| Literature DB >> 26388859 |
Sandra Mota1, Rosana Alves2, Catarina Carneiro2, Sónia Silva3, Alistair J Brown4, Fabian Istel5, Karl Kuchler5, Paula Sampaio2, Margarida Casal2, Mariana Henriques3, Sandra Paiva2.
Abstract
Candida glabrata is considered a major opportunistic fungal pathogen of humans. The capacity of this yeast species to cause infections is dependent on the ability to grow within the human host environment and to assimilate the carbon sources available. Previous studies have suggested that C. albicans can encounter glucose-poor microenvironments during infection and that the ability to use alternative non-fermentable carbon sources, such as carboxylic acids, contributes to the virulence of this fungus. Transcriptional studies on C. glabrata cells identified a similar response, upon nutrient deprivation. In this work, we aimed at analyzing biofilm formation, antifungal drug resistance, and phagocytosis of C. glabrata cells grown in the presence of acetic acid as an alternative carbon source. C. glabrata planktonic cells grown in media containing acetic acid were more susceptible to fluconazole and were better phagocytosed and killed by macrophages than when compared to media lacking acetic acid. Growth in acetic acid also affected the ability of C. glabrata to form biofilms. The genes ADY2a, ADY2b, FPS1, FPS2, and ATO3, encoding putative carboxylate transporters, were upregulated in C. glabrata planktonic and biofilm cells in the presence of acetic acid. Phagocytosis assays with fps1 and ady2a mutant strains suggested a potential role of FPS1 and ADY2a in the phagocytosis process. These results highlight how acidic pH niches, associated with the presence of acetic acid, can impact in the treatment of C. glabrata infections, in particular in vaginal candidiasis.Entities:
Keywords: Candida glabrata; acetate; antifungal drug resistance; candidiasis; fluconazole; phagocytosis; transporters
Year: 2015 PMID: 26388859 PMCID: PMC4560035 DOI: 10.3389/fmicb.2015.00919
Source DB: PubMed Journal: Front Microbiol ISSN: 1664-302X Impact factor: 5.640
Candida glabrata strains used in this study.
| Genotype | Reference | |
|---|---|---|
| ATCC2001 (CBS138) | Wild type | ATCC collection (available at |
| HTL | Derived from ATCC2001, | |
| Derived from HTL, | ||
| Derived from HTL, |
List of primers used in this study.
| Target gene | Primer | Sequence (5′→3′) | PCR product size (bp) |
|---|---|---|---|
| CAGL0C03267g | FPS1 fwd | CATGTCTACCGCTGCTGCTA | 113 |
| CAGL0E03894g | FPS2 fwd | TGCTAGAAGCCGCAGACAAA | 88 |
| CAGL0M03465g | ADY2a fwd | TGTGCTCCTACGGTGGTTTC | 131 |
| CAGL0L07766g | ADY2b fwd | CCCCACCATCGTCTCACAAA | 140 |
| CAGL0A03212g | ATO3 fwd | CGTGAGCAACATACCCCAGT | 93 |
| Housekeeping gene | PGK1 fwd | CAAACGGTGAAAGAAACGAGAA | 100 |
Effect of fluconazole in wild type (WT) C. glabrata ATCC 2001 planktonic cells using two different growth conditions: cells grown in RPMI pH 5.0 and cells grown in RPMI 0.5% acetic acid pH 5.0.
| Condition | MIC (μg/ml) | MFC (μg/ml) |
|---|---|---|
| RPMI pH 5.0 | 150 | 312.5 |
| RPMI 0.5% acetic acid pH 5.0 | 50 | 150 |