfkb1agtgcaaaggaaacgccagaaggccagggcttccggtactctccgccaccgccactaccga
TNF-αatgttgtagcaaaccctgaagctattggccaggagggcattActccaatggctgagccgacgtg43
IFN-γtggtgggcctcttttcttagatatagaaggagacaatttggctttgaTtgaagaactggagagaggagagtgacaaaaaaa43

The Inhibition assay of JAK2 activity

To reveal the role of JAK-STAT signaling pathway in phagocytosis, the activity of the key enzyme JAK2 in this pathway was inhibited with the JAK2 inhibitor 2-(1, 1-Dimethylethyl)-9-fluoro-3, 6-dihydro-7H-benz[h]-imidaz[4, 5-f]isoquinolin-7-one (Millipore, USA) at 2 nM. RAW264.7 cells (1 × 106/mL) were incubated with the JAK2 inhibitor for 6 h. Subsequently the sonicated PG (Sigma, USA) was added into the cells at a concentration of 1 μg /mL. One hour later, the cells were inoculated with heat-inactivated S. aureus at a density of 5 × 106/mL. At 1 h after incubation, the cells were examined using confocal microscopy and flow cytometry. The RAW264.7 cells without the JAK2 inhibitor were used as controls.

Western blotting

Proteins were separated by SDS-PAGE and then transferred to a polyvinylidene fluoride (PVDF) membrane (Millipore, USA). The membrane was blocked with blocking buffer (5% milk in Tris-buffered saline and Tween-20) for 1 h at room temperature. Subsequently the membrane was incubated with a primary antibody at 4 °C overnight. After three washes with Tris-buffered saline, the membrane was incubated with alkaline phosphatase-conjugated secondary antibody (Roche, Switzerland) for 2 h at room temperature. The membrane was detected with BCIP/NBT substrate (Sangon Biotech, Shanghai, China). The primary antibodies were purchased from Cell Signal Technology (USA).

pH detection of phagosomes

The phagosomal pH was assayed according to the previous described method19. Briefly RAW264.7 cells were incubated with FITC (pH-sensitive)-labeled or Alexa Fluor 647 (pH-insensitive)-labeled S. aureus at low MOI (multiplicity of infection) (≤10) for 30 min on ice, allowing the synchronization of bacteria binding onto cells. Subsequently the cells were incubated for the indicated times at 37 °C. After washes twice with ice-cold PBS/EDTA (eathylene diamine tetraacetic acid), the cells were detached and immediately analyzed by flow cytometry to determine the mean fluorescent index emission between FITC and Alexa Fluor 647. To calculate pH using the ratiometric assay, values were compared with a standard curve obtained by resuspending and permeabilizing the cells that had phagocytosed bacteria for 2 h in buffers at a fixed pH (ranging from pH 3.5 to 8). The cells were immediately analyzed by flow cytometry to determine the emission ratio of the two fluorescent dyes at each pH.

Statistical analysis

The data from three independent experiments were analyzed by one-way analysis of variance to calculate the means and standard deviations of the triplicate assays. The significant difference between treatments was determined by Student’s t-test.

Additional Information

How to cite this article: Zhu, F. et al. Role of JAK-STAT signaling in maturation of phagosomes containing Staphylococcus aureus. Sci. Rep. 5, 14854; doi: 10.1038/srep14854 (2015).
  39 in total

Review 1.  Mechanisms of phagocytosis in macrophages.

Authors:  A Aderem; D M Underhill
Journal:  Annu Rev Immunol       Date:  1999       Impact factor: 28.527

2.  Staphylococcus aureus escapes more efficiently from the phagosome of a cystic fibrosis bronchial epithelial cell line than from its normal counterpart.

Authors:  Todd M Jarry; Ambrose L Cheung
Journal:  Infect Immun       Date:  2006-05       Impact factor: 3.441

Review 3.  Staphylococcus aureus infections.

Authors:  F D Lowy
Journal:  N Engl J Med       Date:  1998-08-20       Impact factor: 91.245

4.  Phagocytosis and phagosome acidification are required for pathogen processing and MyD88-dependent responses to Staphylococcus aureus.

Authors:  W K Eddie Ip; Anna Sokolovska; Guillaume M Charriere; Laurent Boyer; Stephanie Dejardin; Michael P Cappillino; L Michael Yantosca; Kazue Takahashi; Kathryn J Moore; Adam Lacy-Hulbert; Lynda M Stuart
Journal:  J Immunol       Date:  2010-05-17       Impact factor: 5.422

5.  Clumping factor A of Staphylococcus aureus inhibits phagocytosis by human polymorphonuclear leucocytes.

Authors:  Judy Higgins; Anthony Loughman; Kok P M van Kessel; Jos A G van Strijp; Timothy J Foster
Journal:  FEMS Microbiol Lett       Date:  2006-05       Impact factor: 2.742

6.  SLAM is a microbial sensor that regulates bacterial phagosome functions in macrophages.

Authors:  Scott B Berger; Xavier Romero; Chunyan Ma; Guoxing Wang; William A Faubion; Gongxian Liao; Ewoud Compeer; Marton Keszei; Lucia Rameh; Ninghai Wang; Marianne Boes; Jose R Regueiro; Hans-Christian Reinecker; Cox Terhorst
Journal:  Nat Immunol       Date:  2010-09-05       Impact factor: 25.606

7.  Expression of δ-toxin by Staphylococcus aureus mediates escape from phago-endosomes of human epithelial and endothelial cells in the presence of β-toxin.

Authors:  Bernd Giese; Frithjof Glowinski; Kerstin Paprotka; Silvia Dittmann; Tobias Steiner; Bhanu Sinha; Martin J Fraunholz
Journal:  Cell Microbiol       Date:  2010-11-11       Impact factor: 3.715

8.  Evidence of an intracellular reservoir in the nasal mucosa of patients with recurrent Staphylococcus aureus rhinosinusitis.

Authors:  Sophie Clement; Pierre Vaudaux; Patrice Francois; Jacques Schrenzel; Elzbieta Huggler; Sandy Kampf; Christine Chaponnier; Daniel Lew; Jean-Silvain Lacroix
Journal:  J Infect Dis       Date:  2005-08-09       Impact factor: 5.226

9.  Neutrophil bleaching of GFP-expressing staphylococci: probing the intraphagosomal fate of individual bacteria.

Authors:  Jamie Schwartz; Kevin G Leidal; Jon K Femling; Jerrold P Weiss; William M Nauseef
Journal:  J Immunol       Date:  2009-07-20       Impact factor: 5.422

10.  Phagocytosis of Staphylococcus aureus by macrophages exerts cytoprotective effects manifested by the upregulation of antiapoptotic factors.

Authors:  Joanna Koziel; Agnieszka Maciag-Gudowska; Tomasz Mikolajczyk; Malgorzata Bzowska; Daniel E Sturdevant; Adeline R Whitney; Lindsey N Shaw; Frank R DeLeo; Jan Potempa
Journal:  PLoS One       Date:  2009-04-21       Impact factor: 3.240

View more
  9 in total

1.  Interleukin 6 Promotes Brucella abortus Clearance by Controlling Bactericidal Activity of Macrophages and CD8+ T Cell Differentiation.

Authors:  Huynh Tan Hop; Tran Xuan Ngoc Huy; Alisha Wehdnesday Bernardo Reyes; Lauren Togonon Arayan; Son Hai Vu; WonGi Min; Hu Jang Lee; Chang Keun Kang; Dong Hee Kim; Dong Seob Tark; Suk Kim
Journal:  Infect Immun       Date:  2019-10-18       Impact factor: 3.441

Review 2.  Molecular basis of mycobacterial survival in macrophages.

Authors:  Jane Atesoh Awuh; Trude Helen Flo
Journal:  Cell Mol Life Sci       Date:  2016-11-19       Impact factor: 9.261

3.  Novel Resolvin D2 Receptor Axis in Infectious Inflammation.

Authors:  Nan Chiang; Xavier de la Rosa; Stephania Libreros; Charles N Serhan
Journal:  J Immunol       Date:  2016-12-19       Impact factor: 5.422

4.  The expression profiles of immune genes in Mus musculus macrophages during Staphylococcus aureus infection.

Authors:  Ziyan Wang; Fei Zhu
Journal:  PLoS One       Date:  2018-01-05       Impact factor: 3.240

5.  Essential genes of the macrophage response to Staphylococcus aureus exposure.

Authors:  Aixia Sun; Hongwei Zhang; Feng Pang; Guifen Niu; Jianzhong Chen; Fei Chen; Jian Zhang
Journal:  Cell Mol Biol Lett       Date:  2018-05-23       Impact factor: 5.787

6.  Macrophages reprogram after ischemic stroke and promote efferocytosis and inflammation resolution in the mouse brain.

Authors:  Wenting Zhang; Jingyan Zhao; Rongrong Wang; Ming Jiang; Qing Ye; Amanda D Smith; Jun Chen; Yejie Shi
Journal:  CNS Neurosci Ther       Date:  2019-11-07       Impact factor: 5.243

Review 7.  The Role of Macrophages in Staphylococcus aureus Infection.

Authors:  Grace R Pidwill; Josie F Gibson; Joby Cole; Stephen A Renshaw; Simon J Foster
Journal:  Front Immunol       Date:  2021-01-19       Impact factor: 7.561

Review 8.  Exploring the Role of Staphylococcus aureus in Inflammatory Diseases.

Authors:  Huanquan Chen; Junyan Zhang; Ying He; Zhuoyi Lv; Zhengtong Liang; Jianze Chen; Peishan Li; Jiawei Liu; Hongchen Yang; Ailin Tao; Xueting Liu
Journal:  Toxins (Basel)       Date:  2022-07-06       Impact factor: 5.075

9.  Interleukin-33 Receptor (ST2) Deficiency Improves the Outcome of Staphylococcus aureus-Induced Septic Arthritis.

Authors:  Larissa Staurengo-Ferrari; Silvia C Trevelin; Victor Fattori; Daniele C Nascimento; Kalil A de Lima; Jacinta S Pelayo; Florêncio Figueiredo; Rubia Casagrande; Sandra Y Fukada; Mauro M Teixeira; Thiago M Cunha; Foo Y Liew; Rene D Oliveira; Paulo Louzada-Junior; Fernando Q Cunha; José C Alves-Filho; Waldiceu A Verri
Journal:  Front Immunol       Date:  2018-05-16       Impact factor: 7.561

  9 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.