| Literature DB >> 26437339 |
Laura Smith1, Euan W Baxter1, Philip A Chambers1, Caroline A Green1, Andrew M Hanby1, Thomas A Hughes2, Claire E Nash1, Rebecca A Millican-Slater3, Lucy F Stead1, Eldo T Verghese1, Valerie Speirs1.
Abstract
BACKGROUND: MicroRNA (miR) expression is commonly dysregulated in many cancers, including breast. MiR-92 is one of six miRs encoded by the miR-17-92 cluster, one of the best-characterised oncogenic miR clusters. We examined expression of miR-92 in the breast epithelium and stroma during breast cancer progression. We also investigated the role of miR-92 in fibroblasts in vitro and showed that down-regulation in normal fibroblasts enhances the invasion of breast cancer epithelial cells. METHODOLOGY/PRINCIPALEntities:
Mesh:
Substances:
Year: 2015 PMID: 26437339 PMCID: PMC4593575 DOI: 10.1371/journal.pone.0139698
Source DB: PubMed Journal: PLoS One ISSN: 1932-6203 Impact factor: 3.240
Pathological features of patients selected for LMD of normal, DCIS and invasive breast lesions (n = 9).
| Case | Tumour type | Size (mm) | Age | Grade | ER | PR | HER2 | LN |
|---|---|---|---|---|---|---|---|---|
| 1 | Ductal NST | 26 | 69 | 2 | + | - | - | N1 |
| 2 | Ductal NST | 14 | 55 | 2 | + | + | - | N0 |
| 3 | Ductal NST | 20 | 45 | 2 | + | + | - | N2 |
| 4 | Ductal NST | 16 | 69 | 1 | + | + | - | N0 |
| 5 | Ductal NST | 14 | 40 | 2 | + | + | - | N0 |
| 6 | Ductal NST | 55 | 61 | 3 | - | - | - | N1 |
| 7 | Ductal NST | 27 | 86 | 2 | + | + | - | N0 |
| 8 | Ductal NST | 28 | 43 | 2 | + | + | - | N1 |
| 9 | Ductal NST | 30 | 48 | 1 | + | + | - | N0 |
Primers used for pyrosequencing.
| Primer | Sequence (5’-3’) | Genomic co-ordinates (GRCh38/hg38) |
|---|---|---|
| Forward | GGGGGTTGGGGGATATAAA | chr13:91348926–91348944 |
| Reverse (biotinylated) | CCTTTTTCAATTCCTTTTCCCTTTAC | chr13:91349234–91349209 |
| Sequencing | GGGGGATATAAAGGAG | chr13:91348933–91348948 |
Fig 1In silico analysis using BreastMark [26] shows luminal A breast cancer patients (n = 154) who express miR–92 have improved disease free survival (DFS) rate compared to patients with low expression levels with a hazard ratio of 0.49 (95% confidence intervals 0.28–0.84; p = 0.008).
Fig 2Laser micro-dissection (LMD) was used to isolate areas of epithelium in normal (A), DCIS (B) and invasive (C) breast tissue from the same tissue section. Breast tissue images show examples of the areas captured for patient 4 as a representative example. The expression of miR–92 decreased during breast cancer progression with highest levels observed in normal breast epithelium, decreasing in DCIS and being lowest in invasive breast tissue (D). *denotes significance of p<0.01.
Fig 3Expression of ERβ1 and miR–92 are not inversely correlated in patients with primary breast cancer. Staining patterns of ERβ1 showed nuclear expression in the normal breast (A) epithelium (examples shown by red arrows) with no significant difference in nuclear staining during cancer progression (B). A shift in the localisation of ERβ1 staining was observed with a significant increase in cytoplasmic staining (green arrows) during progression to DCIS (C, E) and invasive breast cancer (D, E). Blue arrows show ERβ1-negative nuclei. Images of breast tissues show the staining patterns for patient 4 as a representative example. Horizontal lines represent the mean. Range ± S.D. *denotes significance of p<0.05; **denotes significance of p<0.01.
Fig 4Expression of miR92 in normal fibroblasts (NFs) and cancer associated fibroblasts (CAFs) in patient samples (A) and primary fibroblast cultures (B) by qRT-PCR. *denotes significance of p = 0.0014 between NFs (high and low expressing groups) and NFs and CAFs (ANOVA).
Fig 5Down-regulation of miR92 expression in normal fibroblasts (NFs), but not cancer associated fibroblasts (CAFs), significantly enhances the invasive capacity of breast cancer epithelial cells. Matched NFs and CAFs were reverse transfected with either an inhibitor of miR92 or negative control (A) and a Matrigel™ invasion assay was used to assess effects on the behaviour of breast cancer epithelial cells 48 hours post-transfection. Down-regulation of miR92 significantly increased the invasion of MCF7 (B) and MDA-MB–231 (C) cells. Error bars are ± S.D. *denotes significance of p<0.05; **denotes significance of p<0.01; ***denotes significance of p<0.001.
Fig 6In silico analyses using the Oncomine platform showed that expression of the ESR2 gene in the breast tumour microenvironment does not correlate with patient outcome (p = 0.9337) (A). Expression of TGFBR2 (B) and BMPR2 (C) showed a trend towards significance (p = 0.1046 and p = 0.2029) suggesting that high expression levels of these genes are associated with lower rates of patient survival.