| Literature DB >> 26288180 |
Yi-fan Feng1, Hua Guo1, Fei Yuan1, Min-qian Shen1.
Abstract
Stromal cell-derived factor-1 (SDF-1) has been confirmed to participate in the formation of choroidal neovascularization (CNV) via its two receptors: CXC chemokine receptors 4 (CXCR4) and CXCR7. Previous studies have indicated that the activation of Toll-like receptors (TLRs) by lipopolysaccharide (LPS) might elevate CXCR4 and/or CXCR7 expression in tumor cells, enhancing the response to SDF-1 to promote invasion and cell dissemination. However, the impact of LPS on the CXCR4 and CXCR7 expression in endothelial cells and subsequent pathological angiogenesis formation remains to be elucidated. The present study shows that LPS enhanced the CXCR4 and CXCR7 expression via activation of the TLR4 pathway in choroid-retinal endothelial (RF/6A) cells. In addition, the transcriptional regulation of CXCR4 and CXCR7 by LPS was found to be mediated by phosphorylation of the extracellular signal-related kinase (ERK) 1/2 and activation of nuclear factor kappa B (NF-κB) signaling pathways, which were blocked by ERK- or NF-κB-specific inhibitors. Furthermore, the increased CXCR4 and CXCR7 expression resulted in increased SDF-1-induced RF/6A cells proliferation, migration and tube formation. In vivo, LPS-treated rat had significantly higher mRNA levels of CXCR4 and CXCR7 expression and lager laser-induced CNV area than vehicle-treated rat. SDF-1 blockade with a neutralizing antibody attenuated the progression of CNV in LPS-treated rat after a single intravitreal injection. Altogether, these results demonstrated that LPS might influence CNV formation by enhancing CXCR7 and CXCR7 expression in endothelial cells, possibly providing a new perspective for the treatment of CNV-associated diseases.Entities:
Mesh:
Substances:
Year: 2015 PMID: 26288180 PMCID: PMC4545586 DOI: 10.1371/journal.pone.0136175
Source DB: PubMed Journal: PLoS One ISSN: 1932-6203 Impact factor: 3.240
Primer pairs used for analysis.
|
|
|
|
|
|---|---|---|---|
| Macaca mulatta | GAPDH | ctttggtatcgtggaaggactc | gtagaggcagggatgttct |
| Macaca mulatta | CXCR4 | atcctcatcctggctttcttc | caaactcacacccttgcttgat |
| Macaca mulatta | CXCR7 | tgccagacacctactacctgaa | gaagcccaagaccacagagac |
| Macaca mulatta | TLR4 | tgtcccagcacttcatccag | gggtcttctccaccttctgc |
| Rattus norvegicus | GAPDH | gatgacccagatcatgtttga | gagagcatagccctcgtag |
| Rattus norvegicus | CXCR4 | tgcagcaggtagcagtgaaa | tgtatatactcacactgatcggttc |
| Rattus norvegicus | CXCR7 | ggacaccccacaaatcactct | ggagccttccgttcttaggg |
GAPDH = glyceraldehyde-3-phosphate dehydrogenase; CXCR4/7 = chemokine (C-X-C motif) receptor 4/7; TLR4 = toll like receptor 4.