Literature DB >> 26312194

Microsatellite markers for studies with the carnivorous plant Philcoxia minensis (Plantaginaceae).

André V Scatigna1, Fernanda A Oliveira2, Camila C Mantello2, Patrícia M Francisco2, Anete P Souza3, André O Simões1.   

Abstract

PREMISE OF THE STUDY: Microsatellite markers were developed for the critically endangered carnivorous species Philcoxia minensis (Plantaginaceae) for further population genetic studies aiming at its conservation. METHODS AND
RESULTS: We identified 29 clones containing 40 microsatellites from a genomic enriched library. A total of 27 primer pairs were developed and evaluated in 30 individuals of a natural P. minensis population. Seventeen markers successfully presented amplification products within the expected size range, of which 12 were polymorphic. The expected and observed heterozygosities ranged from 0.03 to 0.65 and from 0.00 to 0.77, respectively. Positive transferability with the related species P. bahiensis was observed for the same 17 markers.
CONCLUSIONS: The 12 polymorphic microsatellite markers are suitable for studies in genetic diversity and structure, mating system, and gene flow in P. minensis and also may be useful for similar issues regarding the related species P. bahiensis.

Entities:  

Keywords:  Espinhaço Range; Gratioleae; Philcoxia minensis; Plantaginaceae; conservation genetics; simple sequence repeat (SSR)

Year:  2015        PMID: 26312194      PMCID: PMC4542941          DOI: 10.3732/apps.1500035

Source DB:  PubMed          Journal:  Appl Plant Sci        ISSN: 2168-0450            Impact factor:   1.936


Philcoxia P. Taylor & V. C. Souza is a carnivorous plant genus, endemic to the Brazilian cerrado and caatinga biomes (Pereira et al., 2012; Carvalho and Queiroz, 2014). The genus is characterized by terrestrial herbs with underground stems and leaves under or on the soil surface. It comprises five species: P. bahiensis V. C. Souza & Harley and P. tuberosa M. L. S. Carvalho & L. P. Queiroz, from Bahia; P. goiasensis P. Taylor, from Goiás; P. minensis V. C. Souza & Giul., from Minas Gerais (Taylor et al., 2000); and a newly described species (Scatigna et al., unpublished), also from Minas Gerais. Only a small population of P. minensis is known from a sand patch at the Serra do Cabral State Park, in Minas Gerais State (Souza and Giulietti, 2009). Due to its rarity and the vulnerability of the formation where it occurs, this species could be treated as critically endangered. In addition, very little is known about the general biology of P. minensis. One important step for studies supporting its conservation is the characterization of its genetic diversity and structure, gene flow, breeding ratio of populations, and mating system. The use of microsatellite markers for population genetics and biodiversity conservation has increased in the past decade (Ouborg et al., 2010) and is now a well-established technique. Therefore, the purpose of this study was to develop microsatellite markers or simple sequence repeats (SSR), aiming to elucidate questions concerning aspects of P. minensis biology, such as its genetic structure, variability, and mating system.

METHODS AND RESULTS

A silica gel–dried inflorescence of a single individual of P. minensis was used in the initial DNA extraction, using the NucleoSpin Plant II Kit (Macherey-Nagel, Düren, Germany), following the manufacturer’s protocol. A voucher specimen of that individual (Scatigna, A. V. 42) was deposited at the UEC herbarium at the Universidade Estadual de Campinas, Brazil. The inflorescence of Philcoxia individuals is used for DNA extraction to (1) avoid killing the plant, as the leaves are situated on or below the soil surface; and (2) prevent contamination of the template DNA by the abundant nematodes stuck on the leaf surfaces. A microsatellite-enriched genomic library was constructed following the protocol proposed by Billotte et al. (1999), with slight modifications. Genomic DNA was digested with AfaI enzyme (Invitrogen, Carlsbad, California, USA) for 3 h incubation at 37°C and ligated to the double-stranded adapters 5′-CTCTTGCTTACGCGTGGACTA-3′ and 5′-TAGTCCACGCGTAAGCAAGAGCACA-3′ for 2 h incubation at 20°C. Enrichment was performed using a hybridization-based capture with (CT)8 and (GT)8 biotin-linked probes and streptavidin-coated magnetic beads (MagneSphere Magnetic Separation Products; Promega Corporation, Madison, Wisconsin, USA). The enriched fragments were amplified by PCR, and the amplification products were cloned into pGEM-T Easy Vector (Promega Corporation). Competent XL1-Blue Escherichia coli (Stratagene, Agilent Technologies, Santa Clara, California, USA) were transformed with the recombinant plasmids and cultivated on agar medium containing ampicillin and 100 μg/mL of X-galactosidase. Eighty recombinant colonies were selected using blue/white screening and sequenced in an automated ABI 3500xL Genetic Analyzer (Perkin Elmer–Applied Biosystems, Foster City, California, USA) using T7 and SP6 primers and the BigDye Terminator version 3.1 Cycle Sequencing Kit (Perkin Elmer–Applied Biosystems). Sequences containing microsatellites were identified using the SSR Identification Tool (SSRIT; Temnykh et al., 2001). As a criterion for the SSR selection, sequences that showed at least five dinucleotide repeats; four trinucleotide repeats; and three tetra-, penta-, and hexanucleotide repeats were selected. A total of 40 SSRs were identified in 29 clones, representing a 36.25% rate of enrichment success. The most abundant motifs in the sequences of microsatellites were dinucleotide (70%), followed by tetranucleotide (17.5%), trinucleotide and pentanucleotide (5% each), and hexanucleotide (2.5%). Most of the SSRs found were classified as perfect (67.5%). Twenty-seven primer pairs, complementary to the genomic sequences flanking the microsatellite region, were designed using Primer3Plus (Untergasser et al., 2007). PCR was conducted with a final volume of 15 μL containing 2.5 ng of template DNA, 1× PCR buffer (20 mM Tris HCl [pH 8.4] and 50 mM KCl), 1.5 mM MgCl2, 0.2 mM of each dNTP, 10 mg/mL bovine serum albumin (BSA), 0.5 mM of each primer, and 1 unit of Taq DNA polymerase (Invitrogen). The PCR program for all loci amplification consisted of an initial denaturation at 94°C for 2 min 30 s, followed by 35 cycles of denaturation at 94°C for 1 min, annealing at specific temperature for 1 min (Table 1), extension at 72°C for 1 min, and a final extension at 72°C for 8 min. Amplification products were checked through 3% agarose gels prior to vertical electrophoresis using 6% denaturing polyacrylamide gels for genotyping through silver-staining (Creste et al., 2001). The product sizes were determined using a 10-bp DNA ladder (Invitrogen).
Table 1.

Characteristics of 17 microsatellite loci that successfully amplified in Philcoxia minensis samples.

LocusPrimer sequences (5′–3′)Repeat motifAllele size (bp)Ta (°C)GenBank accession no.
Pm01*F: CCAACAGAAAAGCCCTAACG(GA)1723460KR019066
R: GCCCACAGTCCCTTGAGTAT
Pm02F: AAGACGTTTGCCAGCCTTA(TAG)4(TGTA)317360KR019067
R: TGCATTTATCCCCACAGACA
Pm03F: CCCAGCTTCACCTCACTCTC(TCC)516160KR019068
R: CGTTAGGGCTTTTCTGTTGG
Pm04F: AGTTGCCTTCCATCATCGTT(GT)5(CT)815660KR019069
R: TGGCTGAGAATCACTGACAAA
Pm08*F: TGAAAACCCCAATCCCATAA(GT)823260KR019070
R: CACAGGCGTATCAAGGAAGA
Pm09F: TTGCTTTCCTCTCGGTGTTT(CT)1921460KR019071
R: CATTACTGCACCAAGCCTGA
Pm10F: TGGCCCTTCTCAGATCTTTC(AC)923960KR019072
R: ACATAGACCATTCGGGGAGA
Pm11F: CATTTTTCGTTGTTCCCACA(CA)11(TC)718355KR019073
R: TACATGCGTTCCAAGCCTAA
Pm13F: GCGTTCCTTTTTCGATCTGT(CA)1021360KR019074
R: AGCCATGGATATGTTCTCACC
Pm15F: TCCTAATTGCTTCACGAGCAT(AC)5(GA)521660KR019075
R: AGCTTTGTCAGGCAGCTCA
Pm16F: CCAAAGCTACACACCCAACA(AC)5(ACAAA)324460KR019076
R: TCATATGCTGGGCATACCTG
Pm18*F: AGTCACTGCTTTCAGCCTGTC(AG)2616160KR019077
R: ATGAGATTGCTGAGCCTCGT
Pm20F: ACTCATAGAGGACACACACAC(AG)10(AC)1019960KR019078
R: TTATTTAGGGGACGGAGAG
Pm21F: ATCGCTTCCTCCTCCTCTTC(CA)1018160KR019079
R: AACAAAGCTCGCTCGTTCTC
Pm22*F: TGATCGACTTCATGGACACC(TC)10(CA)918160KR019080
R: CGGGATTCTCTTGCTTAACG
Pm26*F: CTGGCGCTATCCTTCTCAAT(AC)1024660KR019081
R: TGGAGGATGTCTGTTTGTCG
Pm27F: TTTTTCCAAGAGTCTCTGCAC(CAAGC)422560KR019082
R: GAGTGAAAGGGTGGTTTGTGA

Note: Ta = specific annealing temperature.

*Monomorphic loci.

Characteristics of 17 microsatellite loci that successfully amplified in Philcoxia minensis samples. Note: Ta = specific annealing temperature. *Monomorphic loci. For polymorphism evaluation in P. minensis, we sampled a total of 30 specimens from the only known population, in Serra do Cabral (voucher: Scatigna, A. V. 43 [UEC]), Municipality of Joaquim Felicio, Minas Gerais State, Brazil (17°42′23″S, 44°11′39″W). Furthermore, four specimens of P. bahiensis from a population in Chapada Diamantina (voucher: Scatigna, A. V. 107 [UEC]), near the municipality of Piatã, Bahia State, Brazil (13°02′S, 41°57′W), were used to evaluate the transferability of the markers. Individuals were collected at a distance of at least 1 m to avoid sampling of clones. We ran the identity analysis test in CERVUS v. 3.0.7 (Kalinowski et al., 2007), allowing one mismatch to check if there were clones sampled. Statistical analyses were performed using Microsatellite Toolkit v.3.1.1 (Park, 2001) to calculate the number of alleles per locus (A), expected heterozygosity (He), observed heterozygosity (Ho), and polymorphism information content (PIC). FreeNA (Chapuis and Estoup, 2007) was used to identify the possible occurrence of null alleles (FNULL). Linkage disequilibrium (LD) testing was performed between all loci pairs using a G-test. For Hardy–Weinberg equilibrium (HWE), we followed the probability test approach (Guo and Thompson, 1992) using GENEPOP v. 4.2 (Raymond and Rousset, 1995). The unbiased estimator of Wright’s inbreeding coefficient (FIS) was calculated according to Weir and Cockerham (1984) using GENEPOP v. 4.2. Of 27 markers tested, 17 were successfully amplified, of which 12 loci were polymorphic, five were monomorphic, and 10 did not amplify after PCR optimization (Table 1). The same 17 primer pairs successfully amplified with P. bahiensis samples. No matching genotypes (clones) were found within the samples. A ranged from two to five, with an average of 3.5; Ho and He ranged from 0.00 to 0.77 and from 0.03 to 0.65, respectively (Table 2). The PIC values ranged from 0.032 to 0.577, showing medium levels of polymorphism (Table 2). Five loci showed significant deviation from HWE (Table 2). No significant LD between loci was detected when applying Bonferroni correction (P value for 5% = 0.000758), but null alleles were observed for two loci (null allele frequency estimate ≥0.2; Table 2). The significant and negative FIS values for Pm21 are due to an excess of observed heterozygote genotypes. It is likely that the significant and positive FIS estimates for the loci Pm10, Pm13, Pm15, and Pm16 (Table 2) can be explained by its proportions of null allele frequencies. These results were consistent with our expectations, because the population is apparently small and isolated, and the individuals propagate vegetatively.
Table 2.

Results of initial polymorphic microsatellite marker screening in the population of Philcoxia minensis (N = 30).

LocusAAllele size range (bp)HoHePICFISaFNULL
Pm023163–1810.30.2640.233−0.14−0.08
Pm032163–1650.0330.0330.03200
Pm044146–1660.50.4170.379−0.2−0.13
Pm094192–2200.640.6340.552−0.01−0.02
Pm104239–2690.0670.0980.0950.33*0.30b
Pm113177–1850.4480.4020.361−0.12−0.06
Pm134109–2150.3670.4340.3890.16**0.15
Pm154214–2200.3640.5180.4180.30**0.17
Pm162242–24400.0890.0831.00*0.71b
Pm204189–2010.5520.5910.5270.070.01
Pm215155–1850.7730.6550.577−0.18*−0.12
Pm273221–2270.4550.5020.3910.10.05

Note: A = number of alleles sampled; FIS = inbreeding coefficient index; FNULL = occurrence of null alleles; He = expected heterozygosity; Ho = observed heterozygosity; PIC = polymorphism information content.

Significant deviation from Hardy–Weinberg equilibrium: *P < 0.05 and **P < 0.01.

Markers with the probability of occurrence of null alleles.

Results of initial polymorphic microsatellite marker screening in the population of Philcoxia minensis (N = 30). Note: A = number of alleles sampled; FIS = inbreeding coefficient index; FNULL = occurrence of null alleles; He = expected heterozygosity; Ho = observed heterozygosity; PIC = polymorphism information content. Significant deviation from Hardy–Weinberg equilibrium: *P < 0.05 and **P < 0.01. Markers with the probability of occurrence of null alleles.

CONCLUSIONS

The SSR markers herein described are the first developed for P. minensis. These microsatellites are important tools for genetic studies in P. minensis and may be used to evaluate the genetic variability of the related species P. bahiensis, aiming to elucidate questions regarding genetic diversity, spatial genetic structure, mating system, and gene flow. Data from such studies may contribute to conservation and management plans for Philcoxia species.
  7 in total

1.  Underground leaves of Philcoxia trap and digest nematodes.

Authors:  Caio G Pereira; Daniela P Almenara; Carlos E Winter; Peter W Fritsch; Hans Lambers; Rafael S Oliveira
Journal:  Proc Natl Acad Sci U S A       Date:  2012-01-09       Impact factor: 11.205

2.  Performing the exact test of Hardy-Weinberg proportion for multiple alleles.

Authors:  S W Guo; E A Thompson
Journal:  Biometrics       Date:  1992-06       Impact factor: 2.571

3.  Microsatellite null alleles and estimation of population differentiation.

Authors:  Marie-Pierre Chapuis; Arnaud Estoup
Journal:  Mol Biol Evol       Date:  2006-12-05       Impact factor: 16.240

4.  Revising how the computer program CERVUS accommodates genotyping error increases success in paternity assignment.

Authors:  Steven T Kalinowski; Mark L Taper; Tristan C Marshall
Journal:  Mol Ecol       Date:  2007-03       Impact factor: 6.185

Review 5.  Conservation genetics in transition to conservation genomics.

Authors:  N Joop Ouborg; Cino Pertoldi; Volker Loeschcke; R Kuke Bijlsma; Phil W Hedrick
Journal:  Trends Genet       Date:  2010-04       Impact factor: 11.639

6.  Computational and experimental analysis of microsatellites in rice (Oryza sativa L.): frequency, length variation, transposon associations, and genetic marker potential.

Authors:  S Temnykh; G DeClerck; A Lukashova; L Lipovich; S Cartinhour; S McCouch
Journal:  Genome Res       Date:  2001-08       Impact factor: 9.043

7.  Primer3Plus, an enhanced web interface to Primer3.

Authors:  Andreas Untergasser; Harm Nijveen; Xiangyu Rao; Ton Bisseling; René Geurts; Jack A M Leunissen
Journal:  Nucleic Acids Res       Date:  2007-05-07       Impact factor: 16.971

  7 in total
  1 in total

1.  Microsatellite markers: what they mean and why they are so useful.

Authors:  Maria Lucia Carneiro Vieira; Luciane Santini; Augusto Lima Diniz; Carla de Freitas Munhoz
Journal:  Genet Mol Biol       Date:  2016-08-04       Impact factor: 1.771

  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.