W Wujcicka1,2, Z Gaj3,4, J Wilczyński4, D Nowakowska4. 1. Scientific Laboratory of the Center of Medical Laboratory Diagnostics, Polish Mother's Memorial Hospital-Research Institute, 281/289 Rzgowska Street, Lodz, 93-338, Poland. wwujcicka@yahoo.com. 2. Department of Perinatology and Gynecology, Polish Mother's Memorial Hospital-Research Institute, Lodz, Poland. wwujcicka@yahoo.com. 3. Scientific Laboratory of the Center of Medical Laboratory Diagnostics, Polish Mother's Memorial Hospital-Research Institute, 281/289 Rzgowska Street, Lodz, 93-338, Poland. 4. Department of Perinatology and Gynecology, Polish Mother's Memorial Hospital-Research Institute, Lodz, Poland.
Abstract
The purpose of this investigation was the determination of the distribution of genotypes and alleles, residing within interleukin 6 (IL6) and interleukin 1 (IL1) polymorphisms, among fetuses and neonates, congenitally infected with Toxoplasma gondii, and among uninfected control cases. The study included 22 fetuses and newborns infected with T. gondii and 49 control cases. Screening for IgG and IgM antibodies against the parasite and IgG avidity was performed by enzyme-linked fluorescent assay (ELFA) tests. Quantitation of T. gondii DNA in amniotic fluids was assayed by the real-time Q PCR technique for the parasitic B1 gene. Genotypes at IL6 and IL1 single nucleotide polymorphisms (SNPs) were determined by a self-designed, nested polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) assay. Representative genotypes at the studied loci were confirmed by sequencing. All the genotypes were estimated for Hardy-Weinberg equilibrium and IL1 genotypes were tested for linkage disequilibrium. Genotypes and haplotypes at the studied SNPs were investigated for their possible association with the occurrence of congenital T. gondii infection, using a logistic regression model. GC heterozygotes at the IL6 -174 G>C SNP were significantly associated with toxoplasmosis and increased the risk of T. gondii infection [odds ratio (OR) 4.24, 95 % confidence interval (CI) 1.24-14.50 in the codominant model, p ≤ 0.050]. In case of IL1 SNPs, similar prevalence rates were observed between T. gondii-infected and -uninfected offspring. Regarding allelic variability, the C alleles at both IL6 and IL1B SNPs were significantly more frequent in the infected than in the uninfected cases (p ≤ 0.050). It is concluded that IL6 -174 G>C and IL1B +3954 C>T SNPs might be involved in the development of congenital T. gondii infection.
The purpose of this investigation was the determination of the distribution of genotypes and alleles, residing within interleukin 6 (IL6) and interleukin 1 (IL1) polymorphisms, among fetuses and neonates, congenitally infected with Toxoplasma gondii, and among uninfected control cases. The study included 22 fetuses and newborns infected with T. gondii and 49 control cases. Screening for IgG and IgM antibodies against the parasite and IgG avidity was performed by enzyme-linked fluorescent assay (ELFA) tests. Quantitation of T. gondii DNA in amniotic fluids was assayed by the real-time Q PCR technique for the parasitic B1 gene. Genotypes at IL6 and IL1 single nucleotide polymorphisms (SNPs) were determined by a self-designed, nested polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) assay. Representative genotypes at the studied loci were confirmed by sequencing. All the genotypes were estimated for Hardy-Weinberg equilibrium and IL1 genotypes were tested for linkage disequilibrium. Genotypes and haplotypes at the studied SNPs were investigated for their possible association with the occurrence of congenital T. gondii infection, using a logistic regression model. GC heterozygotes at the IL6 -174 G>C SNP were significantly associated with toxoplasmosis and increased the risk of T. gondii infection [odds ratio (OR) 4.24, 95 % confidence interval (CI) 1.24-14.50 in the codominant model, p ≤ 0.050]. In case of IL1 SNPs, similar prevalence rates were observed between T. gondii-infected and -uninfected offspring. Regarding allelic variability, the C alleles at both IL6 and IL1B SNPs were significantly more frequent in the infected than in the uninfected cases (p ≤ 0.050). It is concluded that IL6 -174 G>C and IL1B +3954 C>T SNPs might be involved in the development of congenital T. gondii infection.
Toxoplasma gondii is one of the most common intrauterine infections worldwide and the major cause of perinatal morbidity and mortality [1-4]. Congenital infections with T. gondii are diagnosed in about 0.07–2.9 % of live newborns, leading to asymptomatic as well as symptomatic disease, sometimes with fatal course [1, 5, 6].Considering the immune response against T. gondii, several studies have shown the role of proinflammatory cytokines, including interleukin (IL) 6 and IL1 [7-9]. Among women infected with T. gondii, IL6 expression was estimated to be twice as high compared to the control cases [10]. In another study, the development of toxoplasmosis-related ocular lesions among T. gondii-infectedpatients was reported to be associated with high IL1 and TNF-α levels [11]. In turn, the mice with more severe inflammation in the retina and vitreous humor, related to ocular toxoplasmosis, had a reduced expression of ocular IL1A and an increased production of TNFA mRNA as compared to WT mice [12]. In an in vitro study, the human monocytic wild-type MonoMac6 cells, infected with T. gondii, showed significantly higher levels of IL-1β as compared to non-infected cells [13]. Considering a possible participation of the genetic alterations, located at IL1 and IL6 molecule encoding genes, the −174 G>C single nucleotide polymorphism (SNP) from the IL6 gene was reported to be correlated with toxoplasmic retinochoroiditis (TR) [14]. The prevalence rates of genotypes and alleles at the IL6 −174 G>C SNP differed significantly between the patients with TR and the healthy blood donors with positive serology for T. gondii infection and without retinal symptoms of the previous disease [14]. In turn, another study reported no correlation of either IL1A −889 C>T or IL1B C>T SNPs with the occurrence of TR [15]. However, distinct differences in the distribution of genotypes and alleles at the IL1A SNP were observed between patients with and without recurrent episodes of the disease [15]. So far, no study has been performed to seek for a possible involvement of IL1 and IL6 SNPs in the development of congenital infection with T. gondii.In the reported study, we aimed to analyze and describe a possible influence of the polymorphisms located at the IL1A, IL1B, and IL6 genes on the occurrence of congenital T. gondii infection in fetuses and neonates. The haplotype prevalence rates were also estimated for IL1 SNPs. A multiple-SNP analysis was performed to estimate the assumed simultaneous influence of IL1 and IL6 SNPs on the occurrence of the disease.
Materials and methods
The study included 22 fetuses congenitally infected with T. gondii and 49 uninfected control cases, from which samples were retrospectively (16 infected cases and 25 controls) as well as prospectively (six infected cases and 24 controls) collected. The fetal and neonatal specimens were obtained from the offspring of pregnant women treated at the Department of Fetal-Maternal Medicine and Gynecology at the Polish Mother’s Memorial Hospital—Research Institute in Lodz, between the years 2000 and 2014. Clinical samples, selected for genetic studies, consisted of fetal amniotic fluids, obtained via amniocentesis from pregnant women, and/or cerebrospinal fluids (six samples), as well as umbilical cord blood specimens (two samples). The intrauterine infections with T. gondii were determined from maternal serological features of the recent infection and by the clinical picture, including flu-like symptoms, as well as by fetal and neonatal ultrasound markers associated with toxoplasmosis. The congenital infections with T. gondii were confirmed by the presence of parasitic DNA in fetal and neonatal body fluids. The research was approved by the Research Ethics Committee at the Polish Mother’s Memorial Hospital—Research Institute. All the samples, previously collected for diagnostic purposes, are anonymized in this report. Informed consent forms were signed by all the enrolled participants (pregnant women).
Serological tests
Blood specimens were collected from the pregnant women by venipuncture on their first visit to the hospital. Serum samples were obtained by centrifugation and then stored at 4 °C until analysis. Serological tests were performed at the hospital’s Department of Clinical Microbiology.Screening for T. gondii IgG antibodies was performed with the enzyme-linked fluorescent assay (ELFA) VIDAS TOXO IgG II (bioMérieux). The IgM antibodies were detected with the ELFA assay VIDAS TOXO IgM (bioMérieux). T. gondii IgG avidity was assayed by an ELFA assay VIDAS TOXO IgG AVIDITY (bioMérieux). The pregnant women were diagnosed as recently infected with T. gondii in case of seroconversion during pregnancy or were suspected to be infected in case of the infection-related serology including IgM seropositivity and low IgG avidity index. Fresh intrauterine T. gondii infections, possible in the studied pregnant women, were confirmed by real-time Q PCR assays for the parasitic B1 gene fragments, performed on body fluid specimens of their offspring.
DNA extraction
Fetal genomic DNA was extracted from 5-mL amniotic fluid volumes or 3-mL cerebrospinal fluid volumes, and neonatal DNA was extracted from 200 μL of umbilical cord blood specimens, using a High Pure PCR Template Preparation Kit (Roche™, Mannheim, Germany). The obtained DNA was diluted in 100 μL of elution buffer and stored at −20 °C until further molecular analyses.
Detection and quantification of T. gondii loads
The amount of T. gondii DNA was quantified by a real-time (RT) Q PCR assay for the detection of parasitic B1 gene fragment of 83 bps in length. Forward and reverse primers and TaqMan MGB probe sequences were as follows: 5′-CAAGCAGCGTATTGTCGAGTAGAT-3′, 5′-GCGTCTCTTTCATTCCCACATTTT-3′, and 5′-6-FAM- CAGAAAGGAACTGCATCCGTT-NFQ-3′, respectively [16]. The reactions were prepared in final 25-μL volumes, as described previously [17].
Determination of SNPs located within IL1 and IL6 genes
IL1A −889 C>T, IL1B +3954 C>T, and IL6 −174 G>C SNPs were genotyped, using self-designed nested polymerase chain reaction (PCR) assays. The used external and internal primer sequences, amplicon lengths, and annealing temperatures are shown in Table 1. External primer sequences were developed using the Vector NTI Suite 5.5 software, while the internal primers were based on published data [14, 18–21]. The amplifications were performed with a HotStarTaq® Master Mix Kit (Qiagen, Hilden, Germany). The PCR conditions were as follows: an initial activation for 15 min at 95 °C and for 40 cycles of repeated denaturation at 94 °C for 30 s, annealing at temperatures designed for the used primer pairs (see Table 1), for 1 min, and extension at 72 °C for 2 min, and a final extension at 72 °C for 10 min. The nested PCR products were resolved on 1 % agarose gels, stained with ethidium bromide, and then digested overnight with NcoI, TaqI, and Hsp92II endonucleases, used to determine genotypes at IL1A −889 C>T, IL1B +3954 C>T, and IL6 −174 G>C SNPs, respectively (see Table 2). The products of digestion reactions were resolved on 2 % agarose gels. Genotypes were determined at the analyzed polymorphic sites by the length of restriction fragments, as described previously ([14, 18–21]; see Table 2, Fig. 1). The randomly selected PCR products, including the analyzed SNPs, were then verified by sequencing according to the Sanger method. In case of IL1A and IL1B SNPs, the sequencing was performed for seven and nine CC homozygotes, four and five CT heterozygotes, as well as for three and one TT homozygotes, respectively. Regarding the IL6 SNP, sequencing was done for five GG homozygotes, five GC heterozygotes, and 12 CC homozygotes. Examples of chromatograms with DNA sequences of distinct genotypes at the studied polymorphisms are shown in Figs. 2 and 3. The sequenced and referenced DNA regions were compared using the BLASTN program for alignment of two (or more) sequences. The chromatograms were read out using the Sequence Scanner 1.0 and Chromas Lite 2.1.1 softwares.
Table 1
Primer sequences, annealing temperatures, and amplicon lengths obtained in the nested polymerase chain reaction (PCR) assays for IL1A, IL1B, and IL6 polymorphisms
Gene
GenBank accession no.
SNP name
Primer sequences (5′–3′)
Annealing temperature (°C)
Amplicon length (bps)
IL1A
NC_000002
−889 C>T (rs1800587)
External
For: AAACAGGAACAGAGGGAATACTT
52
485
Rev: CTGTAGAAGAAGGTGTGTGCAAG
Internal
For: GGGGGCTTCACTATGTTGCCCACACTGGACTAA
57
309
Rev: GAAGGCATGGATTTTTACATATGACCTTCCATG
IL1B
NC_000002
+3954 C>T (rs1143634)
External
For: GTAATAGACCTGAAGCTGGAACC
52
383
Rev: CCATTTACCTTGTTGCTCCATA
Internal
For: GTTGTCATCAGACTTTGACC
59
249
Rev: TTCAGTTCATATGGACCAGA
IL6
NC_000007
−174 G>C (rs1800795)
External
For: GAAGTAACTGCACGAAATTTGAG
52
543
Rev: GATAAATCTTTGTTGGAGGGTGA
Internal
For: CAGAAGAACTCAGATGACTG
58
431
Rev: GTGGGGCTGATTGGAAACC
No. number; SNP single nucleotide polymorphism; bps base pairs
Table 2
Length of restriction fragments and genotypic profiles at IL1 and IL6 polymorphisms
IL SNP
Restriction enzyme
Profile (bps)
IL1A −889 C>T
NcoI
CC: 266, 43
CT: 309, 266, 43
TT: 309
IL1B +3954 C>T
TaqI
CC: 135, 114
CT: 249, 135, 114
TT: 249
IL6 −174 G>C
Hsp92II
GG: 229, 173, 29
GC: 229, 173, 122, 51, 29
CC: 229, 122, 51, 29
SNP single nucleotide polymorphism; bps base pairs
Fig. 1
Agarose gel electrophoresis of polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) products for distinct genotypes at IL1A −889 C>T single nucleotide polymorphism (SNP) (a), IL1B +3954 C>T SNP (b), and IL6 −174 G>C SNP (c). DNA fragments, obtained by the restriction analyses with NcoI (a), TaqI (b), and Hsp92II (c) endonucleases, were resolved in 2 % agarose gels, stained with ethidium bromide. The numbers on the right indicate the size of separated DNA fragments. M 50-bp DNA marker; Ud undigested PCR product; CC, CT, TT, GG, GC, CC genotypes at the studied IL polymorphisms
Fig. 2
DNA sequences, containing IL1A −889 C>T SNP (a, b, c) and IL1B +3954 C>T SNP (d, e, f). DNA forward strands were sequenced for all the analyzed SNPs. CC, CT, TT genotypes at the described IL1 SNP
Fig. 3
Chromatograms of DNA sequences, comprising IL6 −174 G>C SNP (a, b, c). DNA forward strands were sequenced for all the analyzed SNPs. GG, GC, or CC genotypes at the described IL6 SNP
Primer sequences, annealing temperatures, and amplicon lengths obtained in the nested polymerase chain reaction (PCR) assays for IL1A, IL1B, and IL6 polymorphismsNo. number; SNP single nucleotide polymorphism; bps base pairsLength of restriction fragments and genotypic profiles at IL1 and IL6 polymorphismsSNP single nucleotide polymorphism; bps base pairsAgarose gel electrophoresis of polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) products for distinct genotypes at IL1A −889 C>T single nucleotide polymorphism (SNP) (a), IL1B +3954 C>T SNP (b), and IL6 −174 G>C SNP (c). DNA fragments, obtained by the restriction analyses with NcoI (a), TaqI (b), and Hsp92II (c) endonucleases, were resolved in 2 % agarose gels, stained with ethidium bromide. The numbers on the right indicate the size of separated DNA fragments. M 50-bp DNA marker; Ud undigested PCR product; CC, CT, TT, GG, GC, CC genotypes at the studied IL polymorphismsDNA sequences, containing IL1A −889 C>T SNP (a, b, c) and IL1B +3954 C>T SNP (d, e, f). DNA forward strands were sequenced for all the analyzed SNPs. CC, CT, TT genotypes at the described IL1 SNPChromatograms of DNA sequences, comprising IL6 −174 G>C SNP (a, b, c). DNA forward strands were sequenced for all the analyzed SNPs. GG, GC, or CC genotypes at the described IL6 SNP
Statistical analysis
The prevalence rates of genotypes and alleles at the IL1 and IL6 polymorphisms in the infected and uninfected fetuses and neonates were estimated by means of descriptive statistics. The analyzed groups of patients were studied for the Hardy–Weinberg (H-W) equilibrium, the linkage disequilibrium (LD), and haplotypes, using the SNPStats software (http://bioinfo.iconcologia.net/en/SNPStats_web). The correlation of the genotypes, alleles, or haplotypes at IL SNPs with the development of congenital T. gondii infections was determined by cross-tabulation, Pearson’s Chi-squared, as well as by the logistic regression model. The analysis of haplotypes at IL1 SNPs and the multiple-SNP analysis were carried out by the expectation–maximization (EM) algorithm. The study results were estimated as being statistically significant when the significance level was p ≤ 0.050. The statistical analysis was, in part, supported by the NCSS 97 software.
The genotypes at all the analyzed polymorphic sites preserved the H-W equilibrium in the fetuses and neonates infected with T. gondii (p = 0.081, p = 0.430, and p = 0.680, for IL1A −889 C>T, IL1B +3954 C>T, and IL6 −174 G>C SNPs, respectively). Taking into account the control cases, the genotypes at IL1B +3954 C>T were in H-W equilibrium (p = 0.150), while the variants at IL1A −889 C>T and IL6 −174 G>C were not (p ≤ 0.050). IL1A −889 C>T and IL1B +3954 C>T SNPs were seen in LD between the infected and the control groups of patients (p ≤ 0.050).
Prevalence rates of the genotypes at IL1A, IL1B, and IL6 SNPs
In the offspring infected with T. gondii, the prevalence rates of CC, CT, and TT genotypes at IL1A −889 C>T/IL1B C>T SNPs were 63.6 % (14/22)/72.7 % (16/22), 22.7 % (5/22)/22.7 % (5/22), and 13.6 % (3/22)/4.5 % (1/22), respectively (see Table 3). Among the control cases, the prevalence rates of the analyzed variants were 51.0 % (25/49)/57.1 % (28/49), 26.5 % (13/49)/30.6 % (15/49), and 22.4 % (11/49)/12.2 % (6/49), respectively. Taking into account the IL6 −174 G>C SNP, GG, GC, and CC genotypes were carried by 27.3 % (6/22), 45.5 % (10/22), and 27.3 % (6/22) of the infected offspring, respectively. In control cases, the prevalence rates of GG, GC, and CC variants at the IL6 SNP were 57.1 % (28/49), 22.4 % (11/49), and 20.4 % (10/49), respectively. Considering the IL6 SNP, the GC heterozygotes were significantly associated with toxoplasmosis and increased the risk of T. gondii infection [odds ratio (OR) 4.24, 95 % confidence interval (CI) 1.24–14.50 in the codominant model, and OR 3.56, 95 % CI 1.19–10.64 for GC and CC genotypes in the dominant model; p ≤ 0.050; see Table 3]. Regarding the IL1A and IL1B SNPs, the observed genotypes were distributed similarly between the infected and uninfected offspring. Neither the haplotype analysis performed for IL1 SNPs nor the multiple-SNP analysis for all the analyzed polymorphisms showed any differences in the prevalence rates of distinct variants between the studied groups.
Table 3
Single-SNP analysis of the relationship between genotypes at the IL1 and IL6 polymorphisms and the occurrence of congenital Toxoplasma gondii infection
Gene polymorphism
Genetic model
Genotype
Genotype prevalence rates, n (%)
OR (95 % CI)
p-Valuea
Infected cases
Controls
IL1A −889 C>T
Codominant
CC
14 (63.6 %)
25 (51.0 %)
1.00
0.560
CT
5 (22.7 %)
13 (26.5 %)
0.69 (0.20–2.33)
TT
3 (13.6 %)
11 (22.4 %)
0.49 (0.12–2.04)
Dominant
CC
14 (63.6 %)
25 (51.0 %)
1.00
0.320
CT-TT
8 (36.4 %)
24 (49.0 %)
0.60 (0.21–1.67)
Recessive
CC-CT
19 (86.4 %)
38 (77.5 %)
1.00
0.380
TT
3 (13.6 %)
11 (22.4 %)
0.55 (0.14–2.19)
Overdominant
CC-TT
17 (77.3 %)
36 (73.5 %)
1.00
0.730
CT
5 (22.7 %)
13 (26.5 %)
0.81 (0.25–2.66)
IL1B +3954 C>T
Codominant
CC
16 (72.7 %)
28 (57.1 %)
1.00
0.370
CT
5 (22.7 %)
15 (30.6 %)
0.58 (0.18–1.91)
TT
1 (4.5 %)
6 (12.2 %)
0.29 (0.03–2.64)
Dominant
CC
16 (72.7 %)
28 (57.1 %)
1.00
0.200
CT-TT
6 (27.3 %)
21 (42.9 %)
0.50 (0.17–1.50)
Recessive
CC-CT
21 (95.5 %)
43 (87.8 %)
1.00
0.280
TT
1 (4.5 %)
6 (12.2 %)
0.34 (0.04–3.02)
Overdominant
CC-TT
17 (77.3 %)
34 (69.4 %)
1.00
0.490
CT
5 (22.7 %)
15 (30.6 %)
0.67 (0.21–2.14)
IL6 −174 G>C
Codominant
GG
6 (27.3 %)
28 (57.1 %)
1.00
≤0.050
GC
10 (45.5 %)
11 (22.4 %)
4.24 (1.24–14.50)
CC
6 (27.3 %)
10 (20.4 %)
2.80 (0.73–10.72)
Dominant
GG
6 (27.3 %)
28 (57.1 %)
1.00
≤0.050
GC-CC
16 (72.7 %)
21 (42.9 %)
3.56 (1.19–10.64)
Recessive
GG-GC
16 (72.7 %)
39 (79.6 %)
1.00
0.530
CC
6 (27.3 %)
10 (20.4 %)
1.46 (0.46–4.70)
Overdominant
GG-CC
12 (54.5 %)
38 (77.5 %)
1.00
0.054
GC
10 (45.5 %)
11 (22.4 %)
2.88 (0.98–8.43)
p ≤ 0.050 is considered significant
n number of tested fetuses and newborns; OR odds ratio; CI confidence interval
aLogistic regression model
Single-SNP analysis of the relationship between genotypes at the IL1 and IL6 polymorphisms and the occurrence of congenital Toxoplasma gondii infectionp ≤ 0.050 is considered significantn number of tested fetuses and newborns; OR odds ratio; CI confidence intervalaLogistic regression model
Distribution of the alleles at IL1 and IL6 SNPs
Among the infected fetuses and neonates, the prevalence rates of C and T alleles at IL1A/IL1B SNPs were 75.0 % (33/44)/84.1 % (37/44) and 25.0 % (11/44)/15.9 % (7/44), respectively (see Table 4). In case of the uninfected patients, the analyzed alleles were found in 64.3 % (63/98)/72.4 % (71/98) and 35.7 % (35/98)/27.6 % (27/98) of the offspring, respectively. Taking into account the IL6 SNP, the G and C alleles were identified in 50 % (22/44) of the infected cases for each allele. In the uninfected controls, the prevalence rates of G and C alleles were 68.4 % (67/98) and 31.6 % (31/98), respectively. A cross-tabulation analysis showed that alleles at the IL1A polymorphic site were similarly distributed between T. gondii-infected and -uninfected fetuses and neonates (see Table 4). In case of the IL1B SNP, the major C allele was significantly more frequent among the infected than among the uninfected offspring (χ2 = 7, p ≤ 0.050; Fisher’s exact test). Considering the IL6 SNP, the minor C allele was significantly more frequent among the infected versus the uninfected cases (χ2 = 4, p ≤ 0.050; Fisher’s exact test).
Table 4
Distribution of the alleles located at the IL1 and IL6 SNPs
Gene polymorphisms and alleles
No. of carriers with IL alleles (%)
p-Value
Infected cases
Controls
IL1A −889 C>T
C
33 (75.0)
63 (64.3)
0.207a
T
11 (25.0)
35 (35.7)
IL1B +3954 C>T
C
37 (84.1)
71 (72.4)
≤0.050b
T
7 (15.9)
27 (27.6)
IL6 −174 G>C
G
22 (50.0 %)
67 (68.4 %)
≤0.050b
C
22 (50.0 %)
31 (31.6 %)
p ≤ 0.050 is considered significant
No. number
aPearson’s Chi-squared test
bFisher’s exact test
Distribution of the alleles located at the IL1 and IL6 SNPsp ≤ 0.050 is considered significantNo. numberaPearson’s Chi-squared testbFisher’s exact test
Discussion
In our study, we found that infants and neonates with GC genotypes at the IL6 −174 G>C SNP were at an approximately four times higher risk of congenital infection with T. gondii as compared to GG and CC homozygotes. Moreover, the minor C allele at the studied locus was significantly more prevalent among the infected than in the uninfected offspring. Regarding T. gondii infections, only one previous study, performed for patients with TR and control cases, reported the role of the IL6 −174 G>C polymorphism for the occurrence of disease [14]. Similarly to our results, the prevalence rates of distinct genotypes at the analyzed IL6 locus were significantly different between the study groups of patients and control cases. In patients with TR, the GC heterozygotic status at the SNP was estimated to be correlated to occurrence of the disease as well [14]. The significantly higher prevalence rate of the C allele versus the G allele observed in our study among the T. gondii-infected offspring as compared to the control cases was also estimated for TR patients [14]. Previously, the IL6 −174 G>C polymorphism was determined as being associated with altered expression levels of the encoded cytokine as well [22-24]. Studies on the role of the IL6 −174 G>C SNP in RSV-infected macrophages showed GC heterozygotes and CC homozygotes as high IL6 production genotypes, correlated with the infection, while among RSV-infectedpatients, the CC genotype at the analyzed SNP was associated with low IL6 levels [22, 23]. Taking into account the papers reporting increased IL6 levels to be correlated with T. gondii infection in various patient groups, it seems possible that the GC heterozygotic status at the IL6 −174 G>C SNP may alter the immune response against the parasite through higher IL6 cytokine production. However, a detailed description of IL6 molecular changes, possibly associated with congenital toxoplasmosis development, would be a challenge. So far, the C allele at the IL6 −174G>C SNP was reported to generate new binding sites for NF-1 and Smad4 transcription factors, which are not observed in the presence of the G allele [25, 26]. In addition, a variable AnTn tract, located at the nucleotides from −392 up to −373 within the IL6 gene promoter, was also reported to affect the transcription of −174 G allele and −174 C allele-related haplotypes [27].According to genetic modifications localized in IL1 genes, we found the major C allele at the IL1B +3954 C>T SNP to be significantly more frequent among the fetuses and neonates with congenital T. gondii infection than among the uninfected cases. So far, several studies showed some involvement of the proinflammatory IL1β cytokine in an immune response after T. gondii infection, although the results are ambiguous [8, 11, 28]. Taking into account IL1 polymorphisms, a previous study in TR patients showed, likewise to our outcomes, similar distributions of the genotypes and, in addition, of the alleles at the analyzed IL1A −889 C>T and IL1B +3954 C>T SNPs in patients with TR and in control cases [15]. The outcomes obtained in our study may suggest that the presence of mutated T allele at the analyzed IL1B SNP plays a protective function against the development of congenital toxoplasmosis. However, the mechanism of the role of the IL1B3954 C>T SNP should be investigated in a detailed molecular study.Considering our outcomes, as presented in this paper, the GC heterozygotic status at the IL6 −174 G>C SNP, as well as the presence of C alleles at both IL6 and IL1B +3954 C>T SNPs, seems to have been involved in the occurrence of congenital toxoplasmosis in the studied fetuses and neonates. So far, several studies have shown some contribution of the encoded IL6 and IL1β cytokines to immune responses against T. gondii, although no such research has been performed for congenital toxoplasmosis. In case of IL6, the GC heterozygotic status at the −174 G>C SNP was determined to be correlated with TR development, while no such relationship was observed for either the IL1A −889 C>T or IL1B +3954 C>T SNPs. Based on our outcomes, we suggest a possible contribution of GC heterozygotic status at the IL6 −174 G>C SNP to the immune response efficacy against congenital T. gondii infection via an increased synthesis of the IL6 cytokine, whereas the T allele at the IL1B +3954 C>T SNP might be protective against the infection. Although the character of observed genetic changes is suggestive of their effective relationship with congenital toxoplasmosis, a detailed further mechanistic research should be undertaken to investigate the hypothesis in detail. We also suggest that further studies on the role of IL6 and IL1 SNPs, performed with larger groups of patients with congenital toxoplasmosis, would be beneficial to verify our results.
Authors: J H Yamamoto; A L Vallochi; C Silveira; J K Filho; R B Nussenblatt; E Cunha-Neto; R T Gazzinelli; R Belfort; L V Rizzo Journal: J Infect Dis Date: 2000-06-05 Impact factor: 5.226
Authors: Bernhard Schaaf; Jan Rupp; Michael Müller-Steinhardt; Jan Kruse; Florian Boehmke; Matthias Maass; Peter Zabel; Klaus Dalhoff Journal: Cytokine Date: 2005-08-21 Impact factor: 3.861
Authors: W Klein; A Tromm; T Griga; H Fricke; C Folwaczny; M Hocke; K Eitner; M Marx; J T Epplen Journal: Eur J Gastroenterol Hepatol Date: 2001-01 Impact factor: 2.566
Authors: C A Naranjo-Galvis; A de-la-Torre; L E Mantilla-Muriel; L Beltrán-Angarita; X Elcoroaristizabal-Martín; R McLeod; N Alliey-Rodriguez; I J Begeman; C López de Mesa; J E Gómez-Marín; J C Sepúlveda-Arias Journal: Infect Immun Date: 2018-03-22 Impact factor: 3.441