Discrimination between E. granulosus sensu stricto, E. multilocularis and E. shiquicus Using a Multiplex PCR Assay.

BACKGROUND: Infections of Echinococcus granulosus sensu stricto (s.s), E. multilocularis and E. shiquicus are commonly found co-endemic on the Qinghai-Tibet plateau, China, and an efficient tool is needed to facilitate the detection of infected hosts and for species identification. METHODOLOGY/PRINCIPAL
FINDINGS: A single-tube multiplex PCR assay was established to differentiate the Echinococcus species responsible for infections in intermediate and definitive hosts. Primers specific for E. granulosus, E. multilocularis and E. shiquicus were designed based on sequences of the mitochondrial NADH dehydrogenase subunit 1 (nad1), NADH dehydrogenase subunit 5 (nad5) and cytochrome c oxidase subunit 1 (cox1) genes, respectively. This multiplex PCR accurately detected Echinococcus DNA without generating nonspecific reaction products. PCR products were of the expected sizes of 219 (nad1), 584 (nad5) and 471 (cox1) bp. Furthermore, the multiplex PCR enabled diagnosis of multiple infections using DNA of protoscoleces and copro-DNA extracted from fecal samples of canine hosts. Specificity of the multiplex PCR was 100% when evaluated using DNA isolated from other cestodes. Sensitivity thresholds were determined for DNA from protoscoleces and from worm eggs, and were calculated as 20 pg of DNA for E. granulosus and E. shiquicus, 10 pg of DNA for E. multilocularis, 2 eggs for E. granulosus, and 1 egg for E. multilocularis. Positive results with copro-DNA could be obtained at day 17 and day 26 after experimental infection of dogs with larval E. multilocularis and E. granulosus, respectively.
CONCLUSIONS/SIGNIFICANCE: The multiplex PCR developed in this study is an efficient tool for discriminating E. granulosus, E. multilocularis and E. shiquicus from each other and from other taeniid cestodes. It can be used for the detection of canids infected with E. granulosus s.s. and E. multilocularis using feces collected from these definitive hosts. It can also be used for the identification of the Echinococcus metacestode larva in intermediate hosts, a stage that often cannot be identified to species on visual inspection.

Introduction

In the most recent taxonomic revision, nine species were recognized in the genus Echinococcus [1]. Of these, the most important and widespread are E. granulosus sensu stricto (genotypes G1-G3) and E. multilocularis, which cause cystic echinococcosis (CE) and alveolar echinococcosis (AE), respectively. The former is commonly associated with livestock and human infections worldwide whereas the latter is primarily found in voles and humans and is geographically limited to the northern hemisphere [2]. To date, E. granulosus s.s., E. canadensis (G6), E. multilocularis and E. shiquicus have been identified in China [3-5]. Both E. multilocularis and E. granulosus s.s. are particularly widespread in western China, including Qinghai, Ningxia, Gansu, Xinjiang and Sichuan provinces/autonomous regions, and are well known as major public health and medical threats. Unlike the other species, E. shiquicus has a very restricted distribution, being reported only from Qinghai Province, China. This species is not known to cause human echinococcosis. The intermediate hosts are plateau pikas (Ochotona curzoniae), in which unilocular cysts occur.

For Echinococcus species in general, dogs, wolves, other canids and cats are definitive hosts in which adult worms cause sub-clinical infections [6-9]. However, larval Echinococcus spp. can cause morbidity and mortality in their intermediate hosts which include cattle, sheep, small mammals (including rodents, plateau pikas, etc.) and humans [10, 11]. It can be difficult to discriminate morphologically adults of some Echinococcus species, such as E. multilocularis and E. shiquicus [12].

To replace traditional morphological methods, a number of molecular approaches targeting parasite DNA have been developed for identification/discrimination of different life stages of Echinococcus species in definitive and intermediate hosts [13-15]. Multiplex PCR approaches, simultaneously using multiple specific primers in a single tube and detecting more than one target species, are material- and time-saving, precise, efficient and cost-effective when DNA from a mixture of pathogens may be present in a sample. This approach is also suitable for mass-screening of samples that may be generated from epidemiological investigations in endemic areas. Several multiplex PCR methods have been developed for identifying certain Echinococcus species, but none for the identification of E. shiquicus [16-17].

Based on interspecific variation in mitochondrial genes of the genus Echinococcus, we designed a multiplex PCR assay with three pairs of specific primers in a single reaction tube for rapid identification of E. granulosus s.s., E. multilocularis and E. shiquicus originating from either intermediate or definitive hosts. Further assessment of the sensitivity and specificity of the multiplex PCR assay was performed using metacestode DNA and copro-DNA to determine the reliability and accuracy of the new diagnostic tool developed in this study.

Materials and Methods

Ethics statement

Dogs and mice used in this study were handled in strict accordance with good animal practice according to the Animal Ethics Procedures and Guidelines of the People's Republic of China (Regulations for Administration of Affairs Concerning Experimental Animals, China, 1988). No endangered/protected species were involved in this study. The dogs and mice used were also treated in accordance with the institutional procedures and guidelines for animal husbandry issued by the Ethics Committee of Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences (Approval No. LVRIEC2010-005).

Sampling of Echinococcus material

Adult worms were collected from stray dogs during routine work of the endemic echinococcosis prevention and control program in Dari County, Qinghai Province, P.R. China. A total of 86 Echinococcus spp. metacestode samples from yaks, sheep, Qinghai voles (Microtus/Neodon fuscus) and plateau pikas were collected on the Qinghai-Tibet plateau, P.R. China. Ten yak lungs and 16 sheep livers harboring hydatid cysts were collected from abattoirs in Maqu County, Gansu Province and Xining City, Qinghai Province, respectively. Thirty Qinghai vole livers and 30 plateau pika lungs harboring hydatid cysts were provided by the epidemic prevention station of Dari County, Qinghai Province.

Parasite materials were dissected from the host tissue and stored either in 70% ethanol before molecular analyses, or temporarily stored at 4°C prior to experimental infections of dogs.

Experimental infection of dogs

Fifteen dogs (mixed breeds) aged 6–8 months were purchased in Lanzhou City, Gansu Province, China. These were de-wormed using praziquantel and confirmed to be free of intestinal parasites by examination of their feces two weeks later. Samples of these feces were retained as negative controls for the multiplex PCR assay. Live protoscoleces (100,000) of each Echinococcus spp. were fed independently to five dogs after their viability for dog challenge was confirmed by microscopy.

Sampling of adults/eggs of Echinococcus spp. from challenged dogs

Dogs were euthanized three months after challenge with protoscoleces. Fecal samples were collected from the dogs each day prior to sacrifice. After removal of the coarse gut contents, the small intestine was cut into 15–20 cm lengths and opened to expose the mucosa. Samples, taken by scraping the mucosa with glass strips, were placed in petri dishes in bio-safety containers [18]. After addition of a small volume of sterile phosphate-buffered saline (PBS, pH 7.2), the contents were checked for the presence of worms (intact or fragmented) and/or eggs. Adult worms were removed using a glass needle and washed in PBS three times. All procedures were performed following appropriate bio-safety conditions [19].

Fecal sampling from non-experimented definitive hosts

Ten stray dogs, provided by the epidemic prevention station in Dari County, Qinghai Province, were processed as above to obtain mucosal samples, worms and eggs. Additionally, five fecal samples from captive foxes were collected from a fur farm in Lanzhou City, Gansu Province. All the collected fecal samples were frozen at -80°C for at least seven days for bio-safety reasons. Worm samples were preserved either in 70% ethanol or frozen at (-80°C) in PBS for further analyses.

Other helminths

DNA samples, extracted from a variety of cestodes (identities confirmed by sequencing and morphology), were used to determine the specificity of the newly developed multiplex PCR assay (Table 1). They were kindly provided by the Key Laboratory of Veterinary Parasitology of Gansu Province, Lanzhou Veterinary Research Institute, CAAS.

Table 1

Parasite species and their GenBank accession numbers for the nad1, nad5 and cox1 genes used in this study.

Parasite	Sequence accession no.	Reference
E. granulosus s.s.	NC_008075/ AF297617	Yang et al, 2005 [22]; Le et al, 2000 [35].
E. multilocularis	NC_000928	Nakao et al, 2002 [23].
E. shiquicus	NC_009460	Nakao et al, 2007 [24].
E. oligarthrus	AB208545/ NC_009461	Nakao et al, 2007 [24].
E. canadensis	NC_011121/ AB235847	Nakao et al, 2007 [24].
E. ortleppi	NC_011122	Nakao et al, 2007 [24].
E. vogeli	NC_009462	Nakao et al, 2007 [24].
E. canadensis (G6)*	AB208063	Nakao et al, 2007 [24].
T. hydatigena*	GQ228819/ FJ518620	Jia et al, 2010 [36]; Liu et al, 2011 [37].
T. multiceps*	GQ228818/ FJ495086	Jia et al, 2010 [36]; Liu et al, 2011 [37].
T. pisiformis*	GU569096	Jia et al, 2010 [36].
T. asiatica	AF445798	Jeon et al, 2005 [38].
T. saginata	NC009938/ AY684274	Jeon et al, 2007 [39].
T. taeniaeformis*	JQ663994/ FJ597547	Jia et al. 2012 [40]; Liu et al, 2011 [37].
T. solium*	AB086256	Nakao et al, 2003 [41].
D. caninum*	AB732959	Nakao et al, 2013 [42].

Note: DNA from parasites labeled with * were used to test the specificity of the multiplex PCR system in this study.

Host tissue sampling

DNA extracted from host tissues was used to check for nonspecific reactions or assay interference that might be caused by contamination of parasite samples with host DNA. Host tissues included dog intestines, and liver and lung samples from cattle, sheep, Qinghai voles and plateau pikas.

DNA extraction from samples

Two hundred mg of each metacestode sample was frozen in liquid nitrogen and ground to powder after removal of ethanol or PBS by rinsing with ddH2O. Total genomic DNA was extracted using a QIAGEN DNeasy Blood & Tissue Kit (QIAGEN, Hilden, Germany) according to the manufacturer’s instructions and stored at -20°C until use.

To minimize the impact of inhibitors on PCR using copro-samples as template, an additional step of stool flotation in saturated zinc chloride solution was used before copro-DNA extraction [20]. Briefly, about 20 g (20 ml) fecal material was placed in a 50 ml centrifuge tube, which was then filled with zinc chloride solution. The tube was vortexed until the fecal material was completely broken up. The tube was then centrifuged at 1000 ×g for 5 min. Five hundred μl of the supernatant (usually containing helminth eggs, proglottids or cells of parasites) was transferred to a 2 ml centrifuge tube, 1.5 ml ddH2O was added to dilute the solution, and the tube was centrifuged at 12,000 ×g for 10 min. The supernatant was carefully discarded and 200 μl ddH2O added to suspend the sediment for DNA extraction. Total genomic DNA was extracted using a QIAGEN QIAamp DNA Stool Mini Kit (QIAGEN, Hilden, Germany) following the manufacturer’s instructions, and the DNA concentration was determined using a spectrophotometer (Thermo, NanoDrop 2000, USA) after elution in 50 μl ddH2O for use in the PCR assay.

Genomic DNA was extracted from host tissues using a QIAGEN DNeasy Blood & Tissue Kit (QIAGEN, Hilden, Germany), according to the manufacturer’s instructions, and stored at -20°C until use.

Primer design

The complete mt genomes (mtDNA) of various cestodes (Table 1) available in GenBank (http://www.ncbi.nlm.nih.gov/) were retrieved to facilitate design of primers specific for E. granulosus s.s., E. multilocularis and E. shiquicus (Table 1). The sequences were aligned automatically using Clustal in MEGA5.0 [21]. Primer pairs, expected to be specific for E. granulosus s.s. (S1 Fig), E. multilocularis (S2 Fig) and E. shiquicus (S3 Fig), were thus obtained. After some preliminary experimentation, one pair of primers specific for each Echinococcus spp. was selected for inclusion in the multiplex PCR assay. Sequences of these primers, target genes and other related information are presented in Table 2.

Table 2

Sequences of primers used in the multiplex PCR.

Species	Gene	Primer	Sequence (5'-3')	Amplicon size (bp)	Concentration (nM)
E. granulosus s.s.	nad1	F-Eg	GGTTTTATCGGTATGTTGGTGTTAGTG	219	100
		R-Eg	CATTTCtTGAAGTTAACAGCATCACG
E. multilocularis	nad5	F-Em	CATTAATTATGGATGTTTCC	584	50
		R-Em	GGAAATACCCCACTATCC
E. shiquicus	cox1	F-Es	GCTTTAAGTGCGTGACTTTTAATCCC	471	100
		R-Es	CATCAAAACCAGCACTAATACTCA

Multiplex PCR assay

PCR amplification was carried out in a 25 μl mixture containing 2 μl dNTPs (2.5 mM of each), 2.5 μl 10× ExTaq Buffer (Mg2+ free), 2 μl MgSO4 (25 mM), 0.25 μl ExTaq DNA polymerase (5U/μl) (TaKaRa, Dalian, Liaoning), 100 pg DNA template of each Echinococcus sample, and all three primer pairs were added according to the final concentrations given in Table 2. Fragments were amplified using the following optimized thermocycling conditions: 95°C/5 min for denaturation; 30 cycles of 94°C/30 sec, 55°C/30 sec, 72°C/40 sec; and 72°C/10 min extension. For all the multiplex PCR assays, positive DNA (DNA templates of the three Echinococcus spp.) and negative (no-DNA) controls were included.

Identification of PCR products

Amplicons were visualized by electrophoresis in 2.0% (w/v) agarose gels in 1×TAE (40 mM Tris-acetate, 2 mM EDTA, pH 8.5), stained with ethidium bromide (EB), and viewed under UV light. The fragments were purified using an agarose Gel DNA Purification Kit (TaKaRa, Dalian, Liaoning), and then cloned into pMD18-T Simple vectors using a TA cloning strategy. The recombinant vectors were identified by enzyme digestion and at least two clones for each DNA region were sequenced by the Shanghai Invitrogen Biotechnology Co. Ltd.

Controls for the multiplex PCR assay

Positive control for fecal sample tests

DNA from protoscoleces of the three Echinococcus spp. was added to a fecal sample as positive control. Another type of positive control was provided by the copro-samples that were directly collected from dogs successfully infected with E. multilocularis or E. granulosus s.s.

Negative controls

To exclude the possibility of contamination in the PCR amplification, two negative fecal samples (no-DNA) were used. Other negative controls included all reagents except for the addition of parasite DNA.

Fecal inhibitor controls

To test for potential inhibitors, DNA extracted from protoscoleces and identified by gene sequencing was added to a negative fecal sample, and subjected to the multiplex PCR in parallel with the negative fecal sample.

Host tissue controls

DNAs extracted from tissues of dogs and foxes as well as those from intermediate hosts were tested using the multiplex PCR assay to determine the minimum contamination level that could cause interference in the assay. Host DNA (0.1, 0.5, 1, 5, 10, 50, 100, 500 or 1000 ng) was mixed into each relevant parasite DNA sample prior to the assay.

Specificity and sensitivity

Specificity

Three pairs of primers were added to each PCR tube with the optimized multiplex PCR reaction conditions (described above) to test various parasite DNA samples as listed in Table 1.

Lowest/highest detection limit of DNA using Echinococcus larval tissue

DNA samples from protoscoleces of the three Echinococcus spp. were quantified by spectrophotometry using a NanoDrop 2000 (Thermo Scientiific, Wilmington, DE, USA). Serial dilutions of the DNA template (0.01, 0.02, 0.05, 0.1, 0.5, 1, 5, 10, 50, 100, 500 and 1000 ng) were used to assay the analytical sensitivity and potential nonspecific amplification of DNA in the multiplex PCR system. Amplification results were visualized by electrophoresis in a 2.0% (w/v) agarose gel.

Minimum numbers of eggs detectable in fecal samples

One to ten Echinococcus eggs were added to the diluted negative fecal samples. DNA extracted from these samples was used in the multiplex reaction to determine the minimum number of eggs that could yield a positive PCR outcome.

Earliest time post-infection on which dog fecal samples yielded positive PCR results

All copro-DNAs, extracted from fecal samples that had been collected every day from experimentally infected dogs, were tested using the multiplex PCR assay to determine the first day when a positive signal occurred.

Results

Infection outcomes of the experimentally challenged dogs and the examination of stray dogs

Infections of E. granulosus s.s. and E. multilocularis were successfully achieved in all the experimentally infected dogs with 5539, 8562, 12535, 18932 and 20775 E. granulosus s.s. and 2893, 3153, 3762, 3864 and 5322 E. multilocularis adult worms being recovered from each group of 5 dogs that were fed with protoscoleces of each species. No adult worms were found in any of the 5 dogs fed larval E. shiquicus. None of the stray dogs was found harboring E. shiquicus or E. multilocularis; only E. granulosus s.s. adult worms were found in their intestinal contents (identity confirmed by both morphology and cox1 sequencing). Worm burdens were relatively low (circa 100–200 worms) in the ten stray dogs examined.

Expected PCR products of 219, 584 and 471 bp were obtained for E. granulosus s.s. (nad1), E. multilocularis (nad5) and E. shiquicus (cox1), respectively (Fig 1), and products of mixed templates of the three Echinococcus species are shown in Fig 2. The multiplex PCR products contained 3 DNA bands (219, 471 and 584 bp) with mixed DNA templates of E. granulosus s.s., E. multilocularis and E. shiquicus; 2 DNA bands (219 and 584 bp) with E. granulosus s.s. and E. multilocularis DNA templates; 2 DNA bands (219 and 471 bp) with E. granulosus s.s. and E. shiquicus DNA templates; and 2 DNA bands (471 and 584 bp) with E. multilocularis and E. shiquicus DNA templates. DNA sequences of these products corresponded in each case with the relevant reference sequences in GenBank: E. granulosus (G1) (NC_008075) [22], E. multilocularis (NC_000928) [23] and E. shiquicus (NC_009460) [24].

Fig 1

Amplicons of the target genes using the multiplex PCR assay.

Lanes 1, 2 and 3, Amplicons of E. granulosus s.s., E. multilocularis and E. shiquicus respectively; Lane 4, Negative control; M, DNA Marker DL 2000.

Fig 2

Amplicons of the mixed templates using the multiplex PCR assay.

Lane 1, Amplicons of E. granulosus s.s., E. multilocularis and E. shiquicus; Lane 2, Amplicons of E. granulosus s.s. and E. multilocularis, Lane 3, Amplicons of E. granulosus s.s. and E. shiquicus; Lane 4, Amplicons of E. granulosus s.s., E. multilocularis and E. shiquicus; Lane 5, Negative control; M, DNA Marker DL 2000.

Specificity

Comparison of various sources of DNA

No PCR products were detected when DNAs from other cestodes (Table 1, labeled with an asterisk) were used in the multiplex assay (Fig 3). False positive results were never produced from confirmed negative samples. Further, no PCR products were obtained when DNA samples from various host tissues were used in the multiplex PCR. Therefore, the specificity of the multiplex PCR for E. granulosus s.s. (G1), E. multilocularis and E. shiquicus was shown to be 100%.

Fig 3

Specificity of the multiplex PCR assay.

M, DNA Marker DL 2000; Lanes 1, 6 and 11, Amplicons of E. granulosus s.s., E. multilocularis and E. shiquicus respectively; Lane 2–5, 7–10 and 12, Other cestode samples: e.g. E. canadensis (G6), T. hydatigena, T. multiceps, T. pisiformis, T. taeniaeformis, T. solium, D. caninum, liver tissue of Qinghai vole, lung tissue of plateau pika.

Copro-DNA templates

Fecal samples, collected from dogs before experimental infection with Echinococcus spp. and from captive foxes (confirmed parasite-free by microscopy and DNA analysis), were negative in the multiplex PCR whereas fecal samples from dogs after experimental infection with either larval E. granulosus s.s. or E. multilocularis were positive. Furthermore, the PCR products obtained were of the expected sizes, matching those that were also obtained for all positive controls. No false positive signals were obtained with any negative control sample.

Fecal inhibitors and the copro-DNA test

To test for the presence of potential inhibitors, parallel multiplex PCR assays were performed with positive Echinococcus spp. DNA, negative fecal samples, and mixtures of Echinococcus spp. DNA and fecal sample DNA as templates. Positive signals were detectable in the multiplex PCRs with mixtures of the Echinococcus spp. DNAs and fecal sample DNA as templates. We infer from this that no adverse fecal inhibitors affected the integrity of the multiplex PCR assay.

Effect of host tissue DNA on the multiplex PCR test

To test for interference due to host DNA contamination in samples, we added various quantities of host DNA to known quantities (100 pg) of parasite DNA. Quantities below 500 ng of host tissue DNA (from intestinal, hepatocyte or pulmonary cells) did not affect PCR outcomes: clear bands of expected sizes were present in gels. However, smeared bands appeared in the gels if the amount of host DNA exceeded 500 ng.

Sensitivity

Minimum/maximum quantity of Echinococcus metacestode DNA

The lower limit for the detection of metacestode DNA was 20 pg for E. granulosus s.s., 10 pg for E. multilocularis, and 20 pg for E. shiquicus, respectively. Clear bands could be visualized up to a maximum quantity of 500 ng template DNA. Smearing of bands occurred if this amount was exceeded. Accordingly, the optimum amount of template DNA used was 100 pg for the multiplex PCR as this quantity produced clear amplicon bands and provided savings on template DNA and PCR primers.

Minimum number of eggs detectable in the fecal samples

Positive PCR products were obtained in reactions using DNA from as few as two eggs of E. granulosus s.s. and one egg of E. multilocularis (Fig 4).

Fig 4

Sensitivity of the multiplex PCR assay.

Lane 1, Amplicons of E. granulosus s.s. and E. multilocularis with 2 eggs and 1 egg respectively, mixed in fecal sample; Lanes 2 and 3, Amplicons of E. multilocularis from 2 eggs and 1 egg respectively, mixed in fecal sample; Lanes 4 and 5, Amplicon of E. granulosus s.s. amplified with 2 eggs and 1 egg mixed in fecal sample; Lane 6, Negative control fecal sample; M, DNA Marker DL 2000.

Earliest time for a positive multiplex PCR assay after experimental infection

Eggs of E. granulosus s.s. and E. multilocularis were visualized under microscopy at days 47–56 and days 36–44 post-challenge, respectively. The multiplex PCR assay yielded positive results from copro-DNA 17 days after experimental infection of dogs with larval E. multilocularis and 26 days after infection with larval E. granulosus s.s.

Assessment of feces from stray dogs

Copro-DNA from all the stray dogs infected with E. granulosus s.s. tested positive in the multiplex PCR.

Discussion

China is the most severe pandemic country for cystic echinococcosis (CE), in humans and livestock, due mainly to E. granulosus s.s., and for alveolar echinococcosis (AE) due to E. multilocularis in humans and small wild mammals. E. shiquicus is also endemic although it has not been reported to infect humans. Dual infections of animal hosts with different Echinococcus spp have been reported in the eastern Qinghai-Tibet plateau region of China [4, 25]. The very close relationship between dogs and humans can lead readily to human infection. The increasing number of human AE and CE cases in northwestern China, where considerable numbers of dogs are present, places a heavy burden on public health and veterinary services. To aid surveillance, management and diagnosis, effective methods are needed for rapid and accurate detection and identification of different life cycle stages of the three Echinococcus spp. simultaneously. The multiplex PCR assay developed in this study provides such a method.

Traditional epidemiological surveys for tapeworms often involve recovery of eggs from feces of potential definitive hosts. However, morphological identification of Echinoccocus eggs to species level is practically impossible, prompting the development of several molecular approaches [26, 27]. Inhibitors present in fecal material that co-purify with parasite DNA extracted from feces often present a problem for PCR-based methods [28]. In this study, the QIAGEN QIAamp DNA Stool Mini Kit, containing InhibitEX tablets for removing inhibitors in fecal samples, was used to purify copro-DNA. The sieving-flotation method was helpful in overcoming this problem due to its enrichment of worm eggs [29]. The positive control (protoscolex DNA in fecal samples) used in this study demonstrated the lack of inhibitor effects in our copro-multiplex PCR assay.

E. granulosus s.s. has been reported as having a pre-patent period of 6 weeks (42 days) [30, 31], while E. multilocularis eggs have been observed in feces at 42–46 days post infection [32]. However, in the current study we first identified eggs of E. granulosus s.s. at 47–56 days post-challenge and those of E. multilocularis at 36–44 days post-challenge by microscopy similar to reports by others [30, 33]. The discrepancies between these studies may be due to the use of different dog-breeds, ages, nutrient status or the conditions under which the dogs were maintained. We were unable to experimentally infect dogs with E. shiquicus although the viability of the challenge sample of protoscoleces was confirmed by microscopy.

PCR-positive signals in this study were obtained from dog fecal samples much earlier (17 days for E. multilocularis and 26 days for E. granulosus) than any other previous studies using microscopy as a method of detecting infected canid hosts. The much earlier detection of an Echinococcus infection by the multiplex PCR method compared with egg recovery from feces and microscopic examination is a marked improvement that can aid surveillance programs aimed at preventing echinococcosis transmission.

The method developed in this study has achieved high species specificity because it produced no amplicon from any other helminth (including several that might dual infect with Echinococcus species in dogs) or from the negative copro-samples (no-DNA). The primer set (three pairs of primers) multiplex reaction in a single tube worked well with all templates tested and yielded specific amplicons of the expected length for each of the three Echinococcus spp. examined.

E. granulosus s.s and E. multilocularis are of major public health concern in many endemic countries globally [34]. A cost effective diagnostic tool is required for echinococcosis surveillance of definitive and intermediate hosts, and for monitoring the effectiveness of control programs. The multiplex PCR assay developed in this study provides an effective method that can be applied in both clinical and epidemiological settings for the identification of Echinococcus spp in diverse hosts, and would be particularly useful for identifying infected hosts in areas co-endemic for AE and CE.

In this study, we focused on Echinococcus samples collected from the Qinghai-Tibet plateau region of China, where three species (E. granulosus, E. multilocularis and E. shiquicus) are known to be endemic. In total, nine species are now recognized in the genus Echinococcus, including E. granulosus sensu stricto (genotypes G1-G3), E. equinus, E. canadensis (genotypes G6, G7, G8 and G10), E. ortleppi, E. multilocularis, E. shiquicus, E. vogeli, E. oligarthrus and E. felidis [1]. None of the three specific pairs of primers developed in this study produced a PCR-amplified product using DNA isolated from E. canadensis (G6 genotype) showing in Fig 3 (the lane 2 with non-band as a negative result). This is supported by inspection and comparison of the primer target sequence for the G6 genotype with those of the three Echinococcus spp., which showed six base pair differences between them (S1 Fig, S2 Fig and S3 Fig in the Supporting Supplementary Information). Furthermore, six or more base pair differences are apparent between the target sequences for E. equinus, E. canadensis (genotypes G7, G8 and G10), E. ortleppi, E. vogeli, E. oligarthrus and E. felidis. Therefore, it is highly unlikely that any amplicon would be produced from these species during the multiplex PCR due to its high species specificity.

STARD Checklist.

(DOC)

Click here for additional data file.

Flowchart.

(DOCX)

Click here for additional data file.

Primer design for Echinococcus granulosus sensu stricto.

(PDF)

Click here for additional data file.

Primer design for Echinococcus multilocularis.

(PDF)

Click here for additional data file.

Primer design for Echinococcus shiquicus.

(PDF)

Click here for additional data file.