| Literature DB >> 26421252 |
Hui Shang1, Ying Wang2, Yue-Hong Yan1.
Abstract
PREMISE OF THE STUDY: Microsatellite loci were isolated in Hypolepis punctata (Dennstaedtiaceae) to further study the reproductive ecology of this species. METHODS ANDEntities:
Keywords: Dennstaedtiaceae; Hypolepis punctata; microsatellite; phylogeography; population genetics
Year: 2015 PMID: 26421252 PMCID: PMC4578377 DOI: 10.3732/apps.1500047
Source DB: PubMed Journal: Appl Plant Sci ISSN: 2168-0450 Impact factor: 1.936
Characteristics of 16 microsatellite loci developed in Hypolepis punctata.
| Locus | Primer sequences (5′–3′) | Repeat motif | Allele size range (bp) | GenBank accession no. |
| SHH02 | F: GTTGTCGTAATCCGCAAAGTGG | (TC)19 | 292–294 | KR270806 |
| R: CAGATATGAGCGTCATTATCTCGGT | ||||
| SHH13 | F: CATGGATTTGTTCTCCCTATCTGC | (GA)39 | 362–378 | KR270807 |
| R: TGGCCTTTGGGGAACCTTAGTA | ||||
| SHH17 | F: CAGCAGCAGAGGAACCTGACA | (CT)15 | 445–447 | KR270808 |
| R: ATTGCGAACCACCCATTGAC | ||||
| SHH19 | F: TTGATGCCTCCATGACTATGCT | (CA)24 | 264–288 | KR270809 |
| R: TCACCTGTCCTCCCTAACTTCT | ||||
| SHH23 | F: CGGAGCGGAAAGGTAGAACA | (AC)6AT(AC)3 | 235–245 | KR270810 |
| R: TTTTGCCACTATTGCTGATGAA | ||||
| SHH33 | F: TCTCCCTCCCTCGATCTCCTT | (CT)17 | 246–258 | KR270811 |
| R: ATGTGGTGCTTCTAGCTGCTGAC | ||||
| SHH34 | F: AACCGTAACAGACGTGCAAACC | (CT)20(CA)9 | 441–453 | KR270812 |
| R: TGTGAGAAGCAGCAAGTCCAAA | ||||
| SHH44 | F: TGGTATCATAGGCCATTTTGTCC | (CT)17(CA)13 | 172–196 | KR270813 |
| R: TAGAGGAGGGAGATGCATTGAGA | ||||
| SHH46 | F: GGAATAAACCATGTAGGCAAGAGC | (GA)13 | 121–123 | KR270814 |
| R: CCAACGAGCCATGTGGACAA | ||||
| SHH51 | F: TAGCAGTAAATAGTTTGTTACGTGCCC | (CA)6AA(CA)3 | 246–249 | KR270815 |
| R: CCATCCGTTGTTGCCCCAT | ||||
| SHH55 | F: GGAATCGCCAAGGAGATAATAA | (AG)12 | 413–422 | KR270816 |
| R: CCCTCTTTTCTCAATCTATGTCCC | ||||
| SHH56 | F: AGAAGATGCTTGTCATAAGTAGGG | (CT)20 | 421–438 | KR270817 |
| R: AATGCTCAAGTCAAAAGTGCC | ||||
| SHH65 | F: TCGATAGTGTTCGCGGGTAA | (CT)23(CA)11 | 271–283 | KR270818 |
| R: GGGCATGGTGGTGACAAAGT | ||||
| SHH71 | F: TTTCGTCTAAATCATGCTCTTTCC | (CT)16 | 293–301 | KR270819 |
| R: GCCTGTCTCGCTACCCGTAT | ||||
| SHH77 | F: GATGAATAAAAGAACTTAAACCAAC | (CA)10 | 439–451 | KR270820 |
| R: AGCAAGAAAGGGAGAACGAG | ||||
| SHH78 | F: ACAGTGATGGAAGGCTGAAAGTC | (CT)10 | 238–242 | KR270821 |
Genetic properties of the 16 newly developed microsatellites of Hypolepis punctata.
| Total ( | Hainan ( | Wuling ( | Nanling ( | |||||||||
| Locus | ||||||||||||
| SHH02 | 2 | 0.036 | 0.036 | 1 | 0.000 | 0.000 | 1 | 0.000 | 0.000 | 2 | 0.063 | 0.063 |
| SHH13 | 10 | 0.143 | 0.843 | 3 | 0.143 | 0.385 | 3 | 0.200 | 0.644 | 9 | 0.125 | 0.815 |
| SHH17 | 3 | 0.071 | 0.491 | 2 | 0.000 | 0.264 | 2 | 0.200 | 0.556 | 3 | 0.063 | 0.179 |
| SHH19 | 6 | 0.143 | 0.805 | 3 | 0.143 | 0.648 | 3 | 0.200 | 0.733 | 4 | 0.125 | 0.667 |
| SHH23 | 3 | 0.143 | 0.137 | 1 | 0.000 | 0.000 | 2 | 0.400 | 0.356 | 3 | 0.125 | 0.123 |
| SHH33 | 7 | 0.179 | 0.760 | 4 | 0.286 | 0.396 | 2 | 0.000 | 0.533 | 4 | 0.188 | 0.692 |
| SHH34 | 6 | 0.143 | 0.732 | 2 | 0.000 | 0.440 | 3 | 0.400 | 0.644 | 3 | 0.125 | 0.573 |
| SHH44 | 5 | 0.143 | 0.759 | 2 | 0.143 | 0.495 | 2 | 0.200 | 0.556 | 4 | 0.125 | 0.718 |
| SHH46 | 2 | 0.143 | 0.468 | 2 | 0.143 | 0.143 | 2 | 0.200 | 0.556 | 3 | 0.188 | 0.534 |
| SHH51 | 3 | 0.071 | 0.390 | 2 | 0.143 | 0.143 | 1 | 0.000 | 0.000 | 2 | 0.063 | 0.063 |
| SHH55 | 5 | 0.143 | 0.606 | 4 | 0.143 | 0.495 | 2 | 0.200 | 0.200 | 2 | 0.125 | 0.444 |
| SHH56 | 8 | 0.143 | 0.845 | 6 | 0.000 | 0.879 | 4 | 0.400 | 0.711 | 5 | 0.125 | 0.810 |
| SHH65 | 6 | 0.143 | 0.779 | 2 | 0.143 | 0.143 | 2 | 0.200 | 0.200 | 4 | 0.125 | 0.756 |
| SHH71 | 4 | 0.071 | 0.538 | 3 | 0.143 | 0.275 | 2 | 0.200 | 0.200 | 3 | 0.000 | 0.331 |
| SHH77 | 4 | 0.071 | 0.610 | 1 | 0.000 | 0.000 | 1 | 0.000 | 0.000 | 3 | 0.125 | 0.486 |
| SHH78 | 2 | 0.036 | 0.363 | 2 | 0.143 | 0.143 | 1 | 0.000 | 0.000 | 1 | 0.000 | 0.000 |
Note: A = number of sampled alleles; He = expected heterozygosity; Ho = observed heterozygosity.
Cross-amplification length (in base pairs) of 16 microsatellite loci from Hypolepis punctata in other Hypolepis species.
| Locus | |||||
| SHH02 | 292 | 292 | 278–292 | — | 292 |
| SHH13 | 366–368 | 382 | 382 | 372 | — |
| SHH17 | 443 | — | — | 485 | 447–449 |
| SHH19 | 264–272 | 290 | — | — | — |
| SHH23 | 235–243 | 233–235 | 225 | 227–239 | 239 |
| SHH33 | 248 | 276 | — | — | — |
| SHH34 | 449 | 457 | — | — | — |
| SHH44 | 150 | — | 140 | 152 | — |
| SHH46 | 121 | 111–113 | 149 | 115 | 121–123 |
| SHH51 | 246 | 287 | — | — | — |
| SHH55 | 416 | — | — | — | 421–423 |
| SHH56 | 431–433 | — | 425 | 417 | 429–431 |
| SHH65 | 273–281 | — | — | 277 | 281–283 |
| SHH71 | 293 | — | — | — | 293 |
| SHH77 | 443 | 449 | — | — | 445 |
| SHH78 | 238 | — | — | — | 240 |
Note: — = failed amplification; n = number of individuals sampled.
Voucher and locality information of all Hypolepis samples used in this study.
| Species | Voucher no. | Locality | Geographic coordinates |
| JSL-WLSQ522 | Wuling Mountain, Hunan, China | 29°18′31″N, 110°6′52″E | |
| YYH13169 | Nanling Mountain, Guangdong, China | 24°43′24″N, 114°15′46″E | |
| SG2984 | Bawangling Mountain, Hainan, China | 19°5′49″N, 109°13′32″E | |
| SG765, SG767 | Fanjingshan Mountain, Guizhou, China | 27°55′44″N, 108°41′17″E | |
| SG2900 | Bawangling Mountain, Hainan, China | 19°5′28″N, 109°10′59″E | |
| HN31 | Wuzhishan Mountain, Hainan, China | 18°55′1″N, 109°42′13″E | |
| YYH11628, YYH11629 | Nantou County, Taiwan, China | NA | |
| SIWS19 | Celebes Island, Indonesia | NA |
Note: NA = not available.
aSpecimens are deposited at the Shanghai Chenshan Botanical Garden Herbarium (CSH), except for voucher SIWS19, which is deposited at the Chinese National Herbarium, Institute of Botany, Chinese Academy of Sciences (PE).