Literature DB >> 26380638

High quality draft genome sequence of Corynebacterium ulceribovis type strain IMMIB-L1395(T) (DSM 45146(T)).

Atteyet F Yassin1, Alla Lapidus2, James Han3, T B K Reddy3, Marcel Huntemann3, Amrita Pati3, Natalia Ivanova3, Victor Markowitz4, Tanja Woyke3, Hans-Peter Klenk5, Nikos C Kyrpides6.   

Abstract

Corynebacterium ulceribovis strain IMMIB L-1395(T) (= DSM 45146(T)) is an aerobic to facultative anaerobic, Gram-positive, non-spore-forming, non-motile rod-shaped bacterium that was isolated from the skin of the udder of a cow, in Schleswig Holstein, Germany. The cell wall of C. ulceribovis contains corynemycolic acids. The cellular fatty acids are those described for the genus Corynebacterium, but tuberculostearic acid is not present. Here we describe the features of C. ulceribovis strain IMMIB L-1395(T), together with genome sequence information and its annotation. The 2,300,451 bp long genome containing 2,104 protein-coding genes and 54 RNA-encoding genes and is part of the Genomic Encyclopedia of Type Strains, Phase I: the one thousand microbial genomes (KMG) project.

Entities:  

Keywords:  Actinobacteria; Bovine skin; Corynebacteriaceae; GEBA; Gram-positive

Year:  2015        PMID: 26380638      PMCID: PMC4572677          DOI: 10.1186/s40793-015-0036-7

Source DB:  PubMed          Journal:  Stand Genomic Sci        ISSN: 1944-3277


Introduction

IMMIB L-1395T (= DSM 45146 = CCUG 55727) was first isolated from the skin of the udder of a cow with a profound ulceration [1]. The classification and identification of this species was based on chemotaxonomic traits and biochemical tests, which were supplemented by 16S rRNA gene phylogentic assessments. Since then, there have been neither reported cases associating strains of with animal infections nor has there been documented cases of its isolation in humans. Although members of the genus are generally regarded as commensal skin colonizer in humans and animals, e.g. , , , , and [2-4], the question remains unanswered whether to consider as belonging to the resident or transient microbes of bovine skin. Therefore, the veterinary medical importance of C. ulcerobovis is unclear and remains to be assessed. Here we present a summary classification and a set of features for IMMIB-L1395T together with the description of the complete genomic sequencing and annotation of DSM 45146T providing insights into candidate genes involved in some basic biological processes.

Organism information

Classification and features

Following the published hierarchial classification of [5, 6], belongs to the genus of the family , one of six suprageneric taxa included in the suborder of the order of the subclass of the class .

Morphology and physiology

Surface colonies of IMMIB L-1395T grown on Columbia blood agar supplemented with 5 % sheep blood (BD; Beckton, Dickenson) are circular (2.0-4.0 mm in diameter), gray, opaque, non-hemolytic and entire edged after 48 h of incubation at 37 °C in a 5 % CO2 atmosphere. Cells are Gram-stain positive, nonmotile and non-spore-forming. The cells appear as slender, irregular rods (0.5 × 1.16 μm), which upon extended incubation become granular and segmented and resemble small irregular cocci (0.59 μm in diameter). The cocci are usually arranged singly (Fig. 1). Optimum growth temperature is 37 °C. The organism is facultatively anaerobic and catalase-positive. Nitrate is not reduced to nitrite, gelatin is not liquified and esculin hydrolysis is negative. Hippurate and Tween 80 are hydrolysed. Acid and alkaline phosphatases, esterase lipase (C8), leucine arylamidase, pyrazinamidase and naphthol-AS-BI-phosphohydrolase are detected in the API ZYM (bioMériux) gallery, while no activity is detected for arginine dihydrolase, chymotrypsin, cysteine arylamidase, esterase (C4), α-fucosidase, α-galactosidase, β-galactosidase, β-glucuronidase, α-glucosidase, β-glucosidase, N-acetyl-β-glucosaminidase, lipase (C14), α-mannosidase, pyrrolidonyl arylamidase, trypsin or valine arylamidase. The organism is susceptible to ampicillin (2 μg), penicillin (1 unit), imipenem (10 μg), ciprofloxacin (5 μg), moxifloxacin (5 μg), cefoxitin (30 μg), gentamicin (10 μg), clindamycin (2 μg), erythromycin (15 μg), rifampicin (5 μg), tigecycline (15 μg) and vancomycin (5 μg); all data from [1]. A summary of the classification and general features of strain IMMIB L-1395T is presented in Table 1.
Fig. 1

Transmission electron micrograph showing cells of C. ulceribovis IMMIB L-1395T. Cells are rod-shaped, which upon extended incubation, divide in spherical form. The cocci are arranged singly

Table 1

Classification and general features of C. ulceribovis IMMIB L-1395T in accordance with the MIGS recommendations [127] published by the Genomic Standards Consortium [128]

MIGS IDPropertyTermEvidence code
Current classificationDomain Bacteria TAS [129]
Phylum Actinobacteria TAS [5]
Class Actinobacteria TAS [5]
Order Actinomycetales TAS [5]
Family Corynebacteriaceae TAS [6]
Genus Corynebacterium TAS [130]
Species Corynebacteriu ulceribovis TAS [1]
Type strain : IMMIB-L1395TTAS [1]
Gram stainPositiveTAS [1]
Cell shapeRodTAS [1]
MotilityNon-motileTAS [1]
SporulationNon-sporulatingTAS [1]
Temperature rangeMesophileTAS [1]
Optimum temperature37 °CTAS [1]
pH Range; Optimum6.8-8.0; 7.3TAS [1]
Carbon sourceGlucoseTAS [1]
Energy sourceChemoorganotrophTAS [1]
MIGS-6HabitatSkin, HostTAS [1]
MIGS-6.3SalinityNot reported
MIGS-22Oxygen requirementAerobic-facultative anaerobicTAS [1]
MIGS-15Biotic relationshipFree livingTAS [1]
MIGS-14PathogenicityUnknownNAS
MIGS-4Geographic locationSchleswig Holstein, GermanyTAS [1]
MIGS-5Sample collection date1996TAS [1]
MIGS-4.1Latitude9.588IDA, TAS [1]
MIGS-4.2Longitude54.209IDA, TAS [1]
MIGS-4.3DepthNot recorded
MIGS-4.4AltitudeNot recorded

Evidence codes – IDA: Inferred from Direct Assay; TAS: Traceable Author Statement (i.e., a direct report exists in the literature); NAS: Non-traceable Author Statement (i.e., not directly observed for the living, isolated sample, but based on a generally accepted property for the species, or anecdotal evidence). These evidence codes are from the Gene Ontology project [126]

Transmission electron micrograph showing cells of C. ulceribovis IMMIB L-1395T. Cells are rod-shaped, which upon extended incubation, divide in spherical form. The cocci are arranged singly Classification and general features of C. ulceribovis IMMIB L-1395T in accordance with the MIGS recommendations [127] published by the Genomic Standards Consortium [128] Evidence codes – IDA: Inferred from Direct Assay; TAS: Traceable Author Statement (i.e., a direct report exists in the literature); NAS: Non-traceable Author Statement (i.e., not directly observed for the living, isolated sample, but based on a generally accepted property for the species, or anecdotal evidence). These evidence codes are from the Gene Ontology project [126]

Chemotaxonomy

has cell-wall chemotype IV, which includes the presence of meso-diaminopimelate (meso-DAP), arabinose and galacose. Corynemycolic acids are present. The major cellular fatty acids are palmitic (C16 : 0) and oleic (C18 : 1ω9c) acids, which constitute more than 95 % of the total fatty acids content. Tuberculostearic acid is not present [1]. The G + C content calculated from the genome draft sequence is 59.2 mol%. No information is available on the poar lipid or respiratory lipoquinone composition.

16S rRNA gene analysis and phylogeny

Phylogenetic analyses were performed using the ARB-package [7]. Evolutionary distances were calculated using the Jukes-Cantor method [8]. Phylogenetic trees were generated by maximum-parsimony (ARB_PARS), neighbour-joining and maximum-likelihood (RAxML; [9]) facilities as implemented in the ARB package. Topologies of the neighbour-joining tree were evaluated using bootstrap analyses [10] based on 500 resamplings. The sequence of the single 16S rRNA gene copy (1397 nucleotides) in the genome of DSM 45146T was added to the ARB database [7] and compared with the 16S rRNA gene sequences of the type strains of species obtained from the NCBI database. This sequence does not differ from the previously published 16S rRNA sequence (AM922112). The highest-scoring sequence of a neighboring species was (HE983829) reported for the type strain of DSM 45799T, which showed a similarity of 96.5 %. Figure 2 shows the phylogenetic position of DSM 45146T within the genus in a 16S rRNA based tree. It is evident from the tree that DSM 45146T together with , , , , , and constitute a distinct monophyletic group within the genus . The clustering of this group of species was also observed in recent study of the phylogeny of the 16S rRNA gene in [11]. The coherency of members of this clade was strongly supported by 99 % bootstrap value and by sharing a distinct set of 16S rRNA signature nucleotides at positions: 131–231 (C-G) and 1308–1329 (C-G). At these positions all other Corynebactium species contain the pairs (U-A). Members of this subclade showed high 16S rRNA gene sequence similarities ranged between 95.3 % and 99.5 %.
Fig. 2

Maximum likelihood phylogenetic tree based on 16S rRNA gene sequences highlighting the position of C. ulceribovis DSM 45146T relative to the type strains of other Corynebacterium species. Numbers at the nodes are support values from 500 bootstrap replicates of >70 %. Bar, 1.0 % sequence divergence. The tree was generated using the ARB software package [7]

Maximum likelihood phylogenetic tree based on 16S rRNA gene sequences highlighting the position of C. ulceribovis DSM 45146T relative to the type strains of other Corynebacterium species. Numbers at the nodes are support values from 500 bootstrap replicates of >70 %. Bar, 1.0 % sequence divergence. The tree was generated using the ARB software package [7] To further study the phylogenetic relationship between and the type strains of some members of this subcluster such as and , whose genome sequences are available, we compared homologous proteins annotated as polyketide synthase (Pks13), fatty acid CoA ligase (FadD32), trehalose corynomycolyl transferase (CmtC) and acetyl coA carboxylase (AccD3), enzymes which form an integral part of the mycolic acid biosynthetic pathway. BLASTP analysis showed that the average amino acid identity between homologous pairs from , and was around 79 % for AccD3, 62 % for Pks13, 63 % for FadD32 and 49 % for CmtC. The phylogenetic trees constructed using the maximum likelihood and neighbor-joining methods based on this data set of protein sequences showed that , and clustered adjacent to each other within the genus (data not shown). Thus, one may hypothesize that this monophyletic group deserves to be recognized as the core of a new genus. However, expanded datasets are needed to affirm the phylogenetic relationship between members of this clade and better resolve the intrageneric relationship between them. In addition, further study will be required to identify synapomorphies to delineate this lineage before a taxonomic conclusion can be made.

Genome sequencing and annotation

Genome project history

The strain was selected for sequencing on the basis of its phylogenetic position [12, 13], and is part of the Genomic Encyclopedia of Type Strains, Phase I: the one thousand microbial genomes (KMG) project [14], a follow-up of the Genomic Encyclopedia of Bacteria and Archaea (GEBA) pilot project [15], which aims at increasing the sequencing coverage of key reference microbial genomes and to generate a large genomic basis for the discovery of genes encoding novel enzymes [16]. KMG-I is the first of the production phases of the “Genomic Encyclopedia of Bacteria and Archaea: sequencing a myriad of type strains initiative and a Genomic Standards Consortium project [17]. The genome project is deposited in the Genomes On Line Database [18] and the genome sequence is available from GenBank. Sequencing, finishing and annotation were performed by the DOE Joint Genome Institute (JGI) using state of the art sequencing technology [19]. A summary of the project information is presented in Table 2.
Table 2

Project information

MIGS IDPropertyTerm
MIGS-31Finishing qualityHigh-Guality Draft [131]
MIGS-28Libraries usedIllumina STD shotgun library
MIGS-29Sequencing platformsIllumina HiSeq2000
MIGS-31.2Fold coverage123.8 ×
MIGS-30AssemblersVelvet (version 1.1.04), ALLPATHS v. r41043
MIGS-32Gene calling methodProdigal 2.5
Locus TagA3EC
Genbank IDAQUY00000000
Genbank Date of ReleaseApril 19, 2013
GOLD IDGp0013740
BIOPROJECTPRJN165381
MIGS-13Source material identifierDSM 45146T
Project relevanceTree of Life, GEBA-KMG
Project information

Growth conditions and genomic DNA preparation

DSM 45146T, was grown in DSMZ medium 535a (Trypticase Soy Broth Agar + Blood) [20] at 37 °C. Genomic DNA was isolated using MasterPure Gram Positive DNA Purification Kit (Epicentre MGP04100) following the standard protocol provided by the manufacturer with the following modifications for the cell lysis solution: additional digest with 1 μl proteinase K (50 μg/μl), 7.5 μl achromopetidase (1 U/μl), 7.5 μl lysostaphin (1 U/μl), 3 μl lysozym (700 U/μl) and 7.5 μl mutanolysin (1 U/μl). Protein precipitation with 200 μl protein precipitation buffer (PPT) and incubation on ice over night followed by incubation (60 min, 37 °C) with 50 μl proteinase K. DNA is available through the DNA Bank Network [21].

Genome sequencing and assembly

The draft genome of DSM 45146T was generated using the Illumina technology [22]. An Illumina Std shotgun library was constructed and sequenced using the Illumina HiSeq 2000 platform which generated 17,830,172 reads totaling 2,674.5 Mbp. All general aspects of library construction and sequencing performed at the JGI can be found at [23]. All raw Illumina sequence data was passed through DUK, a filtering program developed at JGI, which removes known Illumina sequencing and library preparation artifacts [24]. The following steps were then performed for assembly: (1) filtered Illumina reads were assembled using Velvet (version 1.1.04) [25], (2) 1–3 Kbp simulated paired end reads were created from Velvet contigs using wgsim [26], (3) Illumina reads were assembled with simulated read pairs using Allpaths–LG (version r41043) [27]. Parameters for assembly steps were: 1) Velvet (velveth: 63 –shortPaired and velvetg: −very clean yes –export-Filtered yes –min contig lgth 500 –scaffolding no –cov cutoff 10) 2) wgsim (−e 0 –1 100 –2 100 –r 0 –R 0 –X 0) 3) Allpaths–LG (PrepareAllpathsInputs: PHRED 64 = 1 PLOIDY = 1 FRAG COVERAGE = 125 JUMP COVERAGE = 25 LONG JUMP COV = 50, RunAllpathsLG: THREADS = 8 RUN = std shredpairs TARGETS = standard VAPI WARN ONLY = True OVERWRITE = True). The final draft assembly contained 8 contigs in 8 scaffolds. The total size of the genome is 2.3 Mbp and the final assembly is based on 284.2 Mbp of Illumina data, which provides an average 123.8 × coverage of the genome.

Genome annotation

Genes were identified using Prodigal [28] as part of the DOE-JGI Annotation pipeline [29] followed by a round of manual curation using the JGI GenePRIMP pipeline [30]. The predicted CDSs were translated and used to search the National Center for Biotechnology Information non-redundant database, UniProt, TIGRFam, Pfam, PRIAM, KEGG, COG, and InterPro databases. Additional gene prediction analysis and functional annotation was performed within the Integrated Microbial Genomes [31].

Genome properties

The assembly of the draft genome sequence consists of eight scaffolds amounting to a 2,300,451 bp long chromosome with a GC content of approximately 59.2 % (Table 3 and Fig. 3). Of the 2,158 genes predicted, 2,104 were protein encoding and 54 RNA encoding genes. Within the genome, 22 pseudogenes were also identified. The majority of genes (73.45 %) were assigned a putative function whilst the remaining genes were annotated as hypothetical proteins. The distribution of genes into COGs functional categories is presented in Table 4.
Table 3

Genome statistics

AttributeValue% of total
Genome size (bp)2,300,451100.00
DNA coding region (bp)2,121,25892.21
DNA G + C content (bp)1,362,59959.23
DNA scaffolds8
Total genes2,158100.00
Protein-coding genes2,10497.50
RNA genes542.50
Pseudo genes221.02
Genes in internal clusters1537.09
Genes with function prediction (proteins)1,58573.45
Genes assigned to COGs1,36863.39
Genes with Pfam domains1,69378.45
Genes with signal peptides1336.16
Genes with transmembrane helices54125.07
CRISPR repeats2
Fig. 3

Graphical map of the largest scaffold of the genome. From bottom to the top: Genes on forward strand (color by COG categories), Genes on reverse strand (color by COG categories), RNA genes (tRNA green, rRNA red, other RNAs black), GC content, GC skew (purple/olive)

Table 4

Number of genes associated with general COG functional categories

CodeValue% of totala Description
J16110.76Translation, ribosomal, structure and biogenesis
A10.07RNA processing and modification
K825.48Transcription
L845.61Replication, recombination and repair
B10.07Chromatin structure and dynamics
D211.4Cell cycle control, Cell division; Chromosome partitioning
V342.27Defense mechanisms
T303.01Signal transduction mechanisms
M724.81Cell wall/membrane biogenesis
N40.27Cell motility
U191.27Intracellular trafficking and secretion
O694.61Posttranslational modification, protein turnover, chaperones
C996.62Energy production conversion
G1006.68Carbohydrate transport and metabolism
E1409.36Amino acid transport metabolism
F664.41Nucleotide transport and metabolism
H996.62Coenzyme transport and metabolism
I956.35Lipid transport and metabolism
P986.55Inorganic ion transport and metabolism
Q302.01Secondary metabolite biosynthesis, transport and catabolism
R1097.29General function prediction only
S614.08Function unknown
-79036.61Not in COGs

aThe total is based on the total number of protein-coding genes in the genome

Genome statistics Number of genes associated with general COG functional categories aThe total is based on the total number of protein-coding genes in the genome

Insights from the genome sequence

Insights into carbohydrate metabolism

As mentioned previously glucose was the primary carbohydrate utilized by . This sugar is likely to be imported into the cells by a homolog of the phosphoenolpyruvate (PEP): sugar phosphotransferase system (PTS), which is responsible for the transport and concomitant phosphorylation of various sugars across the cell membrane. Exploring the genome of revealed the presence of the genes encoding for the PTS proteins. These include the gene ptsI encoding for enzyme I ([EI], A3ECDRAFT_1792) and the gene ptsH encoding for the histidine carrier protein ([HPr], A3ECDRAFT_1795), as well as the gene ptsG encoding for the glucose-specific enzyme II ([EIIGlc], A3ECDRAFT_1683) and the gene ptsFru encoding for the fructose-specific enzyme II ([EIIFru], A3ECDRAFT_1794). A single copy of each of these genes was found within the genome of C. ulceribovis. The EI and HPr proteins lack sugar specificity and catalyze the transfer of phosphoryl groups from PEP to EIIs. EIIs are complex enzymes consisted of three protein domains, namely, IIA, IIB and IIC. IIA and IIB are phosphoryl transfer proteins of the PTS, whereas IIC is the actual sugar permease [32, 33]. The presence of the ptsG gene confirmed the ability of this organism to utilize glucose as source of carbon and energy. Besides the PTS, the genome of contains a set of genes predicted to encode a carbohydrate ABC transporter (A3ECDRAFT_0345 to A3ECDRAFT_0348), which belongs to the CUT1 family (TC 3.A.1.1-). This ABC transporter composed of two homologous genes encoding two permeases (A3ECDRAFT_0345 and A3ECDRAFT_0346), one encoding a substrate-binding protein (A3ECDRAFT_0347) and one encoding ATP-binding protein (A3ECDRAFT_0348). Members of the CUT1 family are known to transport diverse di- and oligosaccharides, glycerol, glycerol-phosphate and polyols [34]. However, the sugar transported by this ABC transporter remains to be determined in . The genes encoding this ABC transporter are located downstream from the genes encoding a two component system consisting of a sensor histidine kinase and a response regulator.

Central carbohydrate metabolism

The genes envolved in metabolic pathways were analyzed in detail using the information present in KEGG database [35]. It is apparent from inspection of the genome sequence of that the genome contains a complete set of genes coding for the enzymes of the central carbohydrate metabolism, including those that are used in glycolysis, gluconeogenesis, the pentose phosphate pathway (PPP) and the tricarboxylic acid cycle (TCA). The glycolytic enzymes catalyzing the three irreversible steps of glycolysis, glucokinase GCK ([EC:2.7.1.2]; A3ECDRAFT_1543), phosphofructokinase PFK ([EC:2.7.1.11]; A3ECDRAFT_0613) and pyruvate kinase PK ([EC:2.7.1.40], A3ECDRAFT_1959 and A3ECDRAFT_1661), were identified. The key gluconeogenic enzymes phosphoenolpyruvate carboxykinase PEP CK ([EC:4.1.1.32]; A3ECDRAFT_1920), which catalyzes the conversion of oxaloacetate to PEP; glyceraldehyde-3-phosphate dehydrogenase GAPDH ([EC:1.2.1.12]; A3ECDRAFT_0423 and A3ECDRAFT_0908), which catalyzes the conversion of 1,3-biphosphoglycerate to glyceraldehyde-3-phosphate; and fructose-1,6-biphosphatase GlpX ([EC:3.1.3.11]; A3ECDRAFT_0476), which catalyzes the hydrolysis of fructose 1,6-bisphosphate to fructose 6-phosphate and inorganic phosphate, were identified. The emzymes of the oxidative (OPP) and nonoxidative branches of the pentose phosphate pathway were identified. The three enzymes, glucose-6-phosphate 1-dehydrogenase G6PDH ([EC:1.1.1.49]; A3ECDRAFT_0915), 6-phosphogluconolactonase 6PGL ([EC:3.1.1.31]; A3ECDRAFT_0913) and 6-phosphogluconate dehydrogenase (6PGDH) ([EC:1.1.1.44]; A3ECDRAFT_1067), which catalyze the three irreversible reractions of OPP branch were present. The primary enzymes that mediate the reversible reactions of the non oxidative PPP branch, transketolase TKT ([EC:2.2.1.1]; A3ECDRAFT_0917) and transaldolase TALDO ([EC:2.2.1.2]; A3ECDRAFT_0916), were also present. A set of genes encoding enzymes necessary to drive a complete oxidative tricarboxylic acid cycle were found in the genome of . These include genes encoding citrate synthase [EC:2.3.3.1] (gltA, A3ECDRAFT_1136), aconitase [EC:4.2.1.3] (acnA, A3ECDRAFT_0939), isocitrate dehydrogenase [EC:1.1.1.42] (icd, A3ECDRAFT_0312), α-ketoglutarate dehydrogenase [EC:2.3.1.61] (sucB, A3ECDRAFT_1518), succinyl-CoA:acetate CoA-transferase [EC:3.8.3.18] (cat1, A3ECDRAFT_0443 and A3ECDRAFT_0629), succinate dehydrogenase [EC:1.3.5.1] (sdhAB, A3ECDRAFT_0086 and A3ECDRAFT_0087), fumarate hydatase [EC:4.2.1.2] (fumC, A3ECDRAFT_0475), NAD-dependent malate dehydrogenase [EC:1.1.1.37] (mdh, A3ECDRAFT_1397) and FAD-dependent malate:quinone oxidoreductase [EC:1.1.5.4] (mqo, A3ECDRAFT_0727). The gene encoding for the anaplerotic enzyme phosphoenolpyruvate carboxylase ([EC:4.1.1.31]; A3ECDRAFT_0911), which catalyzes the synthesis of oxaloacetate from pyruvate was also identified. Genes coding for the enzymes of the anaplerotic glyoxylate cycle, isocitrate lyase (EC:4.1.3.1; A3ECDRAFT_0081) and malate synthase ([EC:2.3.3.9], A3ECDRAFT_0082), were present in the genome.

Glycogen metabolism

Glycogen, a soluble α-linked glucose polymer (or α-glucan) with ~90 % α-1,4-links in its backbone and ~10 % α-1,6-linked branches, is a source of carbon and energy storage in a wide variety of organisms, including bacteria [36]. Inspection of the genome revealed that was equipped with the genes encoding proteins envolved in glycogen biosynthesis by the classical GlgC/GlgA and the GlgE pathways. Key genes encoding enzymes involved in the GlgC/GlgA pathway include: glgC, encoding for glucose-1-phosphate adenyltransferase GlgC ([EC:2.7.7.27], A3ECDRAFT_0532) which catalyzes the production of ADP-glucose from ATP and glucose-1-phosphate; glgA, encoding for glycogen synthase GlcA ([EC:2.4.1.21], A3ECDRAFT_0531) which catalyzes the successive addition of glucose from the glycosyl-nucleotide to the growing α-1,4-linked chain to generate the linear glucan; and glgB, encoding for the α-1,4-glucan branching enzyme GlgB ([EC:2.4.1.18], A3ECDRAFT_0591) which catalyzes the formation of α-1,6-glucosidic linkages in the linear α-1,4-glucans to produce glycogen. In case of the GlgE pathway, three of the four genes (treS, pep2, glgE and glgB) encoding for the enzymes involved in this pathway were found: the glgE gene encoding for maltosyl transferase GlgE ([EC:2.4.99.16], A3ECDRAFT_0592), the pep2 gene encoding a maltokinase Pep2 ([EC2.7.1.175], A3ECDRAFT_1428) and the previously mentioned glgB gene encoding for the GlgB ([EC:2.4.1.18], A3ECDRAFT_0591). BLASTP analysis revealed that the Pep2 protein is a maltokinase which forms a complex with trehalose synthase TreS. This is not surprising partly due to the fact that the pep2 (also called mak) gene is usually linked with the treS gene and in some micro-organisms like Psuedomonas entamophila, and in numerous members of the class the two genes are fused into a single gene [37-39]. The GlgE pathway requires trehalose as a precursor of α-glucan synthesis using the combined action of the four enzymes [37, 40–42]. In this pathway, trehalose is first isomerized to maltose by trehalose synthase (TreS). Next, maltose is phosphorylated to maltose-1-phosphate by maltose kinase (Pep2) by expending a molecule of ATP. The phospho-activated disaccharide is a substrate for maltosyltransferase (GlgE). GlgE uses maltose-1-phosphate to elongate α(1 → 4) linked glucan chains. GlgB, the last enzyme of this pathway, mediates α(1 → 6)-branching of the glucan chain [43]. In addition to the gene involved in glycogen biosynthesis two genes, glgP and glgX, which encode for glycogen phosphorylase GlgP ([EC:2.4.1.1], A3ECDRAFT_1662) and the glycogen debranching enzyme GlgX ([EC:3.2.1_], A3ECDRAFT_1629), respectively, were identified in the genome. These enzymes mediate glycogen degradation. GlgP catalyzes the sequential phosphorolysis of glycogen to release glucose-1-phosphate, whereas the enzyme GlgX acts by remodeling of the glycogen branches to permit further degradation.

Trehalose metabolism

Trehalose is a disaccharide composed of two glucose units which are linked in an α, α-1,1-glycosidic linkage. It is an energy store and a stress-protectant, helping bacteria to survive desiccation, cold and osmotic stress [44]. Trehalose is also an integral component of cell wall trehalose dimycolates (TDM, cord factor) found in species of the genera , , and [45, 46]. Inspection of genome revealed the presence of genes encoding for proteins envolved in trehalose biosynthesis via the GalU-OtsA-OtsB and the TreY-TreZ pathways. The GalU-OtsA-OtsB pathway is catalyzed by the galU, otsA and otsB gene products, including the enzymes UTP--glucose-1-phosphate uridyltransferase GalU ([EC:2.7.7.9], A3ECDRAFT_1217), trehalose-6-phosphate synthase OtsA ([EC:2.4.1.15], A3ECDRAFT_1788) and trehalose-6-phosphate phosphatase OtsB ([EC:3.1.3.12], A3ECDRAFT_1791), respectively, whilst the TreY-TreZ pathway is catalyzed by the treY and treZ gene products, which include the enzymes maltooligosyltrehalose synthase TreY ([EC:5.4.99.15], A3ECDRAFT_1625) and maltooligosyltrehalose trehalohydrolase TreZ ([EC:3.2.1.141], A3ECDRAFT_1615), respectively. The GalU-OtsA-OtsB pathway involves trehalose synthesis from UDP-glucose and glucose-6-phosphate [47, 48], whereas the TreY-TreZ pathway involves trehalose biosynthesis from glycogen-like α(1 → 4)-linked glucose polymers [47, 49]. Additionally, examination of the genome revealed the presence of a gene encoding for trehalose phosphorylase ([EC:2.4.1.64], A3ECDRAFT_0084). This enzyme catalyzes the phosphorolysis of trehalose to produce glucose-1-phosphate and glucose. This reaction is reversible and could give rise to trehalose from glucose-1-P and glucose [50].

Insight into lipids metabolism

Fatty acid biosynthesis

Fatty acids biosynthesis is mediated by enzymes catalyzing several iterative cycles of reaction steps including condensation, reduction, dehydration and reduction [51, 52]. The genes encoding for enzymes necessary for fatty acid biosynthesis in DSM 45146T were identified. Inspection of the genome revealed the presence of a single fas1 gene encoding type I fatty acid synthase FAS I ([EC:2.3.1.-], A3ECDRAFT_2083). BLASTP analysis revealed that FAS I (A3ECDRAFT_2083) was identical to homologs (NCgl0802) in ATCC13032T and (HMPREF0281_00958) in C. ammoniagens DSM 20306T sharing 53 % and 52 % identities, respectively. FAS I (A3ECDRAFT_2083) is a single polypeptide of 3055 amino acid residues, which contained all the catalytic domains necessary to perform the iterative series of reactions for de novo fatty acids synthesis. The individual component enzymes of the various catalytic domains are acyl transferase (AT), enoyl reductase (ER), β-hydroxyacyl dehydratase (DH), malonyl/palmitoyl transferase (MPT), acyl carrier protein (ACP), β-ketoacyl reductase (KR), and β-ketoacyl synthase (KS) [53]. In addition to the fas1 gene, genes encoding for the putative subunits of acetyl-CoA carboxylase were found: one gene encoding for biotin carboxylase BC (α subunit) ([EC:6.3.4.14], A3ECDRAFT_2085) and the other encoding for carboxyltransferase CT (β subunit) (A3ECDRAFT_2084). Acetyl-CoA carboxylase catalyzes the biotin-dependent carboxylation of acetyl-CoA to produce malonyl-CoA in the first committed step of the fatty acid biosynthesis pathway. Malonyl-CoA is then made available to be utilized by the multifunctional type I FAS for de novo biosynthesis of fatty acids. FAS I synthesizes both saturated (C16:0 and C18:0) and monounsaturated (C18:1ω9c) fatty acids [54]. In the results of cellular fatty acids analysis are in agreement with the functional characteristics of FAS I.

Fatty acid catabolism

For the catabolism of fatty acids, 16 genes encoding for proteins predicted to be involved in the β-oxidation pathway of fatty acid degradation were identified. These include: four fadE genes encoding for acyl-CoA dehydrogenase ([EC:1.3.8.7], A3ECDRAFT_0464, _1504, _1084, _1608, _1609), two fadD genes encoding for fatty acid CoA ligase ([EC:6.2.1.3], A3ECDRAFT-0100 and A3ECDRAFT_1435), one fadJ gene encoding for 3-hydroxyacyl-CoA dehydrogenase ([EC:1.1.1.35], A3ECDRAFT_1916), three fadA genes encoding for acetyl-CoA acyltransferase ([EC:2.3.1.9], A3ECDRAFT_1199, _1765, _1915) and four echA genes encoding for enoyl-CoA hydratase ([4.2.1.17], A3ECDRAFT_1142, _1525,_2066, _2067). In addition, one acx gene encoding for acyl-COA oxidase ACOX1 ([EC:1.3.3.6], A3ECDRAFT_2105), which catalyzes the desaturation of fatty acyl-CoA thioesters and donates electrons directly to molecular oxygen generating H2O2 [55, 56]. The subsequent detoxification of the resulting H2O2 is catalyzed by catalase ([EC:1.11.1.6]; A3ECDRAFT_0111) encoded by the katA gene of . The existence of considerable set of genes putatively involved in β-oxidation, suggested the ability of to mobilize the energy and carbon stored in fatty acids with different chain-lengths.

Corynomycolic acid biosynthesis and processing

Mycolic acids, long-chain α-alkyl, β-hydroxy fatty acids, are major components of the cell wall of several genera of . They are found either covalently linked to the cell wall arabinogalactan, to form mycolyl arabinogalactan, or acylated to trehalose units to form trehalose monomycolate (TMM) and trehalose dimycolate (TDM) [57-59]. Mycolic acids covalently linked to the cell wall form a hydrophobic permeability barrier, also referred to as the mycomembrane, which contributes to the low permeability of the envelope of and the natural resistance of these microorganisms to various antibiotics [45, 60, 61]. Mycolic acids vary in size and complexity within the different genera of . Members of the genus are characterized by producing short-chain C22 to C36 mycolic acids, also called corynomycolic acids, with simple chemical structure [57]. Examination of the genome of DSM 45146T revealed the presence of homologs of genes encoding for proteins with known functions in the pathway of mycolic acids biosynthesis, processing and subsequent transport for deposition in the cell wall. These genes comprising: accD3 encoding for an acyl-CoA carboxylase complex (A3ECDRAFT_1931), which catalyzes the carboxylation of palmitoyl-CoA to yield carboxylated intermediate [62-64]; fadD32 encoding for an acyl-CoA synthetase/AMP ligase FadD32 (A3ECDRAFT_1933), which catalyzes the activation of the meromycolate chain through the formation of meroacyl-ADP before transfer to the polyketide synthase [64, 65]; pks13 encoding for a polyketide synthase (A3ECDRAFT_1932) that performs the condensation of two fatty acids to form a 2-alkyl-3-keto mycolate precursor [66]; elrF encoding for the envelope lipid regulation factor ElrF (A3ECDRAFT_1934), _0314, _0659, _0660, _0935), which plays a role in the regulation of mycolic acid compositions in response to thermal variation in the environment [67]; cmtA, cmtC and cmtB encoding for trehalose mycolyltransferases (A3ECDRAFT_0077), (A3ECDRAFT_1936) and (A3ECDRAFT_1937), respectively, which catalyze: a) the transfer of mycolyl residue onto trehalose, thereby generating TMM, b) the transfer of one molecule TMM to another TMM leading to the formation of TDM, and c) the transfer of mycolate from TMM to arabinogalactan, forming the cell wall arabinogalactan-mycolate polymer [68-70]; mmpL encoding for membrane transport proteins of the MmpL family (A3ECDRAFT_0066, A3ECDRAFT_1927, A3ECDRAFT_2155) which is involved in the translocation of TMM to the outside of the bacterial cell for subsequent use as substrate for cell wall mycolylation [71]; and cmrA encoding for short-chain dehydrogenase/reductase CmrA (A3ECDRAFT_1367), the enzyme catalyzes the reduction of the mycolate precursor to produce the mature trehalose mycolates and subsequent covalent attachment onto the cell wall [72]. These genes clustered together forming a locus in the chromosome (Fig. 4). The overall organization of the entire locus in all mycolic acid-containing is almost identical, although a slight difference is apparent in the mycolyltransferase region (Fig. 4). This gene repertoire is consistent with the detection of mycolic acids in the cell envelope of DSM 45146T by thin-layer chromatography [1].
Fig. 4

Cluster of genes encoding for enzymes involved in mycolic acid biosynthesis in C. ulceribovis DSM 45146T and selected species of some relevant genera of Corynebacterineae. The cluster consists of at least five genes, all of them transcribed in the same direction. The pks13, fadD32 and accD3/accD4 othologs were found in all genomes examined and the genetic organiszation surrounding the pks13 gene was highly conserved. Slight differences between the species examined is apparent in the mycolyltransferase (green colored) region. Orthologs are shown by matching colors

Graphical map of the largest scaffold of the genome. From bottom to the top: Genes on forward strand (color by COG categories), Genes on reverse strand (color by COG categories), RNA genes (tRNA green, rRNA red, other RNAs black), GC content, GC skew (purple/olive)

Phospholipids biosynthesis

Phospholipids are fundamental structural components of biological membranes that are also associated with energy production, nutrient uptake, protein export, and various sensing/signaling reactions in the living cells. The major phospholipids species found in members of the genus are phosphatidylglycerol (PG), lysophosphatidylglycerol (LPG), cardiolipin (CL), phosphatidylinositol (PI) and phosphatidylinositol-dimannoside (PIM2) [73]. Thirteen genes related to phospholipid pathway were identified in the genome of . Among these were four genes encoding enzymes involved in phosphatidic acid (PA) biosynthesis via two pathways: two paralogs of plsC genes encoding for 1-acyl-sn-glycerol-3-phosphate acyltransferase PlsC ([EC:2.3.1.51]; A3ECDRAFT_1544 and A3ECDRAFT_1945), which catalyze the sequential addition of acyl moieties from acyl-CoA to sn-1 and sn-2 position of glycerol-3-phosphate to form phosphatidic acid [74]; two dagk paralogs encoding for diacylglycerol kinase DGK (A3ECDRAFT_0383 and A3ECDRAFT_0501), which catalyze the phosphorylation of diacylglycerol (DAG) to produce PA [75]. A single copy of the cdsA gene encoding for phosphatidate cytidylyltransferase CdsA ([EC:2.7.7.41], A3ECDRAFT_0714), which catalyzes the conversion of phosphatidic acid to cytidine diphosphate-diacylglycerol (CDP-DAG), a key intermediate in phospholipids biosynthesis [76]. Two genes encoding for proteins annotated as phosphatidylglycerophosphate synthase ([EC:2.7.8.5], A3ECDRAFT_0785) and phosphatidylglycerophosphate phosphatase ([EC:2.7.8.5], A3ECDRAFT_1077) required for the synthesis of PG. The first enzyme catalyzes the condensation of CDP-DAG with glycerol-3-phosphate yielding phosphatidylglycerophosphate (PGP), whereas the second enzyme catalyzes the subsequent dephosphorylation of PGP to produce PG. A copy of the cls gene encoding for cardiolipin synthase Cls ([EC:2.7.8.-], A3ECDRAFT_0953), which catalyzes the synthesis of cardiolipin through the condensation of two phosphatidylglycerol molecules [77]. A copy of the pgsA gene encoding for PI synthase PIS ([EC:2.7.8.5], A3ECDRAFT_0837), which catalyzes the synthesis of PI from CDP-DAG and myo-inositol [78]. The pimA and pimB genes encoding for phosphatidylinositol α-mannosyltransferase PimA ([EC:2.4.1.57], A3ECDRAFT_0839) and phosphatidylinositol α-1,6-mannosyltransferase PimB ([EC:2.4.1--], A3ECDRAFT_1542), respectively, which are involved in the mannosylation steps of PI to produce PIMs. PimA catalyzes the committed step in PIMs biosynthesis, transferring a mannose residue from GDP-Man to the 2-OH of the inositol ring of PI producing PIM1 [79, 80], whereas PimB catalyzes the transfer of a second Man residue from GDP-Man to the 6-position of the inositol moiety of PIM1 resulting in the formation of PIM2 [81-83]. Moreover, the genes ino1 and impA encoding for myo-inositol-3-phosphate synthase Ino1 ([EC:5.5.1.4], A3ECDRAFT_2002) and inositol monophosphatase ImpA ([EC:3.1.3.25], A3ECDRAFT_0801 and A3ECDRAFT_1648), respectively, were present. Both Ino1 and ImpA enzymes are involved in the biosynthesis of myo-inositol from glucose-6-phosphate [84, 85]. Although the pgsA paralogs (A3ECDRAFT_0785, A3ECDRAFT_0837 and A3ECDRAFT_1077) were annotated as PgsA/CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase, it seems likely that they are functionally not related. The pgsA (A3ECDRAFT_0837) genomic region in showed an organization similar to that found in other bacteria (Fig. 5). In all these groups pgsA is the second gene of a cluster of four to five genes potentially organized as an operon. The first ORF of this cluster (A3ECDRAFT_0836) located upstream of the pgsA gene encoded a protein of unknown function. The third ORF (A3ECDRAFT_0838) located downstream of the pgsA gene encoded a protein with similarities to bacterial acyltransferases (showed 53 % identity with homolog Rv2611c in H37Rv). The fourth ORF (A3ECDRAFT_0839) encoded a putative α-mannosyltransferase PimA (showed 49 % identity with homolog Rv2610c in H37Rv). Genetic evidences have showed that the pimA ortholog (RV2610c) in H37Rv encoded an essential enzyme for mycobacterial growth that initiates the biosynthetic pathway of PIMs [86, 87]. Therefore in , the presence of pgsA (A3ECDRAFT_0837) and pimA (A3ECDRAFT_0839) genes together within a cluster of genes suggested that PgsA (A3ECDRAFT_0837) may be a phosphatidylinositol synthase involved in PI biosynthesis which could be mannosylated by PimA (A3ECDRAFT_0839) leading to the synthesis of PIM. However, experimental verification of the function of the protein (A3ECDRAFT_0837) remains to be performed.
Fig. 5

Comparison of the genetic organization of the pgsA and pimA genes in C. ulceribovis DSM 45246T and PI/PIMs-producing species of some selected genera of Corynebacterineae. In all examined species the pgsA, htrB and pimA genes are colocalized confirming its link to PI and PIMs biosynthesis. Orthologs are shown by matching colors

Cluster of genes encoding for enzymes involved in mycolic acid biosynthesis in C. ulceribovis DSM 45146T and selected species of some relevant genera of Corynebacterineae. The cluster consists of at least five genes, all of them transcribed in the same direction. The pks13, fadD32 and accD3/accD4 othologs were found in all genomes examined and the genetic organiszation surrounding the pks13 gene was highly conserved. Slight differences between the species examined is apparent in the mycolyltransferase (green colored) region. Orthologs are shown by matching colors

Cell wall biogenesis and the penicillin binding proteins (PBPs)

possesses genes encoding for a complete set of enzymes involved in peptidoglycan (PG) biosynthesis, including MurABCDEFGI, alanine racemase ([EC:5.1.1.1], A3ECDRAFT_0263) and D-alanyl-D-alanine ligase ([EC:6.3.2.4]; A3ECDRAFT_0671). MurA, a UDP-GlcNAc enolpyruvyl transferase, catalyzes the first committed step of peptidoglycan synthesis by transferring an enolpyruvate from PEP to UDP-GlcNAc resulting in the formation of UDP-N-acetylglucosamine-enoylpyruvate, which subsequently reduced by MurB to UDP-N-acetylmuramic acid (UDP-MurNAc). The amino acid ligases MurC, MurD, MurE and MurF catalyze the successive addition of L-alanine, D-glutamic acid, meso-diaminopimelic (meso-DAP) or L-lysine and D-alanyl-D-alanine dipeptide, repectively, to the D-lactoyl group of UDP-MurNAc [88]. The translocase MraY catalyzes the transfer of MurNAc-pentapeptide motif from UDP-MurNAc-pentapeptide to an undecaprenyl phosphate carrier lipid anchored in the cytoplasmic membrane forming the first membrane linked intermediate (Lipid I). The MurG protein catalyzes the transfer of GlcNAc from UDP-GlcNAc onto lipid I, generating lipid II [89]. The murCDEFG genes were organized in cluster located in the center of conserved dcw (division cell wall) region in the order shown in (Fig. 6), whereas the murABI genes were located elswhere in the chromosome.
Fig. 6

Division and cell wall (dcw) cluster in C. ulceribovis DSM 45246T. The region consists of a cluster of genes involved in cell division and peptidoglycan synthesis

Comparison of the genetic organization of the pgsA and pimA genes in C. ulceribovis DSM 45246T and PI/PIMs-producing species of some selected genera of Corynebacterineae. In all examined species the pgsA, htrB and pimA genes are colocalized confirming its link to PI and PIMs biosynthesis. Orthologs are shown by matching colors meso-DAP, the third residue in the PG pentapeptide [90], is an important chemotaxonomic marker of members of the including the genus and it is essential for both peptidoglycan and lysine biosynthesis in bacteria. From genome sequencing data, it was clear that should synthesize meso-DAP from aspartate via the dehydrogenase variant of the DAP-pathway [91, 92]. The genes dapA, dapB, dapC and dapD are present in the genome, whereas the dapE and dapF genes are missing from the genome. Moreover, the ask (encoding aspartokinase [EC:2.7.2.4], (A3ECDRAFT_0021) and asd (encoding aspartate semialdehyde dehydrogenase [EC:1.2.1.11], A3ECDRAFT_0022), genes are found clustered in an operon. Aspartokinase and aspartate semialdehyde dehydrogenase catalyze the first two enzymatic steps of the DAP-pathway, leading to conversion of aspartate to aspartate semialdehyde. The lysA gene encoding for diaminopimelate decarboxylase ([EC:4.1.1.20] A3ECDRAFT_0568), which catalyzes the conversion of meso-DAP to L-lysine, is also present in the genome. Furthermore, genome harbors seven genes encoding for penicillin binding proteins (PBPs) that catalyze the final steps of peptidoglycan synthesis. Two genes encoding for the bi-functional high molecular-mass (HMM) PBP of 1A family, designated PBP1A (A3ECDRAFT_2000) and PBP1B (A3ECDRAFT_0034), which have transpeptidase-transglycosylase activities and catalyze the elongation of the uncross-linked glycan chains of the PG. Three genes encoding for HMM PBP 2 family, designated PBP2A (A3ECDRAFT_2052), PBP2B [FstL] (A3ECDRAFT_1562) and PBP2C (A3ECDRAFT_0722), which contain transpeptidase domains and an additional dimerisation domains and believed to play a role in cell morphogenesis. Two genes encoding for low-molecular mass (LMM) PBP of type PBP4, designated DacB (A3ECDRAFT_1828), and one of type PBP 5/6, designated DacC ([EC:3.4.16.4]; A3ECDRAFT_0319). The Dac proteins are D,D-carboxypeptidases which catalyze the cleavage of the terminal D-Ala-D-Ala bond making the stem peptide unavailable for transpeptidation and through this activity regulate the amount of cross-linking that can occur within the PG [93]. Moreover, genome contains two ldt genes encoding two L, D-transpeptidases (Ldt), LdT1 (A3ECDRAFT_1351) and LdT2 (A3ECDRAFT_1870). The L,D-transpeptidases are a group of carbapenem sensitive enzymes that participate in the remodeling of the peptidoglycan network by formation of 3 → 3 cross-links between two adjacent meso-DAP residues (meso-Dap → meso-Dap bridges) instead of the 4 → 3 cross-links (D-Ala → meso-DAP) generated by the D,D-transpeptidase activity of the PBPs and can thus render the peptidoglycan resistant to the hydrolytic activity of endopeptidases [94, 95].

Cofactor biosynthesis

Organic cofactors play crucial roles in the catalysis of biochemical reactions in the metabolism of all living organisms. Inspection of DSM 45146T genome revealed the expression of enzymes involved in the de novo biosynthetic pathways for several cofactors such as pyridoxal-5-phosphate, lipoic acid, flavin nucleotides, folate, pantothenate, thiamine, nicotinic acids biotin and menaquinones. The supplied additional files give an overview of the de novo biosynthetic and salvage pathways for some of these cofactors. The genomes of DSM45146T harbors only one gene encoding for a pyridoxal 5’-phosphate synthase PdxS ([EC:4.3.3.6], A3ECDRAFT_0841). Pyridoxal-5-phosphate seems to be synthesized in from ribulose 5-phosphate and a 3 carbon sugar via the deoxyxylulose 5-phosphate-independent pathway as named by [96]. The lipA and lipB genes encoding for lipoyl synthase LipA ([EC:2.8.1.8], A3ECDRAFT_1516) and lipoyl(octanoyl) transferase LipB ([EC:2.3.1.181], A3ECDRAFT_1517) that catalyze the two consecutive steps of lipoic acid de novo biosynthesis were identified.

Riboflavin (Vitamin B2) biosynthesis

Riboflavin is synthesized from guanosine 5’-triphosphate (GTP) and ribulose 5’-phosphate. It is an essential component of the basic metabolism, being the precursor of the flavin cofactors, flavin mononucleotide (FMN) and flavin adenine dinucleotide (FAD), which serve as prosthetic groups for many oxidoreductases [97]. The genome of has all genes encoding for the enzymes involved in riboflavin synthesis (Additional file 1). The rib operon encoding for a GTP cyclohydrolase II (RibA)/3,4-dihydroxy 2-butanone 4-phosphate synthase (RibB), diaminohydroxyphosphoribosylaminopyrimidine deaminase (RibD)/5-amino-6(5-phosphoribosyl-amino)uracil reductase (RibD), riboflavin synthase (RibE), and 6,7-dimetyl-8-ribityllumazine synthase (RibH). These enzymes form a pathway that yields one riboflavin molecule from one molecule of GTP and two molecules of ribulose 5-phosphate. At the next stage, the bifunctional riboflavin kinase/FAD-synthase converts riboflavin to FMN and FAD.

Folic acid (Vitamin B9) biosynthesis

Genes encoding for all the enzymes of the folate biosynthetic pathways are present (Additional file 2). The first enzyme of the pterin branch is GTP cyclohydrolase (FolE), which catalyzes the conversion of GTP to 7,8-dihydroneopterin triphosphate [98], which is converted to the corresponding monophosphate by alkaline phosphatase D [EC:3.1.3.1]. The three genes folBKP, which encode the three enzymes dihydroneopterin aldolase, 2-amino-4-hydrox-6-hydroxymethyldihydropteridine diphosphate and dihydropteroate synthase, respectively, formed an operon. The three enzymes catalyze the stepwise conversion of dihydroneopterin to 7,8-dihydropteroate. The resulting dihydropteroate is converted to dihydrofolate by dihydrofolate synthase [EC:6.3.2.12], which is reduced by dihydrofolate reductase [EC:1.5.1.3] to tetrahydrofolate.

Pantothenic acid (Vitamin B5) and coenzyme A (CoA) biosynthesis

Like other bacteria, synthesizes coenzyme A (CoA) via pantothenic acid from aspartate and α-ketoisovalerate (Additional file 3). The CoA biosynthetic route requires nine enzymes: four to synthesize pantothenic acid I-VI) and five to produce CoA (VI-XI). With the exception of the gene encoding for 2-dehydropantoate 2-reductase PanE (EC1.1.1.169), which catalyzes the reduction of 2-dehydropantoate (IV), all pantothenate and CoA biosynthesis genes are annotated in . Although the genome lacks the panE gene encoding for 2-dehydropantoate 2-reductase (KPR), a gene (A3ECDRAFT_1818) encoded for a predicted oxidoreductase, which contains short-chain dehydrogenase (SDR) and DUF2520 domains, was present in the genome. BLASTP analysis revealed that the protein (A3ECDRAFT_1818) was 41 % identical to ketopantoate reductase (PanE/ApbA) in F0235. Homologs of this KPR protein are present in other bacterisa such as V583 (EF1861), novicidia (FTT1388) and . The KPR protein has been shown to also catalyze the conversion of 2-dehydropantoate to pantoate in species [99]. In the pABA (para-aminobenzoic acid) branch of the pathway, chorismate is aminated to 4-amino-deoxychorismate by para-aminobezoate synthase [EC:2.6.1.85] which subsequently converted to pABA by aminodeoxychorismate lyase [EC:4.1.3.38]. The enzyme dihydropteroate synthase also catalyzes the condensation of pABA with 6-hydroxymethyl 7,8-dihydropterin pyrophosphate yielding dihydropteroate.

Thiamine (Vitamin B1) biosyntheis

Thiamine in its active form, thiamine pyrophosphate, is an essential cofactor for several microbial enzymes of the carbohydrate metabolism [100]. The genes encoding proteins related to the biosynthesis of thiamine pyrophosphate are present in the genome of DSM 45146T. The thiamine biosynthetic pathway of 45146T is outlined in (Additional file 4). Thiamine monophosphate (XIII) is formed by coupling of two independently synthesized moieties, 4-amino-2-methyl-5-β-hydroxyethyl thiazole phosphate (IX) and 4-amino-2-methyl-5-hydroxymethylpyrimidine pyrophosphate (XII). At the next step, thiamine monophosphate is phosphorylated by the enzyme ThiL to form thiamine pyrophosphate. The 4-amino-2-methyl-5-hydroxymethylpyrimidine pyrophosphate (XII) is produced from aminoimidazole ribotide (X), an intermediate of purine biosynthesis pathway [101]. Hydroxymethyl pyrimidine synthase (ThiC) and phosphomethylpyrimidine kinase (ThiD) catalyze the conversion of (X) to form (XII). In DSM 45146T, 4-amino-2-methyl-5-β-hydroxyethyl thiazole phosphate (IX) is derived from an oxidative condensation of cysteine, glyciene and 1-deoxy-D-xylulose 5-phosphate (DXP). Several genes such as thiG, thiO, iscS, and Dxs are involved in this process.

Nicotinic acid (Vitamin B3) and nicotinamide adenine dinucleotide NAD biosynthesis

NAD and its reduced and phosphorylated derivatives, NADH, NADP and NADPH, function as reducing equivalents for cellular biochemistry and energy metabolism. The genome of 45146T carries the genes encoding for enzymes involved in NAD biosynthesis via both the canonical de novo pathway from L-aspartate and the salvage biosynthetic pathway from nicotinamide. In the de novo pathway, nicotinic acid mononucleotide (NaMN) is synthesized in three enzymatic steps from L-aspartate followed by two enzymatic steps to complete the synthesis of NAD (Additional file 5). In the salvage biosynthesis, nicotinamide is converted in a four-step pathway through nicotinate, nicotinate D-ribonucleotide and deamino NAD+ to intact NAD+ (Additional file 5).

Biotin (Vitamin H) biosynthesis

Biotin is an essential cofactor for biotin-dependent carboxylases, which catalyze the transfer of a carboxylate group from a donor to an acceptor molecule [102]. Biotin synthesis can be subdivided into the synthesis of pimeloyl-CoA from pimelic acid followed by the biotin ring assembly [103]. The bioA-bioD and bioB genes encoding for the enzymes involved in the biotin ring assembly were identified in DSM 45146T genome. However, the pathway of biotin biosynthesis in DSM 45146T is incomplete due to the lack of at least of the bioF and bioW genes. Moreover, the genome contains the bioY-bioM-bioN genes encoding for the protein components BioY (A3ECDRAFT_0764) -BioM (A3ECDRAFT_0763) –BioN (A3ECDRAFT_0762), which constitute tripartite biotin transporter [104]. The birA gene encoding for the BirA protein was also identified.

Menaquinone (Vitamin K2)

Menaquinone (MK) plays a key role as an electron carrier in the electron transport of the respiratory chain in prokaryotes [105]. The genome of is also equipped with the genes for the biosynthetic pathway of menaquinone from chorismate. In this pathway chorismate is converted into 1,4-dihydroxy-2-naphthoate (DHNA) via isochorismate by five enzymes encoded by the menFDCEB genes. DHNA is converted to MK after prenylation (catalyzed by MenA) and methylation (catalyzed by MenG). Since menaquinones are the only type of isoprenoid quinones found in the genera of the suborder , including the genus , the presence of genes encoding for enzymes catalyzing the biosynthesis of menaquinone in the genome of DSM 45146T is consistent with its classification in the genus . Menaquinones are widely used as chemotaxonomic markers. The taxonomic value of menaquinones lies on their chain length and degree of unsaturation [106].

CRISPR/Cas system and immunity to phage attack

Analysis of the genome sequence revealed that employs various defense mechanisms to overcome phage infections. These include restrisction of penetrating phage DNA (restriction-modification (R-M) system), abortive phage infection (Abi) system, and the clustered regularly interspaced short palindromic repeats (CRISPR)-associated (Cas) proteins (CRISPR/Cas) system. The genome contains six paralogs of the hsd genes encoding for type I R-M enzymes. These include two hdsR paralogs encoding for two R subunits of type I restriction enzyme HsdR ([EC:3.1.21.3], A3ECDRAFT_1191 and A3ECDRAFT_1675), two hsdM paralogs encoding for two M subunits of type I restriction enzyme HsdM ([EC:2.1.1.72], A3ECDRAFT_1187 and A3ECDRAFT_1677) and two hdsS paralogs encoding for two S subunits of type I restriction enzyme HsdS ([EC:3.1.21.3], A3ECDRAFT_1188 and A3ECDRAFT_1676). The HsdR subunit is responsible for restriction, the HsdM subunit is involved in modification and the HsdS subunit is responsible for specific sequence recognition. None of them reveals any activity as a single protein [107]. For modification activity, a combination of one HsdS and two HsdM subunits is required and for restriction activity all subunits are absolutely required in a stoichiometric ratio of R2M2S1 [107]. The M2S1 multifunctional enzyme acts as protective methyltransferase [108], whereas the holoenzyme exhibits both endonucleolytic and helicase activities. The principal function of the R–M system is to protect the bacterial cell against invading DNA, including viruses [109]. In addition, a gene (A3ECDRAFT_0290) encoding a protein annotated as Abi-like protein was identified. This protein contains an Abi_2 domain (pfam07751), which has been shown to mediate bacteriophage resistance by abortive infection [110]. Activation of Abi protein limits phage replication within a bacterial population and promotes bacterial cell death [111, 112]. Moreover, DSM 45146T genome contains two CRISPRs loci together with the associated cas genes. CRISPR locus 1 contains 1070 bp and harbors 17 spacer sequences and is not specified by the presence of cas genes in the direct proximity. CRISPR locus 2 contains 6893 bp and harbors 102 spacer sequences and is flanked by seven cas genes [cas3 (A3ECDRAFT_1586), cse1 (A3ECDRAFT_1587), cse2 (A3ECDRAFT_1588), cas7 (A3ECDRAFT_1589), cas5 (A3ECDRAFT_1590), cas6 (A3ECDRAFT_1591) and cas1 (A3ECDRAFT_1592)]. The consesus sequences of the direct repeats of the two CRISPR regions are identical having a length of 28 bp (GTGTTCCCCGCGCAGGCGGGGATGAGCC) and separated by spacers with variable nucleotide sequences. CRISPRs provide the cell with aquired immunity to protect against bacteriophages, plasmids and other mobile genetic elements by a RNA interference-like mechanism [113, 114].

Insight into protein secretion systems

Secreted proteins play essential roles in bacteria, including the colonization of niches and host-pathogen interactions [115, 116]. In Gram-positive bacteria proteins secretion is mediated mainly by the general secretory (Sec) and the twin-arginine translocation (Tat) pathways. Some Gram-positive bacteria e.g. mycobacteria, nocardia and corynebacteria have a specialized type VII secretion system (T7SS) for secretion of WXG100 family proteins. Inspection of DSM 45146T genome revealed the presence of all genes encoding proteins for the Sec translocation system. These include proteins forming the main membrane channel-forming complex SecYEG (A3ECDRAFT_0227/A3ECDRAFT_0157/A3ECDRAFT_0912), the cytosolic ATPase SecA (A3ECDRAFT_0372 and A3ECDRAFT_1078), the auxiliary proteins SecD (A3ECDRAFT_0848), SecF (A3ECDRAFT_0849) and YajC (A3ECDRAFT_0847), and the chaperones Ffh (A3ECDRAFT_0690) and FtsY (A3ECDRAFT_0689). As in other Gram-positive bacteria, the genome lacks homologs of the SecB protein, the chaperone that targets protein to the Sec translocon for passage through the cytoplasmic membranes. Genes encoding for the twin-arginine translocase (Tat) system, tatA/E, tatB, tatC, and tatD were also present in the genome. Like the majority of other sequenced actinobacterial genomes, the tatA/E gene (A3ECDRAFT_0977) was found next to tatC (A3ECDRAFT_0978), while the tatB gene (A3ECDRAFT_0538) and the tatD gene (A3ECDRAFT_1228) were separately located. The distinguishing feature of the TAT system is its ability to translocate fully folded proteins across the cytoplasmic membrane using the transmembrane proton gradient as the main driving force for translocation [117]. A putative type IVb pilus-encoding gene cluster, similar to the tad (tight adherence) locus in , was identified in the genome of . The genes of this tad locus appear to be organized as two adjacent clusters. The first cluster contained four genes encoding for: homolog of the TadZ protein (A3ECDRAFT_0049), followed by the TadA protein (A3ECDRAFT_0050), followed by two integral membrane proteins, TadB (A3ECDRAFT_0051) and TadC (A3ECDRAFT_0052). The second cluster contained three genes encoding for: a low-molecular weight protein (68 aa) containing DUF4244 domain (A3ECDRAFT_0053), followed by an unkown protein (A3ECDRAFT_0054), followed by a TadE-like protein (A3ECDRAFT_0055). Not linked to the tad locus, a gene encoding a putative prepilin peptidase PilD (A3ECDRAFT_0873), which was found located distantly in the genome. The tad export apparatus facilitates the export and assembly of pili, which mediate the nonspecific adhesion of bacteria to surfaces and are essential for host colonization and pathogenesis [118-120]. In addition, genes encoding proteins for type VII secretion system (ESX/T7SS) were also present in DSM 45146T genome. A region, comparable to region 4 (ESX-4) of H37Rv, containig nine genes (A3ECDRAFT_0240- A3ECDRAFT_0248) was identified (Fig. 7). The proteins encoded by these genes include: (A3ECDRAFT_0248), a WXG100/ESAT-6-like protein composed of 96 amino acids; (A3ECDRAFT_0247), a WXG100/CFP-10-like protein composed of 104 amino acids; (A3ECDRAFT_0246), Rv3446 potein family, C-terminal domain (alanine and valine rich protein); (A3ECDRAFT_0245), an ATPase with FtsK-SpoIIIE domain (EccCab); (A3ECDRAFT_0244), a putative ABC-type transporter-ATPase component; (A3ECDRAFT_0243), a putative exporter of polyketide antibiotics; (A3ECDRAFT_0242), an integral membrane protein with transmembrane helix regions (EccD); (A3ECDRAFT_0241), a subtilisin-like serine protease (MycP); (A3ECDRAFT_0240), a transmembrane protein (EccB). ESAT-6 (product of esxA) and CFP-10 (product of esxB) are members of a protein family that is characterized by a length of ~100 amino acid residues, containing a WXG motif and lack a distinguishable Sec-signal sequence [121]. Both of these proteins are important T-cell antigenic targets and are essential for the virulence of and [122, 123]. Type VII secretion system affects a range of bacterial processes including sporulation, conjugation and cell wall stability [124, 125].
Fig. 7

Comparison of gene clusters that encode type VII secretion system (T7SS also ESX) in C. ulceribovis DSM 45146T and variants that are present in other mycolic acid-containing taxa of the Corynebacterineae. Six genes encoding for six proteins are generally present in all the examined species. These proteins are: two members of the ESAT-6 family (Esat-6 and CFP-10); a member of the FtsK/SpoIIIE family (EccCab); a subtilisin-like protease (MycP); an integral membrane protein with 10–11 transmembrane domains (EccD); a member of another membrane-protein family (EccB); In addition, two proteins the PE (proline-glutamine) and PPE (proline-proline-glutamine) encoded by two genes are shared by some, but not all T7SS systems. Orthologs are shown by matching colors

Division and cell wall (dcw) cluster in C. ulceribovis DSM 45246T. The region consists of a cluster of genes involved in cell division and peptidoglycan synthesis Comparison of gene clusters that encode type VII secretion system (T7SS also ESX) in C. ulceribovis DSM 45146T and variants that are present in other mycolic acid-containing taxa of the Corynebacterineae. Six genes encoding for six proteins are generally present in all the examined species. These proteins are: two members of the ESAT-6 family (Esat-6 and CFP-10); a member of the FtsK/SpoIIIE family (EccCab); a subtilisin-like protease (MycP); an integral membrane protein with 10–11 transmembrane domains (EccD); a member of another membrane-protein family (EccB); In addition, two proteins the PE (proline-glutamine) and PPE (proline-proline-glutamine) encoded by two genes are shared by some, but not all T7SS systems. Orthologs are shown by matching colors

Conclusions

The availability of high-quality genome sequence from provided crucial insights into the broad biological functions of this organism. Genome analysis showed that the overall features of are similar to those of the genus ; it possesses a complete set of peptidoglycan biosynthesis genes, synthesizes meso-DAP from aspartate via the dehydrogenase pathway, possesses all genes for menaquinone biosynthesis from corismate and has complete set of genes for the biosynthesis and processing of mycolic acids. also possesses a single fas1 gene encoding type I fatty acid synthase FAS I for de novo fatty acids biosynthesis and a complete set of genes associated with fatty acid degradation by the β-oxidation pathway. Genes encoding enzymes associated with the central carbohydrates metabolism were identified. possesses a complete TCA cycle and glyoxylate shunt; a functional PPP for generation of pentoses and NADPH for anabolic purposes; all gene necessary for glycogen metabolism; trehalose synthesis via the OtsA-OtsB pathway. The genome also contains genes encoding myo-inositol- 3-phosphate synthase and inositol monophosphatase involved in the biosynthesis of myo-inositol from glucose-6-phosphate as well as gene encoding for α-mannosyltransferase PimA leading to the synthesis of PIM. To meet cofactor requirements, several genes encoding for enzymes that catalyze de novo biosynthetic pathways for several cofactors are present in the genome. Finally the genome of harbors genes encoding proteins that protect the cells against the danger of bacteriophage infections. These include type I restriction enzymes (R-M enzymes), Abi-like protein that mediate bacteriophage resistance by abortive infection (Abi system) and CRISPER/cas system that serve as molecular “vaccination cards”.
  118 in total

Review 1.  Type I restriction systems: sophisticated molecular machines (a legacy of Bertani and Weigle).

Authors:  N E Murray
Journal:  Microbiol Mol Biol Rev       Date:  2000-06       Impact factor: 11.056

Review 2.  A functional-phylogenetic classification system for transmembrane solute transporters.

Authors:  M H Saier
Journal:  Microbiol Mol Biol Rev       Date:  2000-06       Impact factor: 11.056

3.  Gene ontology: tool for the unification of biology. The Gene Ontology Consortium.

Authors:  M Ashburner; C A Ball; J A Blake; D Botstein; H Butler; J M Cherry; A P Davis; K Dolinski; S S Dwight; J T Eppig; M A Harris; D P Hill; L Issel-Tarver; A Kasarskis; S Lewis; J C Matese; J E Richardson; M Ringwald; G M Rubin; G Sherlock
Journal:  Nat Genet       Date:  2000-05       Impact factor: 38.330

4.  Nonspecific adherence by Actinobacillus actinomycetemcomitans requires genes widespread in bacteria and archaea.

Authors:  S C Kachlany; P J Planet; M K Bhattacharjee; E Kollia; R DeSalle; D H Fine; D H Figurski
Journal:  J Bacteriol       Date:  2000-11       Impact factor: 3.490

5.  Three pathways for trehalose biosynthesis in mycobacteria.

Authors:  K A De Smet; A Weston; I N Brown; D B Young; B D Robertson
Journal:  Microbiology       Date:  2000-01       Impact factor: 2.777

6.  The pimB gene of Mycobacterium tuberculosis encodes a mannosyltransferase involved in lipoarabinomannan biosynthesis.

Authors:  M L Schaeffer; K H Khoo; G S Besra; D Chatterjee; P J Brennan; J T Belisle; J M Inamine
Journal:  J Biol Chem       Date:  1999-10-29       Impact factor: 5.157

7.  Characterization of the in vivo acceptors of the mycoloyl residues transferred by the corynebacterial PS1 and the related mycobacterial antigens 85.

Authors:  V Puech; N Bayan; K Salim; G Leblon; M Daffé
Journal:  Mol Microbiol       Date:  2000-03       Impact factor: 3.501

8.  Identification of nonlipophilic corynebacteria isolated from dairy cows with mastitis.

Authors:  J Hommez; L A Devriese; M Vaneechoutte; P Riegel; P Butaye; F Haesebrouck
Journal:  J Clin Microbiol       Date:  1999-04       Impact factor: 5.948

Review 9.  Physiological roles of trehalose in bacteria and yeasts: a comparative analysis.

Authors:  J C Argüelles
Journal:  Arch Microbiol       Date:  2000-10       Impact factor: 2.552

Review 10.  beta-oxidation - strategies for the metabolism of a wide variety of acyl-CoA esters.

Authors:  J K Hiltunen; Y Qin
Journal:  Biochim Biophys Acta       Date:  2000-04-12
View more
  1 in total

1.  Draft genome sequence of Actinotignum schaalii DSM 15541T: Genetic insights into the lifestyle, cell fitness and virulence.

Authors:  Atteyet F Yassin; Stefan Langenberg; Marcel Huntemann; Alicia Clum; Manoj Pillay; Krishnaveni Palaniappan; Neha Varghese; Natalia Mikhailova; Supratim Mukherjee; T B K Reddy; Chris Daum; Nicole Shapiro; Natalia Ivanova; Tanja Woyke; Nikos C Kyrpides
Journal:  PLoS One       Date:  2017-12-07       Impact factor: 3.240

  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.